MIME-Version: 1.0 Content-Type: multipart/related; boundary="----=_NextPart_01C8E823.DA10E9A0" This document is a Single File Web Page, also known as a Web Archive file. If you are seeing this message, your browser or editor doesn't support Web Archive files. Please download a browser that supports Web Archive, such as Microsoft Internet Explorer. ------=_NextPart_01C8E823.DA10E9A0 Content-Location: file:///C:/8E69C634/Classof2004.htm Content-Transfer-Encoding: quoted-printable Content-Type: text/html; charset="windows-1252" CHSAA Hall of Fame

This presentation contains content that your browser may not be able to = show properly. This presentation was optimized for more recent versions of Micro= soft Internet Explorer.

If you would like to proceed anyway, click here.

------=_NextPart_01C8E823.DA10E9A0 Content-Location: file:///C:/8E69C634/Classof2004_files/master04.htm Content-Transfer-Encoding: quoted-printable Content-Type: text/html; charset="windows-1252"
Click to edit Master title style
Click to edit Master text styles
Second level
Third level
Fourth level
Fifth level
‹footer›
‹#›<= span style=3D'font-size:58%;mso-special-format:lastCR'>
------=_NextPart_01C8E823.DA10E9A0 Content-Location: file:///C:/8E69C634/Classof2004_files/master04.xml Content-Transfer-Encoding: quoted-printable Content-Type: text/xml; charset="utf-8" ------=_NextPart_01C8E823.DA10E9A0 Content-Location: file:///C:/8E69C634/Classof2004_files/preview.wmf Content-Transfer-Encoding: base64 Content-Type: image/x-wmf AQAJAAADLFYAAAEAoScAAAAAFhAAACYGDwAiIFdNRkMBAAAAAAABAI0RAAAAAAMAAAAAIAAAPDgA ADxYAAABAAAAbAAAAAAAAAAAAAAAvwMAAM8CAAAAAAAAAAAAADB1AADkVwAAIEVNRgAAAQA8WAAA BgAAAAIAAAAAAAAAAAAAAAABAAAABAAAAAMAAEABAADwAAAAAAAAAAAAAAAAAAAAAOIEAICpAwAx AAAAEAQAAAEAAAAAAwABAAAAAIAAAAAAgAAAgIAAAAAAgACAAIAAAICAAMDAwADA3MAApsrwAAQE BAAICAgADAwMABEREQAWFhYAHBwcACIiIgApKSkAVVVVAE1NTQBCQkIAOTk5AP98gAD/UFAA1gCT AMzs/wDv1sYA5+fWAK2pkAAzAAAAZgAAAJkAAADMAAAAADMAADMzAABmMwAAmTMAAMwzAAD/MwAA AGYAADNmAABmZgAAmWYAAMxmAAD/ZgAAAJkAADOZAABmmQAAmZkAAMyZAAD/mQAAAMwAADPMAABm zAAAmcwAAMzMAAD/zAAAZv8AAJn/AADM/wAAAAAzADMAMwBmADMAmQAzAMwAMwD/ADMAADMzADMz MwBmMzMAmTMzAMwzMwD/MzMAAGYzADNmMwBmZjMAmWYzAMxmMwD/ZjMAAJkzADOZMwBmmTMAmZkz AMyZMwD/mTMAAMwzADPMMwBmzDMAmcwzAMzMMwD/zDMAM/8zAGb/MwCZ/zMAzP8zAP//MwAAAGYA MwBmAGYAZgCZAGYAzABmAP8AZgAAM2YAMzNmAGYzZgCZM2YAzDNmAP8zZgAAZmYAM2ZmAGZmZgCZ ZmYAzGZmAACZZgAzmWYAZplmAJmZZgDMmWYA/5lmAADMZgAzzGYAmcxmAMzMZgD/zGYAAP9mADP/ ZgCZ/2YAzP9mAP8AzADMAP8AAJmZAJkzmQCZAJkAzACZAAAAmQAzM5kAZgCZAMwzmQD/AJkAAGaZ ADNmmQBmM5kAmWaZAMxmmQD/M5kAM5mZAGaZmQCZmZkAzJmZAP+ZmQAAzJkAM8yZAGbMZgCZzJkA zMyZAP/MmQAA/5kAM/+ZAGbMmQCZ/5kAzP+ZAP//mQAAAMwAMwCZAGYAzACZAMwAzADMAAAzmQAz M8wAZjPMAJkzzADMM8wA/zPMAABmzAAzZswAZmaZAJlmzADMZswA/2aZAACZzAAzmcwAZpnMAJmZ zADMmcwA/5nMAADMzAAzzMwAZszMAJnMzADMzMwA/8zMAAD/zAAz/8wAZv+ZAJn/zADM/8wA///M ADMAzABmAP8AmQD/AAAzzAAzM/8AZjP/AJkz/wDMM/8A/zP/AABm/wAzZv8AZmbMAJlm/wDMZv8A /2bMAACZ/wAzmf8AZpn/AJmZ/wDMmf8A/5n/AADM/wAzzP8AZsz/AJnM/wDMzP8A/8z/ADP//wBm /8wAmf//AMz//wD/ZmYAZv9mAP//ZgBmZv8A/2b/AGb//wClACEAX19fAHd3dwCGhoYAlpaWAMvL ywCysrIA19fXAN3d3QDj4+MA6urqAPHx8QD4+PgA//vwAKCgpACAgIAA/wAAAAD/AAD//wAAAAD/ AP8A/wAA//8A////ADAAAAAMAAAAAQAAABUAAAAMAAAAAwAAAE0AAACUTwAAAAAAAAAAAAC/AwAA zwIAAAAAAAAAAAAAwAMAANACAAAgAMwAAAAAAAAAAAAAAIA/AAAAAAAAAAAAAIA/AAAAAAAAAAD/ //8AAAAAAGwAAAAoBAAAlAQAAABLAACgAAAAeAAAACgAAACgAAAAeAAAAAEACAAAAAAAAEsAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAACAAACAAAAAgIAAgAAAAIAAgACAgAAAwMDAAMDcwADwyqYABAQE AAgICAAMDAwAERERABYWFgAcHBwAIiIiACkpKQBVVVUATU1NAEJCQgA5OTkAgHz/AFBQ/wCTANYA /+zMAMbW7wDW5+cAkKmtAAAAMwAAAGYAAACZAAAAzAAAMwAAADMzAAAzZgAAM5kAADPMAAAz/wAA ZgAAAGYzAABmZgAAZpkAAGbMAABm/wAAmQAAAJkzAACZZgAAmZkAAJnMAACZ/wAAzAAAAMwzAADM ZgAAzJkAAMzMAADM/wAA/2YAAP+ZAAD/zAAzAAAAMwAzADMAZgAzAJkAMwDMADMA/wAzMwAAMzMz ADMzZgAzM5kAMzPMADMz/wAzZgAAM2YzADNmZgAzZpkAM2bMADNm/wAzmQAAM5kzADOZZgAzmZkA M5nMADOZ/wAzzAAAM8wzADPMZgAzzJkAM8zMADPM/wAz/zMAM/9mADP/mQAz/8wAM///AGYAAABm ADMAZgBmAGYAmQBmAMwAZgD/AGYzAABmMzMAZjNmAGYzmQBmM8wAZjP/AGZmAABmZjMAZmZmAGZm mQBmZswAZpkAAGaZMwBmmWYAZpmZAGaZzABmmf8AZswAAGbMMwBmzJkAZszMAGbM/wBm/wAAZv8z AGb/mQBm/8wAzAD/AP8AzACZmQAAmTOZAJkAmQCZAMwAmQAAAJkzMwCZAGYAmTPMAJkA/wCZZgAA mWYzAJkzZgCZZpkAmWbMAJkz/wCZmTMAmZlmAJmZmQCZmcwAmZn/AJnMAACZzDMAZsxmAJnMmQCZ zMwAmcz/AJn/AACZ/zMAmcxmAJn/mQCZ/8wAmf//AMwAAACZADMAzABmAMwAmQDMAMwAmTMAAMwz MwDMM2YAzDOZAMwzzADMM/8AzGYAAMxmMwCZZmYAzGaZAMxmzACZZv8AzJkAAMyZMwDMmWYAzJmZ AMyZzADMmf8AzMwAAMzMMwDMzGYAzMyZAMzMzADMzP8AzP8AAMz/MwCZ/2YAzP+ZAMz/zADM//8A zAAzAP8AZgD/AJkAzDMAAP8zMwD/M2YA/zOZAP8zzAD/M/8A/2YAAP9mMwDMZmYA/2aZAP9mzADM Zv8A/5kAAP+ZMwD/mWYA/5mZAP+ZzAD/mf8A/8wAAP/MMwD/zGYA/8yZAP/MzAD/zP8A//8zAMz/ ZgD//5kA///MAGZm/wBm/2YAZv//AP9mZgD/Zv8A//9mACEApQBfX18Ad3d3AIaGhgCWlpYAy8vL ALKysgDX19cA3d3dAOPj4wDq6uoA8fHxAPj4+ADw+/8ApKCgAICAgAAAAP8AAP8AAAD//wD/AAAA /wD/AP//AAD///8AbZFtkW2RbZFtkW2RbZEAAAAAAAAAAAAAAAAAAAAAAAAAAAAhACEAQgAAAEIA IQBCAEIAQwBDAEMAQgBDAEIAQwBCAEMAQgBDAEIAQgBCAEMAQgBDAEIAQwBCAEMAQgBDAEIAQgBC AEMAQgBCAEIAQwBCAEIAQgBCAAAAQgAhAEIAAABCACEAQgAAAEIAAABCAAAAAAAAAAAAAAAAAAAA AJFtkq6SrpKukW2SrpGuQzxDPEM8PTxDPD0AQzw9PEM8QzxDPEM8ZjxmPGY8ZjxmX2Y8ZmZmZmZm ZjxmX2ZfZl9mPGZfZl9mZWZfZmBmX2ZmZl9mX2ZfZmVmX2ZlZmVmZWZlZmVmPGZfZjxmX2Y8Zl9m PGY8ZjxmPGY8ZjxmPGY8ZjxmPGY8ZjxmPGY8QzxmPEM8QzxDPEM8QzxDPEM8QwBtkW2RrpFtkW2R bZGukQA8AD0APDw9ADwAPQA8PEM8PDxCPEI8ZjxmPGY8ZTxmPGY8ZjxmZmY8Zl9mX2ZfZl9mX2Y8 Zl9mX2ZfZl9mX2ZfZl9mPGZfZjxmX2ZfZmVmZWZlZmVmX2Y8ZjxmPGZfZjxmPGY8ZjxmPGY8Zjxl PGY8ZjxmPEI8ZjxCPGY8QjxDPD08Qzw9PD08PDw9PDw8PQAAkq6SrpKukq6SrpKukq5DPEM8QzxD PEM8QzxDPGY8ZjxmPGY8ZjxmPGZlZjxmZWZfZmVmZWZmZmBmZmZfZmZmX2ZmZl9mZmZlZmZmZoZm ZmBmZmZfZmZmX2ZmZl9mZmZlZmVmZWZlZl9mYGZfZmZmX2ZfZjxmZmY8ZmVmPGZCZjxmPGY8Zjxm PGY8ZjxmPGY8ZjxDPGY8QzxDPEM8QzxDAG2RbZFtkW2RbZFtkW2RADwAPAA8ADwAPAA8PEI8PDxC PDw8ZjxlPGY8ZTxmPGU8ZjxmX2Y8Zl9mX2ZfZjxmX2ZfZl9mX2ZfZl9mX2ZfZl9mX2ZfZjxmX2Y8 Zl9mPGZlZmVmZWY8ZjxmPGY8ZjxmPGY8ZjxmPGY8ZjxlPGY8ZTxmPEM8ZjxCPGY8QjxCPDw8Qjw8 PD08PDw9PDw8PAA8AACRbZKukq6SrpKukq6RbUM8PTxDPEM8QzxDPGY8ZjxmPGY8ZjxmPGZlZmVm ZWZlZmVmZWZlZmVmZWZlZmVmX2ZlZmWGZmZfhmZmZoZmZmCGZmZfZmVmX2ZfZl9mZmZfZmVmZWZm ZmVmZWZfZmZmX2ZfZl9mZWY8ZmVmPGZlZjxmPGY8ZkJmPGY8ZjxmPGY8ZjxDPGY8QzxmPEM8QzxD PEMAbZFtkW2RbZFtkW2RbZEAPAA8ADw8Qjw8PEM8QjxmPGU8ZjxmPGY8ZjxmPGZlZjxmZWZfZl9m X2ZfZl9mX2ZfZmVmZWZlZl9mX2ZfZl9mX2ZfZl9mX2ZfZl9mX2ZfZl9mZWZlZmVmPGZfZjxmX2Y8 Zl9mPGY8ZjxlPGY8ZjxmPGY8ZjxmPGY8QzxmPEI8Qzw8PEM8PTw9PDw8Qzw8PD0AAJKukq6SrpKu kq6SrpKuQzxDPEM8QzxDPGY8ZjxmPGY8ZmVmX2ZlZmVmZWZlZmVmZWZlZmVmZWZlhmZmZYZmhmWG ZoZlhmVmZYZmZmaGZmZlhmZmYIZmZl9mZWZlZmVmZYZmZmVsZWZlZmZmX2ZmZl9mZmZlZmVmX2Zl ZkJmZWY8ZkJmPGZCZjxmPGY8ZjxmPGY8ZjxmPEM8ZjxDPEM8QwBtkW2RbZFtkW2RbZFtkQA8ADwA PAA8PEI8PDxmPGU8ZTxlPGY8ZV9mPGVlZjxlZWY8ZmVmX2ZfZl9mX2ZfZmVmZWZlZl9mX2ZfZl9m X2ZfZl9mX2ZfZl9mX2ZfZl9mZWZlZmVmQmZlZjxmX2Y8Zl9mPGY8ZjxmPGY8ZTxmPGU8ZjxlPGY8 ZTxmPEI8Qzw8PEM8PDw8PDw8Qzw8PDw8PAAhkW2SrpFtkq6RbZKuka5DPEI8QzxDPGY8ZjxmPGY8 ZmVmX2ZlZmVmZWZlZmVmZWZlZmVmZWZlhmVmZYZlhmWGZYZlhmWGX4ZlZl+GZWZfhmZmX4ZmZl+G ZWZlZmVmZYtlZmWLZWZlZmVmX2ZgZl9mZWZfZl9mPGZlZjxmZWY8ZkJmPGY8ZjxmPGY8ZjxmPGY8 QzxmPEM8ZjxDPEM8QzxDAG2RbZFtkW2RbZFtkW2RADw8Qjw8PEM8QjxmPGU8ZjxlX2Y8ZmVmX2Zl Zl9mZWZlZgAAAABlZmUAAIYAAGUAAGYAAABmZQAAAF8AAABfZgAAX2YAAF9mAABlZgAAAAAAZgBs ZQAAAGUAAAAAZl8AAGY8AABmPGY8ZjxmPGU8ZjxlPGY8ZTxmPGY8ZjxCPEM8QjxDPDw8Qzw8PEM8 PDw8AACSrpFtkq6SrpKukq6SrkM8QzxDPGY8ZjxmQmZCZmVmZWZlZmWGZWZlhmVmZYZlhhkZGRll AGYZGYYZGQAZGYYZGRkAZRkZGQAZGRllhhkZAIYZGWWGGRllhhkZGRkZhhmLABkZGWUZGRkZZl8Z GWZfGRkAX2ZlZmVmZWY8ZmVmQmZlZkJmQmY8ZkJmPGY8ZjxmPGY8ZjxDPGY8QzxDPEMAbZFtkW2R bZFtkW2RbZEAQjw8PEM8QjxmPGU8ZjxlZWY8ZmVmX2ZlZl9mZWZfZmUZZWZlGQAZAIYAZhkAGQBl GQAZAIYZABkAXxkAZl9mGQAAGQBmGQBlAF8ZAIYZABkAGQBlGQBlGQAZAF8ZAAAAZjwZPGY8ZTxm PGU8ZjxlPGY8ZTxmPGU8ZjxCPGY8QjxCPDw8Qzw8PEI8PDw8PDwAAJFtkq6RbZKukq6SrpGuQzxD PGY8ZjxmQmZlZmVmZWZlZmWGZWZlhmWGZYZlhmWGZYYAGRmGGYsZAGUZABkAhhkAGYtlGQAZZYYZ AGWGZRkZGRkAZRllGQCGGQAAGQAZABkAABkAZRkAGQBmGRkZAGUZAABlZmVmZWZlZmVmPGZlZkJm ZWY8ZkJmPGZCZjxmPGY8ZjxmPGY8QzxDPEM8QwBtkW2RbZFtkW2RbZGukTxCPEM8QjxmPGU8ZkJm ZWZfZmVmZWZlZl9mZYZlZmWGZWYZGWWGAIYZGWWGGRkZhmUZGYtlhhkZZYZlGQBmZYYZZgAZZWZl GRlmGRkZGRkZGWYZGRkZZRkZGRlmX2YZGV9lGRlfZmVmPGZlZjxlPGY8ZUJmPGY8ZjxlPGY8Qjxl PEI8QzxCPEM8PDxCPDw8PAAAkq6SrpKukq6SrpKukq5DPGZCZjxmQmZlZmZmZWZlZmWGZYZlhmWG ZYZmhmWGZYYZhgAAGQCGi2WLhhkAi4aGZYuGi2WLpotlixkAZYZmhhkZAABlhmaGZYYZhmaGAIZl hmaGZQBlGWVmAGZlZmVmZWZlZmVmZWZlZmVmZWZlZmVmZWZCZkJmPGZCZkJmQmY8ZkJmPGY8Qzxm PEM8QzxDAG2RbZFtkW2RbZFtka6RPEI8QjxlPGU8ZjxmZWZfZl9mX2ZfZl9mZYZfZmWGZYZlhhkZ GRllhmWLZRkZhmWGZYZlZmWGZaZlhhkZZYZlZhkZGRllhmVmZYZlZmVmGWZlZl9mXxlfZl9mGWVf ZTxlX2ZfZWVmQmVlZjxlPGU8ZTxmPGU8ZTxlPGY8QjxlPEI8QjxCPEI8PDxCPDw8PDw8AACSrpKu ka6SrpGukq6SrmY8ZjxmZWZlZmVmZWZlZmWGZYZlhmWGZYZmhmWGZYZlhmWGZYumi2WLpotli6aG ZYumhmWLZYtli6aGZYZlhmWGZYZli2WGZYtlhmWGZYZlhmWGZYZlZmWGZWZlZmVmZYZlZmVmZWZl ZmVmZWZlZjxmZWZCZmVmPGZCZjxmQmY8ZkJmPGY8ZjxmPEM8QzxDPEMAbZFtkW2RbZFtka6RrpI8 QjxmPGU8ZjxlX2ZfZmVmX2ZlZmVmZYZlhgAAAIZlhmWGZYZlpmWLZYtli2WGZYZlhmWGZYZli2WG ZYZlpmWGZYZlhmWGZYtlhmWGZWZlhmVmZWZfZmVmX2ZlZl9lZWZfZmVmX2ZlZkJmZWY8ZTxmPAAA ADxlPGY8ZTxmPEI8ZjxCPGY8QjxCPDw8Qjw8PDwAAJKukq6SrpKukq6SrrWuZjxmZWZlZmVmZWZl ZmWGZYZlhmWGZYumhhkZGQBli6aGpoamhmWLpoumi6aLpoumi6aLpoumi4qLpoumhmWGpoZli4aL ZYuGi2WLZotli2WGZYZlhmWGZYZlhmWGZYZlhmWGZWZlZmVmZWZlZmVmZRkZGQBmQmZlZjxmQmY8 ZkJmPGZCZjxmPGY8ZjxDPEM8QwBtkW2RbZFtkW2RrpKukTxmPGU8ZjxlX2ZfZl9mXwAAAGUAAAAA AGWGABkAhgAAZQAApmUAAKZlAACLpgAAi2UAAAAAi2UAAIsAAAAAAABlAACGAAAAAGUAAAAAAAAA ZYYAAAAAXwAAhmVmAAAAAABmAABlZgAAAGUAAAAAAGVfABkAPAAAZQAAPEI8ZjxCPEI8QjxCPDw8 Qjw8PEI8PAAAkq6SrpKukq6SrrWuta5mQmZlZmVmZWZlhmWGZRkZGWUZGRkZGWWLGRkZABkZABkZ hqYZGYumGRkAphkZi6YZGRkZiwAZGYsZGRkZGRkAGRmGGRkZGWUZGRkZGRkZZYYZGRkZZRkZAGWG GRkZGRkAGRllixkZGWYZGRkZGWZlGRkZABkZABkZQmZCZkJmPGZCZjxmPGY8ZjxDPGY8QzxDAK6R bZFtkW2RrpGuta61PGY8Zl9mX2ZfZmWGZYZlGQCGGQBlGQCGGQCmGQCLGQAZAKYZAAAAi6YZposZ AKaLGYumixkAGQCmGRkZAIYZABkAGQBlGQCGGRkZAGUZAIYZAGUZAIZlGWVmZYYZAGUZABkAbGVm GQBCGQBmGQBlGQBlGQA8GQAZAGU8ZjxlPGY8QjxmPEI8QjxCPEM8PDw8AACSrpKukq6SrrWutZG1 kWZlZmVmZYZmhmWGZYZlhhkAABkAixkAphmmABkAABkAGQCLGRkZAKYZAACmGQAAhoumABkZphkA AIsAGYumGQAZABmGABkAhosAGYaGGQAAGWUAGQBlGQAAZYtmGQCLGQAZAGWLZRkAABkAZRkAZhlm ABkAABkAGQBCZkJmQmZCZjxmQmY8ZjxmPGY8QzxmPEMAbZFtkW2RrpGuka61rrQ8ZjxlX2ZfZmWG X4ZlhmUZGRkZABkZpqamGRkZGYsZGRmGpoYZGaaLGRmmGRkZpoamGRmGphkZGaYZGYumGRkZGYZl GRkZAIYZGWWGGRkZGWUZGRkAixkZZYtlGRmLGRkZGWVlZWwZGRkZABkZZTxlGRkZGUIZGRk8ZTxC PGU8ZTxlPEI8QjxCPEM8PDxCPDwAAJKukq6SrrWuta61kbWRZmVmZWZlhmWGZYZlhqaGGQCmGQAA pgCmi6aLpoumGQCtpoumraatpq2mi6YZpoamGaYAABkAGaati4uKrYaLpoumi6aLGQCGi4aGpoaG hmWLposZAGuLa4tri2WLAItli2WLZYtlGQCLGQAAZgBmZWZlZmVmGQBCZkJmPGZCZjxmQmY8Zjxm PGY8QzxmPEM8QwBtkW2RrpKuka61rrWutTxmZWZfZmWGZYZlhmWGGRllGRkZphmmi6aGpoumGRmL poumraaGpq2mi6atpoami6YZGRkZhqaLpoumi6aLpoumhqaLGRmmi6aLpoZlhmWGZYsZGWWLa4tl i2WLGYtli2VlZWxlGRlsGRkZZRllZWZlZWVmGRllZjxlQmY8ZTxmPGU8ZTxCPEI8QjxDPDw8QwAA kq6SrrWuta61kbWutZFmZYZlhmWGZoZli4aLpoumi6atpoumraatpq2mraatpq2mrYatpq2LrYqt i62mrYuthq2Gi6athoumrYuthq2Gi6aLioumrYuLhq2Gi4aLhotli4uLa4uKi2uLbItri2uLZYtl i2WLZWxlbGVmZWxlZmVmZWZlZmVmQmZlZkJmQmY8ZkJmPGY8ZjxmPEM8ZjxDAG2RrpKuka61rrSu ta61X2ZfZmWGZYZlhmWGpoumi6aLpoumi6aLpq2mi6atpoumraatpq2mrYqtiq2KraaLpoumi6aL poami6aLpoumi6aLpoumi6aLpoumi6aGZYZli2WLZYtli2WLZYtli2VsZYtlbGVsZWZlZmVlZWZl ZWVlZWVlZjxlPGU8ZTxmPGU8ZTxCPGY8PDxCPDw8Qzw8AACSrrWuta61rrWutZG1kYZlhmWGZYZl i6aLpouGraati62mrYutpq2mraatiq2mrYutpq2trYqtra2Ks4uti62LrYuti62mraaLpgAAAKaL iouKrYuLpq2LrYathouGi4aLpouGi2WLZotli2WLZYtli2WLZYtli2VmZWxlZmVmZWZlZmVmZWZl ZkJmZWY8ZkJmPGY8ZjxmPGY8ZjxDPEMArpKukq61rrWuta61rrVfhmWGZYZlhmWGpoumi6aLpouK raatpq2mraatpq2mraatiq2mraatiq2KrYqtiq2KrYutiq2KraaLphkZGaaLpouKi6aLpoumi4aL pouGhmWGpotlhmWLZYZli2WLZYtlbGWLZWxlbGVmZWZlZWVmZWZlZmVlZWY8ZTxmPGU8ZjxlPGY8 QjxDPDw8Qzw8PD0AALWuta61rrWutZG1kbWRhmWLhoumi4aLpq2Graati62LrYutiq2Lraatra2L rQCtrbMAra0AAK0AAK0AAACtrYsAAACLAIutAACLGQAAAK2KAAAAhq2GAACtiwAArYaLAACGAACL AABlAACLZYsAAAAAZgAAi2YAAItli2WLZWZli2VmZWZlZmVmZWY8ZmVmPGZCZjxmPGY8ZjxmPGY8 QwCuka61rrWuta60rrWutWWGZYZli2WLpoumhqaLpoumraatiq2mraatpq2mrRkAiq0ZAMcZGQAZ GYoZGRkArYoZGRmLGaaLGRmmixkZGYsAGRkZpoumGRmLphkZAKaGGRllGRkAGRllGRmGZYYZGRkZ ABkZi2UZGWZlZWVmZWVlZmVlZWU8ZUJmPGU8ZTxlPGU8QjxlPEI8Qzw8PDw8PAAhta61rrWutZG1 rrWRtZGLpoumi4aLpq2Graatpq2mra2tiq2LrYqtra2mrYsZrQCtGa0ArRkAGQCtGQAZAK2zrRkA GQCtGQAAAKYZAK0ZAIYZAK2GGQAAAIuGGYaLGQAAAIYZABkAixkAZYtlGQCLGQAZAGUZAAAAbGWL ZWZli2VmZWZlZmVmZWZCZjxmPGY8ZjxmQmY8ZjxmPGY8QzxDAK61rrWuta61rrWutZG1ZYami6aL poumi6atpq2mraatiq2KrYqtpq2mraYZABkAGQAZAK0ZABkArBkAGayziq0ZABmtixkZGQCtGQAA GaaGGQAAABkZGQCmGQAAhhkZGQCGGQAZAGUZAABlhhkAABkAGQCGGRkZAGVmZWVlZmVmZWZCZWVm ZWZlZjxlPGU8ZTxmPEI8ZjxCPEI8PDw9AAC1kbWutZG1kbWRtZG7tIuGi4uti62Lraatp62mra2t ra2tra2tra2tra2tGQAZsxmzGQCtGRkZra0ZGa2zrbOtGRmtAK2LGRmtGRkZGYatGRkZGYatGRmG rRkZhq2GGRmLGRkZGYYZGRmGhhkZGYsZGRmLZYsZGWWLZYtli2VmZWxlZmVmZWZlZmVmQmZCZjxm QmY8ZkJmPGY8QzxmPEMArrWuta61rrWuta61kbWmi6aLiq2mi6atpq2mraatpq2Kraytpq3Hraat rBkAABkArBkAABkArK2Kraytiq2srRkAGQCmraatpqemp6aGpqemhqaLpoumixYQAAAmBg8AIiBX TUZDAQAAAAAAAQAAAAAAAAADAAAAACAAADwYAAA8WAAApoaGhqaGpoamhqaGZYamGWWGZYYZhmUZ AGZli2VmZYZlZWVmZWVlZmVlZWZCZWVmPGU8ZTxlPGU8QjxmPEI8Qjw8PEM8PAAAtZG1kbWutZG1 kbW0tbSLi62LrYutpq2Lraytra3Hra2trbOtra2tra2tGRkZrRmtGRkZGRmts62trLOts62zGRkZ Ga2ti62GrYathqeGp4athq2LrYathq2GrYaGhouGi6aLhoumi4aLhouGhmUZGYZli2WLZYtli2WL ZWZli2VmZWxlZmVmZWZCZkJmPGZCZjxmQmY8ZjxmPGY8QzxDAJG1rrWuta61kbWRtbS7houLrYqt iq2mrYqtpq3HrcetrK2sraytx62sraytrbOsra2zrK2traytrK2KraytrK2trYqthq2mrYanpqeG p6anhq2mi4atpouGi6aGpoamhqaLpoumi6aGpoZlhmWGZYZlhmWGZYtlZmWLZWZlZmVlZWZlZmVm QmU8ZjxlPGY8ZTxmPGU8QzxCPEM8Qjw8AAC7kbWRtZG1tLW0u7TctK2Lra2trK2trYqtra2tra2t rdSt1K3Urc6tzq2trdSt1K3UrbOt1K2zrdSts62tra2tra2tra2trYatp6eGp6enhq2GrYati62G rYathq2Gi6athouGrYaLhouGi4aGhoZlhmaLZYtli2WLZYtli2VsZYtlbGVsZWZlZmVmQmZlZkJm QmZCZkJmPGY8ZjxmPEMAkbSuta61rrWutLS7tLuGrYatiq2mrYqtpq3Hrcetx62sraytrK2srayt rK2sra2zra2ts6ytrLOsraytx63Hrcetx62mraatpqemp6Knhqemp4atpq2mraaGpoamhqaLpoum i6aLpotlhmWGX4Zfhl9mZWZlZWVmZWVlZmVmZWZlZWVmQmVCZTxlPGU8ZTxmPEI8QjxCPEI8PDxC PDwAALWRtZG1kbW0tbTctNy0ra2ti62traytrK3Hzq2trc6tzq3UrdSt1K3Orc6t1K3UrdSt1K3U rdSts63Ura2nzqetp62trcetp62GraenhqeGp4athq2GrYathq2Graathoumi4uLpouGi6aLhoZm hmaGZYZlhmWLZYZli2WGZYtlZmVsZWZlZmVmQmZlZkJmQmY8ZkJmPGY8QzxmPEM8QwCRta61rrWu tbS1tLu03Iati62Kraytiq2srcetrc6sra3UrAAAzqwAAM6sra0AAACt1K2tAACsAAAAra0AAKcA AAAArccAAACmrQAAAACmAAAAAKcAAACnAACmAACLposAAACLAAAAi6aLAAAAhgAAXwAAZgAAAGZl AABmZWYAAGVmZWVlZTxlPGY8ZUJmPGU8ZjxCPGY8PDxDPDw8QwAAu5G1kbW0tbTWtNy03LStra2t raytra2sra3Orc6tzq3UrRkZAK0ZGdStzq0ZGRmtAK3UGRmtGRkZrdQZGa0ZGRkZrQAZGRmtrRkZ GRmnGRkZGa0ZGRkAGRkAGRmthq0ZGRkAGRkZi4qLGRkZixkZABkZhhkZGQBlGRkAZYsZGWWLZWZl ZmVmZWZlZmVmZWZCZkJmPGZCZjxmPEM8ZjxDAJG1kbWutbS1tLW03LTci62LrYqtpq2Kraytrc6s zq3OrNStGQAAGQCszq0ZAK2tGa2tGQAAAK0ZAK0ZAAAApxkArRkAphkAraYZGRkApxkAGQCGGQAZ AK0ZABkApoumGQAZAIsZAKaLposZAGWGGQAZAF8ZABkAZmUZZWYZAAAAZWVlZjxlPGU8ZUJmPGU8 ZjxCPGU8QjxDPDw8PTw8AAC1tLW0tbTctNa03LTctK2tra2zra2sra2trc6tzq3UrdSt1BkZGRkA zq3UGQCt1K3UrRkZGQDOGQCtGRkZAM4ZAAAZra0ZAAAArAAZrYYZABkArRkAGa2LGQAZAK2mrRkA Ga2GGQAAhoumGQCGphkAGQCGGQAZhmUZAABlGRkZAGZlZmVmZWZlZmVmZWZlZmVmQmZCZjxmPGY8 ZjxDPEMAtLW0tbS1tLW01rTctNyGra2trK2sraytrK2szq3UrdSt1KwZrQAZzq3OrRkA1K3OANSt GRnOpxkAzqcZGa3HGRkZrK0ZGRkZrBkZraYZGRkZrYYZGa2mGRkZGa2mraYZGYumGRkZpoamABkA pgAZGRmGXxkZhmVmGRllZmUZGWVlZmVlZWU8ZWVmQmZlZkJlQmY8ZTxmPEI8Qzw9PD0AALu0u7Tc tNy03LTctNy0z63mrbOts62trdSt1M7UztTO1M7UzhkZAADUztQZ1AAAGQCz1K3Urc4ZAK3Op86t zhkArbOt1K2zrbOtra2tpxmnrQCtra2tra2tra2KrYutpq2GrYYZAACGGQAZABkAGQCLhoamhmWG ZYtli2WLZYtli2VmZWZlZmVmZWZlZmVmQmZCZkJmQmY8ZjxmPGY8QwC0tLS1tNa03LTVtNy03Ket p62traytrK2srazOrM7O1K3OrRkZGRnOrc6t1BkZGRms1KzUrK0ZGcetp87HrRkZrK2sraytrK2K rYqtpq3HrRmthq2KrYqtpq2KraaLpoumhqaGGRmmhhkZGRkZGRmGZYZlhmWGZYZlZWVmZWVlZmVl ZWVfZWVmPGVCZjxlQmY8ZTxlPEI8Qzw9PD08PAAhu7TctNy03LTctNy03LTmrc6tzq2trdStzq3U ztTO1M7UztTOzs7UztTO1NTU1NTU1LPUs9St1K3Op86nzq3OrdSt1K3UrbOtraytra2nra2tra2t ra2tra2KrYqtiq2KraatpoumrYaLhouGi6aLhoumi6aGZYtlhmWLZYtli2VmZWZlZmVmZWZlZmVm QmZCZkJmQmY8ZjxDPGY8QzxDALTctNy03LTctNy03LTcp86tzq2trc6szqzOrM6t1KzOztTOzs7O zs7O1K3U1NSz1NTastSz1KzOrM7Hzq3Op86t1K2zrbOsraytiq2sraatp62sra2tiq2Kraatiq2m raaLpoumi6aLpoamhqaLpoamhmWGZYZlhmWGZWVlZmVlZWZlZWVmX2ZlZkJlZWY8ZTxmPGU8ZjxC PEM8PTw9AADctNy03LTctNy03LTctOat5s7OrdXO1K3Uzs7O1M7UztTO1M7VztTO1dTU1NvU2tTa 2trU2tTUztTOzq3Ozs6t5s7VrdSts62zra2tra2tra2tra2tra2tra2ti62LrYqti62mrYuthq2G i4aLhouGi4aLpoumhmWGZYZli2WLZYtlZmVmZWZlZmVmZWZlZjxmZWY8ZkJmPGY8ZjxmPEMAtNa0 3LTctNy03LTctNynzqfOrc6tzq3Orc6tzqzOzs7Ozs7UztTO1M7U1NSz1NTa1NrU1LLU1NSs1K3O rc6nzqfOrc6traytrK2srcetra2tra2tiq2Kraatpq2mi6aLpoumi6aLpoumhqaGpoamhmWGZYZl hmWGZYZlZmVlZWZlZWVmX2VlZjxlQmY8ZTxlPGU8ZTxCPEI8PDxDPDwAANy03LTctNy03LTctNy0 5q3OzubOzs7Vzs7O1M7OztTO1M7VztTO1dTV1NvU1dTb1NrU2tTU1NrU1NTUzs6t5sjmp+atzq3U rbOt1K2trbOtra3Ura2sra2tpq2trYqti62KrYutpq2LrYathoaGhoaGpoumhmWGZYZlhmWGZYtl ZmWGZWZlZmVmZWZlZkJmQmY8ZkJmPGY8ZjxmPEM8QwC03LTctNy03LTctNy03KfOrc6tzs7Ozs7O zs7Ozs7Ozs7UztTO1NTV1NXU1dTV1NTU1NTU1NrU1NTUrdStzqfOp+anzq3OrK2ss6yzrbOsra2t rK2sraatpq2mraatpouKraaLpq2mi6aLpoamhqaGpoZlhmWGZYZlhmVmZWZlZWVmZWVlZmVlZWZC ZWVmPGU8ZjxlPGU8QjxDPD08PQAA3LTctNy13LTc1tzV3NXmzubO5s7VztXO1c7VztXO1c7V1NXU 1dTV1NvU1dTV1NXU1dTV1NvU2tTa1NTU1c7Op+bI5qfOrdSt1LPUs9Sz1K3Ura2tra2tp62trYat i62KrYutiq2LrYathq2Gi4aGpoaGhqaGpoZli2WGZYtlZmWLZWZlZmVmZWxlZmVmZWY8ZmVmPGZC ZjxmPGY8ZjxDAIaGhs+Gz4bPhouGz4bPpqempqanpqemraampq2mraatpqamraatpq2mpqatpq2m raampq2mraatpqaz1K3Orc6nzqfOp62ss6yzrLOss6ytrK2sraatpq2mp6atpoumraaLioumi6aL poamhqaGpoZfhmWGZYZlhmVlZWZlZWVmZWVlZmVlZWZCZUJlPGU8ZTxlPGU8QjxCPDw8PDw8AADP hs+Gz4bPhs+Gz4bPhqemp6atpq2mraatpq2mraatpq2mraatpq2mraatpq2mraatpq2mraatpq2m 1NTUztTOzq3Ozs6tzq3UrNSts6yzra2sra2tpq2nraathq2mrYutiq2KrYqti4umi4aGpoaGhqaG poZli2WGZYZlhmWGZWZlZmVmZWxlbGVsZWZlZmVmPGY8ZjxmPEM8ZjxDPEMAtNy03LTctNzV3LTc 1dzOzs7Uzs7O1c7UztTO1NTV1NXU1dTV1NXU29Tb1NXU1c7VztXO1NTVztTOzq3Us9St1K3Orc6t zq2trLOsraytpq3Hraatpq2mraatpoamraatpq2mi4qLpoumi6aGpoZlhmWGZYZlhmWGZYZlZmVm ZWZlZmVmZWZlZmVmQmVCZjxlPGU8QjxlPEI8Qzw8PEMAANy03LTc1tzW3Nbc1dzV5s7VztTO1dTV 1NXU1NTb1NvU29Xb1NvV29rb29vU1dXV5tXU1dTV1NXO5s7OztTU1NTUztSt1K3OrdSt1K3Ora2t ra2tp62nrYatp62mrYatpq2LrYqti62KrYuLpouGi6aLhotli2WGZYZlhmWGZYZli2VsZWxlbGVs ZWZlZmVmPGZCZjxmQmY8ZjxDPGY8QwC03LTctNzW3NXc1dzV3M7mzs7O1M7UztTO1M7Us9TU29TV 1Nuz29rb1NvU29TVztXO1M7Uzs7OzsjOyM6t1LPUrdStzq3Orc6szqytrK2srcetp62mraatpqem p6aGpoumi6aLpoumi6aLpotlhqaGZYZlhmWmZYZlZmWGZWZlZmVlZWZCZmVmQmVCZjxlPGY8ZTxm PEI8Qjw8PEM8PAAA3LTctNzV3Nbc1tzV3NXmzubO1dTU1NXU1M7V1NTU29Tb1Nva29rb29vb29XV 1dXm1dTV1NXO1c7myObO5s7U1NTO1c7UrdSt1K3Urc6tzq3Orc6traetp62GrYatpq2GrYathoum rYuLpouGi6aLpoumi6aGZYamhmWGZYZli2VmZWxlbGVsZWZlZmVmPGZlZjxmQmY8ZjxDPGY8QzxD ANXctNy03NXc1tzV3NXczs7O1c7UztTO1M7UztTO1M7U1NrU2tTb2tva29Tb1NXO1c7VztTU1M7O zubI5s7mztTO1K3UrdSt1K3UrdStzq2trc6nraetpq2Graatpq2mraatpoumi6aLpoumhqaLZYam hmWGZYZlhmWGZWZlZmVmZWZlZmVmQmZlZjxlPGY8ZTxmPEI8ZjxCPEM8PDxDAADc1dzV3Nbc1tzW 3Nbc1ebO1c7V1NXU1M7VztTO1M7U1NXU1dTb2tva29vb1NXV1ebV1NXU29TVztXO5s7mzubO1c7V ztXO1a3V1NWt1a3mreatzqfOra2tra2tra2trYutra2GrYaLpq2Gi6aLhoumi4aLpouGi2WLhoZl i2WLZYtlbGVsZWZlZmVmZWZlZjxmQmY8ZkJmPGY8QzxDPEMAtNzV3LTc1ty13NXc1dzOzq3UztTO 1M7Urc7Ozs7OztTN1M7U1NTU29Ta1NXO1c7VrdXU29TU1NTOzs7myObO5q3OztSt1K3Urc6tzq3O rc6nraetp62nraatpq2mrYqtpq2mraaGpoamhqaGZYZlhmWGZYZlhmWGZYZlhmVmZWZlZWVmZWVl ZjxlPGY8ZTxmPEI8ZTxCPEM8PDw8ADwAANzW3Nbc1dzW3Nbc1tzV1c7VztXUAAAAAAAA1M7UztTO AAAAAAAAAAAAANsAAAAAAADUAAAAANsAAAAAAObO5gAAAAAA1c7VzubO1c7mrebOzqfOp62nzq2t ra2tra2zra2LrYutpq2Gi6aLhoami4aGpoumi6aLhotli2WLZYtlbGVsZWZlZmVmZWZlZkJmQmY8 ZjxmPGY8QzxDPEM8QwDW3NXc1dzV3Nbc1tzV3M7mztXO4uLi4uLiAM7UztTO4uLi4uLi4uLi4gDi 4uLi4uIA4uLi4gDi4uLi4gDO5uLi4uLiAAAAzubO5qfOzs6tzqfOp62nraetp62mra2tiq2Lraat pq2mhqaGpoamhmWGZYtli6aLZYtli2VmZWZlZmVmZWZlZl9mZWY8ZUJmPGU8ZjxCPGY8QjxCPDw8 PAAA3dbc1tzW3Nbd1t3W3NzV5tXV1eLi4uLi4gDU1NTU4uLi4gDU4uLi4uLU4uLi4uLi2+Li4uLa 4uLi4uLO1eLi4gDO4uLizubO5s7mzubOzq3mrc6n5q2tp62tra2zrbOts62ti62Lraathoumi4aL pouGi6aLi4uGi4aLZYtmi2WLZWZlZmVmZWZlZkJmZWY8ZkJmPGY8ZjxmPEM8QzxDANbc1tzV3Nbc 1tzW3LXc5tXO1c7i4uLi4uLU1NSt1OLi4uIAAOLi4uIA1NTi4uLiANTi4uIA2uLi4uIAzuLi4uIA AAAAAADIzqfOp86nzq3Op86nzqetp62mraytiq2Ls4qti62mraaLpoamhqaGpoZlhmWLZYtli2WG ZYtlZmVmZWZlZjxlZWY8ZUJmPGU8ZTxCPGU8QjxCPDw8QgA8AADc1t3W3Nbc1tzW3dzc3NXV1dXV 1OLi4uIAAADU1NTV4uLi4uLi4uLiANTb4uLi4gDb4uLiANTi4uLiAM7i4uLi4uLi4uIA5s7OyObO zs7mzs6t5q3Op62tra2trbOts62zrbOtrYuthq2mrYaLpoumi6aLhotli2aLZotmi2WLZYZlhmVm ZWZlZmVmZWY8ZjxmPGY8ZjxmPEM8QzxDPEMA1tzW3Nbc1dzW3Nbd3NzV1dTVztXi4uLi4uIA1NTU rQAAAADU4uLi4gDb1OLi4uIAAOLi4gAA4uLi4gDV4uLi4gDO4uLizs7OyM6nzq3Orc6tzqfOp62n ra2trK2ts4qtra2LrYutpoumi6aGpotlhqaLZYtli2WLZYtli2WLZWZlZmVmZWZCZWVmQmU8ZTxl PGY8QjxDPDw8Qjw8PDwAANzW3Nbd1tzW3Nbd3N3c1dXV1dXU4uLi4uLi1dTV1OLi4uIAAOLi4uLb 2uLi4uLi4uLi4uLi4uLi4uLV1NXi4uIA4uLizs7Ozs7Ozs7VztSt1c7Orc6tra3OrbOts62zrbOt rYuti62LrYutpouGi6aLhoumi4aLZouGi2aLZotli2aGZWxlZmVsZWZlZkJmPGZCZjxmPEM8ZjxD PEM8QwC03Nbc1tzW3LTc1tzW3M7VztXO1eLi4uIA1NQAAADU4uLi4uLi4uLa1Nri4uLi4uLi4uLi zuLi4uLU1NXO1eLi4uLizs7OyM6nzq3Orc6tzq3Orc6sra2trK2srYqtiq2KrYqtpq2mraaLpoum hqaGZYZlhmWGZYtlhmWLZWZlZmVmZWZlZWVmQmVCZTxlPGU8QjxCPEI8Qjw8PDwAPAAA3Nbc1tzW 3Nbc1tzW3NbV1NXU1dTi4uLiAADi4uIA29TV1NvU29Tb1NvU29rb1NvU1dTV1NXU1dTV1NXU1dTV 1NXO1M7OzubOzs7UztTO1M7OrdStzq3Ora2ts62zrbOtrYutra2LrYutpq2Gi6aLpoami6aLZYum i2WLZotli2VmZYtlZmVsZWZlZmVmPGY8ZTxmPGY8ZjxDPEM8QjxDANXc1tzW3Nbc1dzV3NXcztXO 1c7i4uLi4uLi4uLiANTa1NvU2tTb1NrU29Ta1NvU1dTVztTO1c7U1NTU1NTV1NTO1M7Ozs7Ozs7U ztTO1K3Orc6tzq3OrK2traytra2traytiq2Lraatpq2mhqaGZYZlhmWGZYtli2WLZWZli2VmZWZl ZmVmZWVCZkJlQmU8QjxlPEI8Qjw8PEI8PDw8AADc1tzW3dbc1tzW3Nbc3NXU1dTV4uLi4uLi4uLi 4trb2tva29Tb2tvU29rb1NvU29TV1NXO1c7V1NXU29Tb1NXU1dTU1NTO1M7U1NTU1NTUztTO1K3U rdSt1K2trdStra2tra2tra2thq2Graathoumi4aLpouGi2WLZYtli2WLZYtlZmVsZWZlZmVmQmZl ZjxmPGY8ZjxDPEM8QzxDPEIAtNzW3LXc1tzV3NXc1dzU1dTU1NvU2tra2tra27nb2tva29rb1NrU 2tTU1NvU1NTVztTO1K3OztTU1NTU1NTU1NTU1NTO1M7UztTU1KzUzs6szq3UrM6szqytra2sra2t pq2mraatpq2mhqaGpoami2WGZYZlhmWGZWZli2VmZWZlZmVmZWVlZkJlQmY8ZTxlPDw8Qjw8PDw8 PDw8ADwAANzW3Nbc1tzW3Nbc3Nzb1dTV1Nva29rb2uja6Nro2uja29rb2tvU29TV1NvU1dTV1NXO 1c7VztXU1NTb1NvU1dTV1NvU1NTU1NTU1NTUztTO1M7UztSt1K3OrdStra2tra2tra2thq2GrYat houmi4aLpoumi2WLZYZli2WLZYtlZmWLZWZlZmVmZWZlZkJmPGY8ZjxDPEM8QzxDPEI8QwDW3Nbc 1tzV3NXc1dzV3NTV1NvU2tra2tra29ro2uja29rb1NvU1dTU1NXU1dTV1NXO1c7OztTO1NTU1NTU 1NTU1NTU1NTa09TU1M7UztSs1K3UrNSt1KzOrc6tra2tp62traathq2Gp4atpoumi6aLpotli2WG ZYZlhmVmZWZlZmVmZWZlZkJlQmZCZUJlPEI8QjxCPEI8PDxCADw8PAAA3Nbc1t3W3Nbc1tzc3NzV 1dvb29rb2tra29rb2ujb29Tb2tvU29TV1NXU1dTV1NXU1c7VztXU1dTV1NTU1dTV1NXU1dTb1NrU 2tTU1NTU1NTU1NTO1M7UrdStzq3Ora2tra2tra2trYathq2Gi4uLiouLi6aLpotli2WGZYtlZmWG ZWZlZmVmZWZlZkJmQmY8ZjxmPEM8QzxDPEM8QzxCALTc1tzW3NbctNzV3LTc1NXU29Tb1Nra2rPa 1NrU2tTVs9TU1LPU1NWt1M7UztTO1c7UztTO1NTUrdTO1K3UztTO1NTU1NTU1NPUztTN1M7UrNTO 1K3Orc6sra2tx62traatiq2mraatpoumi6aLpotli2WLZaZlhmVlZWZlZmVmX2VfZjxlPGY8ZTxl PEI8Qjw8PEI8PDw8ADwAPAA8AADc1tzW3Nbd1tzW3Nzc1tXV29Xb29va29Ta1NXU1dTb1NXU1dTV 1NXU1dTV1NXU1dTV1NXU1NTV1NTU1c7UztXO1M7V1NTU2tTU1NTO1M7UztTO1M7UztTOzq3Ora2t ra2trK2trYuthq2mrYuLiouKi4qLpotli2WGZYZlZmWGZWZlZmVmZWZCZjxmQmY8ZjxlPGY8QzxD PEI8Qzw8PEMA1tzV3Nbc1tzW3Nbc1dzO1dTb1dvV29Ta1NTU1NTU1NTU1dTU1NXU1NTVztTU1dTV 1NXU1NTU1NTU1M7UztTOzs7UztTU1NPU1NTNzs7Ozs7O1M3Ozs6tzq3Op62traytrK2KrYqtpq2m i6aLioumi4qLZYtli2WGZYZlZmVmZWZlZjxlZWY8ZTxmPGU8ZTxCPEI8PDxCADw8PAA8ADwAANzc 3Nbd1t3W3Nzc1tzc1ebV1dvV29Xb1AAAAAAA1NvUAAAAAAAA1QAAAAAAANQAANsAAAAA1AAAAADV 1AAAAAAAAAAAANTUAAAAAADUzs7OAAAAAAAA1AAAAAAAAK0AAAAAAAAAAAAAAAAAAAAAAAAAAAAA i6aLZYtlhgAAAAAAAGVmAAAAAAAAQmY8ZjxmPGY8QzxDPEM8QzxCPEM8QgDV3NbctdzW3dbc1tzV 3M7VztXV27PVAOLi4uLiAADU4uLi4uLiAOLi4uLi4gDi4gDi4uLiAOLi4uIA1OLi4uLi4uLi4gDU 4uLi4uIArM6t4uLi4uLiAOLi4uLi4gDi4uLi4uLi4uLi4uLi4uLi4uLi4uLiAGWGZYZlZuLi4uLi 4gAA4uLi4uLiAGU8ZTxCPEI8PDxCPDw8PAA8ADwAPAAA3Nbc1t3W3dbd1tzc3NbV1dXm1dXb4uLi 4uLi4uIAAOLi4uLi4tTi4uLi4uLV4uLi4uLi4uLi4uLiANXi4uLi4uLi4uIA1OLi4uLiANTO1OLi 4uLi4q3i4uLi4uLi4uLiAKzi4uLi4uLi4uLi4uLi4uLi4ouLZYtli+Li4uLi4uLiAOLi4uLi4mZC ZkJlPGY8ZjxmPEI8QzxCPEM8PDxDANbd1tzW3dbd1t3W3NbcztXU1dTV4uLi4uLV1OLi4gDb4uLi 4gDV1OLi4uIA1OLi4tTb4uLi4uLi4tTO4uLi4uLi4uLi1NTi4uLi4tTU1K3U4uLi4gDOrOLi4uIA 4uLi4gAA4uLi4gCt4uLi4gCL4uLi4gCLZYtlhuLi4uIAZuLi4uIA4uLi4gBCZjxCPEI8QjxDPDw8 PAA8PDwAPAA8AADd1t3W3dbd1t3c3dzc3NXV29Xb1eLi4uIA1dXi4uLb1OLi4uIAAADi4uLiANvU 29QA4uLi4tTi4gAAAOLi4uIA2+LiAAAA4uLi4gDU1dTU1OLi4uIAAADi4uLiANTi4uLi4uLi4uIA huLi4uIAi+Li4uIAioumi2U0DAAAJgYPAF4YV01GQwEAAAAAAAEAAAAAAAAAAwAAADwYAAAAAAAA PFgAAOLi4uIAZeLi4uIA4uLi4gBmQmZCZkJmPGY8QzxDPEM8QzxDPEM8QgDW3Nbd1t3W3bXc1tzW 3NXVs9XU1eLi4uIA1dTV1NXU2+Li4uLi4uLi4uLiANTV1OLi4uLi1NTi4uLi4uLi4uLUreLi4uLi 4uLi4s7U1NTU1OLi4uLi4uLi4uLiAKwAAAAAreLi4uIAreLi4uIAi+Li4uIAi2WLZYbi4uLiAADi 4uLiPOLi4uIAAEI8QjxCPEI8PDw8PDwAPAA8ADwAPAAA3dbd1t3W3dzd1t3c3dzb1dvU1dXi4uLi ANTb1AAAANri4uLi4uLi4uLi4gDb1OLi4uLi1NvU2+LiANXi4uIAztXO4uIAzuLi4gDV1NTU1NTi 4uLi4uLi4uLi4gDi4uLiAADi4uLirYvi4uLiAKbi4uLiAIqLZYtlhuLi4uLi4uLiZeLi4uLi4gA8 ZjxmPGY8QjxDPEI8Qzw8AEM8PDxDANbd1t3W3dbd1t3W3dzc1dXU1dTV4uLi4gAA1OLi4gDb4uLi 4gDb1OLi4uIA1OLi4uLb1AAAANTi4gDi4uLiAM7O5uLiAOLi4uIAztTU1M7U4uLi4gDOrOLi4uIA rOLi4uLi4uLiraat4uLi4gCL4uLi4gCLZYtlZmVm4uLi4uLiZWbi4uLi4uI8QjxCPEI8QjxCADw8 QgA8ADwAPDw8AADd3N3c3dzd3N3c3dzd3NzV29XV1NXi4uLiAADi4uIA2uLi4uIAANvi4uLiAADi 4uIAAOLi4gDb4uLi4uLi4gDO1c7i4uLi4uLiANTO1dTUzuLi4uIAAM7i4uLiAACtra2tra2tra2t i+Li4uIAhuLi4uIAiotri2WLZWZlZmVmZWZlZuLi4uIAAABmPGY8QzxDPEM8QzxDPEM8QzxDPEMA 1t3W3dbd3N3c3dzd1t3V1dTV1NXO4uLi4uLi4uLiAOLi4uLi4gDi4uLi4uIA4uLi4uLi4uIA1OLi 4uLi4uIA1M7O4uLi4uLi4gDO1M7UzuLi4uLi4gDi4uLi4uIAra2tpq2KraatiuLi4uLiAOLi4uLi AItli2WLZWVlZjxlPGU8ZTzi4uLi4uIAPEI8QjxCADw8QgA8ADwAPAA8ADwAAN3W3dzd3N3c3dzd 3N3c1tXV1dXU1dTV4uLi4uLi4tvi4uLi4uLa4uLi4uLi29Ti4uLi4uLi1Nvi4uLi4uLi29TU1OLi 4uLi4uLO1c7UztXi4uLi4uKt4uLi4uLira2tra2tra2ti63i4uLi4obi4uLi4ouLi2WLZYtlhmVm ZWZlZkJmQuLi4uLiPGY8QzxDPEI8QzxCPEM8QzxDPDw8QwDW3dbd1t3c3Nzd3N3c3ebV1dXU1dTV 1NXU29Xb2+ja29rb2tra29rb2tva29Tb1NXU29TV1NvU2tTb1NrU2tTU1NTU1M7UztTO1M7Ozs6t zs7Urc6tzq3OrbOtra2trK2nraatiq2mrYatpoami6aLiotli2WLZWxli2VmZWY8ZTxmPGU8ZjxC PEM8QjxCPDw8QgA8ADwAPAA8ADwAPAAA3dzd1t3c3dzi3N3c3dzW1dbV1dXV1dXV29Xb2+Hb6Nvo 2+ja6Nrb2tvb29rb2tvU29Tb1NvU29rb2tva29Tb1NvU2tTV1NTO1c7UztXO1M7VztTO1c7OrdSt 1K2zra2tra2tra2LrYathoumrYaLpouLi2uLbItli2aLZWZlZmVmZWY8ZkJmPGZCZjxDPEM8QzxD PEM8QzxDPEM8QzxDANbc1t3W3Nbc1tzc3Nbd5tbP1dXV1NXU1bPV1dvV29voudva29rb2tuz2tTb 1NvU29TU1NXU1NTb1NrU2tTU1NSz1NTU1NTO1K3Ozs7Ozq3Orc6tzq3Orc6tra2trK2traatpq2m raatpoami6aLpotli2WLZWxlbGVmZWZlZUJmPGU8ZTxCPGU8QjxCPDw8PAA8ADwAPAA8ADwAPAA8 AADd1t3W3dbd3Nzc3dzd3NbW1tXW1dXV1dXV1dvV3Nvc2+jb6Nvo2uja29rb2tvU29Tb1NXU1dTb 1Nva29ra1NvU1NTV1NXU29TUztXO1M7UztTO1M7Orc6tzq3Ura2tra2thq2GrYathoumrYqLpoum i6aLZYtli2WLZYtlZmVmZWY8ZjxmPGY8QjxmPEI8QzxCAEM8QjxDPEI8Qzw8PEMA1t3W3Nbc1tzW 3Nzc3N3m1ubW5tXV1dXV1dXV1dXb1dvb6Nvb2+ja29rb1NvU29Tb1NXU1dTV1NXU29Ta1NrU1NTU 1NTU29Ta1NrU1M7Uzs7Ozq3Orc7Hzq2tra2traathq2mp4atpoumi6aLpoumi6aLZYtli2VsZWxl ZWVmPGU8ZjxlPGU8QjxCPDw8QgA8ADwAPAA8ADwAPAA8ADwAAN3c3dbd3N3W3dzc3N3c1tbX1tbV 1tXV1dXV1dXc1dzV3Nvo2+jb29vo29va29Tb1NvU1dTV1dXU29Tb1NvU2tTa1NrU29rb2tva29Tb 1NTU1M7Uzs7Ozq3Orc6tzq2tp62nrYathq2GrYaLiouLi6aLpotli2WLZYtlZmVmZWZlZmVmPGY8 ZjxmPEI8QzxDPEM8QjxDPEM8QzxDPEM8QwC13dzdtdzW3Nbc1tzW3NXW0NbV1c/V1dXm1ebV5tXV 1dXb29vb29Xb1Nva27Pb1NXU1c7VzubO1c7V1NXU1NTU1NTU1NPU1NrU2tra1NrU1NTUztSszsfO x62nrcetx62mp4anpoami6aGpoumhmWGZYZlhmVmZWxlZWVmPGU8ZTxlPGU8QjxCPDw8QgA8ADwA PAA8ADwAPAA8ADwAPAAA3dzd3N3c3dzd1tzc3NzW1dbW1tXV1dXV1dXV1dXV1dXb1dvb29Xb1dvV 29vb2tvU29TV1NXO1c7V1NXU1dTb1NXU1dTU1NrU2tTa1NrU29TU1NTO1M7Ozs6nzqfOp62nrYat hqemrYathq2Gi6aLpotli2WGZYtlZmVmZWZfZjxmPGZCZjxmPEI8QzxCPEM8QjxDPEIAQzxDPEM8 PTxDANbd1t3c3dzd3NzW3Nbc5tXV1tXV1dXV1dXV5tXm1ebV1dXV29Xb1NXV1dTb1Nva29Tb1NXO 1c7VztXO1NTV1NTU1dTU1NTU1NTU1NTU2tTU1NTO1M7Orc6tzsetx63HraetpqeGhqaGpoumhqaL ZYZlhmWGZYZlZmVmX2VfZTxlPGU8QjxCPEI8Qjw8AEIAPAA8ADwAPAA8AD0APAA8AADd1t3W3dzd 3OLc3dzd3NXV1tXW1dzV1dXW1dXV1dXV1dbV1dXb1dvV29XV1dvb29rb2tvU1dXV1NXU1dTV1NXU 1dTV1NXV1ebV5tXO1dTU1NXU1M7Vzs6tzq3Orc6traetp62GrYathq2GrYaLhoumi6aGZYtlhmWG ZWZlZmVmPGZCZjxmPEM8QzxDPEM8QjxDPEI8QzxDPEM8QzxDPEIAtdzW3dbd3N3c3Nzc1tzm1ebV 1dXV1dXVtNXV1c7V5tXO1dXV1NXU1bPV1NXU1dTbs9vU1dTVztWt1NTVztTO1a3VztXO5ubmqObm 5q3Ozs6tzq3Orc6tzqytra3Hraetpqemp4aGpoaGi4aLpoZlhmVlZWZlZWVmX2VfZTxlPGU8QjxC PEI8QgA8ADwAPAA8ADwAPAA8ADwAPAA8ADwAAN3c3dbd1t3c3dzi3N3c1tXV1dXV1dXc1dXV1dXV 1dXV1dXb1dXV29XV1NXV1dTV1dvU29TV1NXV1dTV1dXU1dXVztXm1ebV5ubm5ubmztXO5s7mzs6t zq3Orc6traetp62nrYanhq2GrYathoaGhqaGZYZlhmWGZWZlZmVmPGY8ZjxmPEM8QzxCPEM8QjxD PEIAQzxDPEM8PABDPDw8QwDc3dzc3N3W3dzc3N3c3dXW1dbV1dXV1dXV1dXV1dXV1dXV1NXV1dTV 1NXU1dTVztXU1dTV1NXO1c7VztXm1ebVztXO5s7VzubO5s7m5ubO5s7mrc6tzq3Ora2nraetx62G rYanhoaGhoaLhoaGhmWGZYZfZV9mX2ZfZjxlPGY8QjxCPEI8QjxCPEIAPABCADwAPAA8ADwAPAA8 ADwAPAAA4tzi3OLc3dzd3OLc4tzc1tzW3NXc1dXV3NXW1dzV1dXb1dvV29Xb1dvV1dXV1dXV1dXV 1dXV1ebV1dXO1ebV5tXm5ubm5ubO1ebm5tDm5ubmzuat5q3mreatraetra2nrafPhqiGhoaLhoaG hoaGZoZmhl+GZWZfZmVmPGY8ZjxmPGY8ZjxDPEM8QjxDPEM8QzxDPEM8QzxDPEM8QzxDANzd3N3c 3Nzc1tzc3dzi1dy03NXctNXV1ebV1dXV1dXV1NXU27PV1NXU1dTVrdXO1c7V5tXO1c7VztXO1a3m zubI5sjmyObI5sjmzubJ5ubmyOat5qfOrc6traethq2Gp4anhqeGhoaGX4Zfhl+GZYZfZl9mX2Zf ZjxmPGY8ZTxCPEI8QgA8ADwAPAA8ADwAPAA8ADwAPAA8ADwAPAA8AADd3N3c3Nzi3Nzc3dzi3Nzb 3Nzc3NzV1tXW1dbV1dXW1dvV29Xb1dvV1dXV1dXV1dXV5tXm1ebV5tXm1ebV5ubm5ubm5ubO5ubm 5ubm0ObQ5ubJ5ubmrdWtzq3Pra2GrYanhq2Gp4aMhoZghmaGZoZmhmWGZmZfZl9mX2ZlZjxmPGY8 QzxDPEM8QzxDPEIAQzxCPEM8PQBDPEI8QzxDPEMA1t3W3dzc3Nzc3Nzc3OLV3Nvc29zV3NXW1dbm 1ubWz9XV29Xb1dvV1dXV1dXV1ebV5tXm1ebV5tXm1ebV5ubm5snmyebm5s7m5ubm5ubmyebJ5qjm p+atzq2thq2GraanhqeGp4aGooZghl+GX4ZfZl9mX2ZfZjxmPGY8ZjxmPEI8Qjw8PDwAPAA8ADwA PAA8ADwAPAA8ADwAPAA8ADwAAN3c3dzd3N3c4tzc3OLc3NXc3NzV3NXW1dbW1tXW1dbm1tXb1dzV 3NXc1dbV1dXV1dbV1ebV1dXV1tXV5tXm1ebQ5tDm0ObQ5tbm5ubV5ubm5snmqObm5q3Vra2nraet hq2Gp4aohoyGhoaGZoZmhmCGZmZgZmBmX2ZmZkJmQmY8ZjxDPEM8QzxDPEM8QzxDPEM8QzxDPEM8 QzxDPEM8QwC13Nbd1t3c3Lvc3Nzc3NXVtNbV1tXW1dbP1ubWz9bm1s/V5tXV1dXWtNbV1dXV1dXm 1ebVztXm1c7V5tXP1ebmz+bm0Mnm5ubJ5ubmzubO5qfmp+an5qfmra2nraanhqemhoaGhoaihl+G X4ZfZl9mX2ZfZjxmPGY8ZjxmPEI8Qjw8ADwAPAA8ADwAPAA8ADwAPAA8ADwAPAA8ADwAPAAA3dbd 3N3c3dzd3N3c3dzc1dbV1tXW1dbW1tbW1tbm1tDQ5tbV1dXc1tzV1tXW1dXV1dXV1dXV1dXV1dXV 1ubW5tDm0ObQ5tDm5ubm5ubO5s7mp+ao5qfmreatraeths+GrYathoaGjIaGYIZmhmCGYGZgZmBm X2ZgZjxmPEM8Qzw8PEM8PDxDPD0AQzw8PEM8PDxDPDw8Qzw8AEM8PTxDANbd1t3c3dzd3N3c3dzd 1dbV1ubW5tbm1ubW5tbm1ubW0Nbm1tXc1dzW3NXW1dzV1dXb1dXU1dTV1dXV1dXW5tbm0Obm5tDJ 5snmyObO5q3mrean5qfmp8+nrYathq2Gz4athoaGhmCGYIZfZl9mX2ZgZl9gPGY8ZjxmPDw8Qjw8 PDwAPAA8ADwAPAA8ADwAPAA8ADwAPAA8ADwAPAA8AADd3N3c3dzd3N3c3dzi3NbW1tbW5tbQ1tDW 0Nbm1tXW5tbQ1tbd3N3c3dbc1dzV3Nvc29vb3NXb1NvV3NXc1dbm1ubQ5tDm0Obm5ubJ5ubmzubO 5q3mreanz6eths+nz4bPhoaGjIaGhoaGhmCGZoZgZmBmYGZgZjxmPEM8ZjxDPEM8QwBDPEM8QzxD PEM8QzxDPD08QzxDPEM8QzxDPEMA3N3c3bXd3N273dzd3N3W1tbW0NbP0NDQ0NDQ0ObQ5tbm1tbW td3d3bvc1ty01tXc29vb3LTb1dXU1dXW1dXV1ubQ5tDJ5snmyebJ5qfmp+anzqfmp62nrYanhq2G p4athoaGhmCGZoZgZl+GX2ZgZjxgPGY8YDxmPDw8PDw8ADwAPAA8ADwAPAA8ADwAPAA8ADwAPAA8 ADwAPAA8ADwAAOLd4tzd3N3c3dzd3N3c3dbX1tfW1tDW0NHQ19DR0NbQ1tbW1t3d4t3i3N3W3NXc 2+Hc4dzc29zV29Xc1dbV1tXW5tbm0ObQ5tDm0MnmyObI5qfmrc+nz6eths+GrYbPhq2GroaGhoZm hmaGZmZgZmBmX2ZfZjxmPEM8QzxCPEM8PDxDPEM8Qzw9PEM8PDxDPD08Qzw8AEM8QzxDPEM8QwDd 4t3i3N3c3dzd3N3c3dbX1t3W19DW0NDQ0dDR0NHQ0NDW0NbW3dzc3Nzb3Nvc29zc4dzh3NzV3NXc 1dbV1tXW1dbm0ObQyebm5snmyeanyafmp8+nrYathq2Gp4aGhoaGi4aGhoZgZmCGX2ZgZjxmX2Y8 ZjxmPDw8PTw8ADwAPABDADwAPQA8ADwAPAA8ADw8PAA8ADwAPABDADwAPQAA/93/3eLc4tzi3N3c 3dzd193X3dfX0NfQ1tDR0NfQ19DX1tfW3dbc3OHc3Nvh3OHc4uHi3OLc3Nbc1tzW3dfd1t3W1ubW 5ubm0ObQydDJ0KjmqOanz6ethq2GrYathouGrYaLhoaGhmaGZoZmZmZmYGZgZjxmPEM8ZjxDPEM8 QzxDPEM8QzxDPEM8QzxDPEM8QzxDPEM8QzxDPEM8QzxDAA4AAAAUBAAAAAEAABAAAAAAAAAAgAAA AACAAACAgAAAAACAAIAAgAAAgIAAwMDAAMDcwACmyvAABAQEAAgICAAMDAwAERERABYWFgAcHBwA IiIiACkpKQBVVVUATU1NAEJCQgA5OTkA/3yAAP9QUADWAJMAzOz/AO/WxgDn59YAramQADMAAABm AAAAmQAAAMwAAAAAMwAAMzMAAGYzAACZMwAAzDMAAP8zAAAAZgAAM2YAAGZmAACZZgAAzGYAAP9m AAAAmQAAM5kAAGaZAACZmQAAzJkAAP+ZAAAAzAAAM8wAAGbMAACZzAAAzMwAAP/MAABm/wAAmf8A AMz/AAAAADMAMwAzAGYAMwCZADMAzAAzAP8AMwAAMzMAMzMzAGYzMwCZMzMAzDMzAP8zMwAAZjMA M2YzAGZmMwCZZjMAzGYzAP9mMwAAmTMAM5kzAGaZMwCZmTMAzJkzAP+ZMwAAzDMAM8wzAGbMMwCZ zDMAzMwzAP/MMwAz/zMAZv8zAJn/MwDM/zMA//8zAAAAZgAzAGYAZgBmAJkAZgDMAGYA/wBmAAAz ZgAzM2YAZjNmAJkzZgDMM2YA/zNmAABmZgAzZmYAZmZmAJlmZgDMZmYAAJlmADOZZgBmmWYAmZlm AMyZZgD/mWYAAMxmADPMZgCZzGYAzMxmAP/MZgAA/2YAM/9mAJn/ZgDM/2YA/wDMAMwA/wAAmZkA mTOZAJkAmQDMAJkAAACZADMzmQBmAJkAzDOZAP8AmQAAZpkAM2aZAGYzmQCZZpkAzGaZAP8zmQAz mZkAZpmZAJmZmQDMmZkA/5mZAADMmQAzzJkAZsxmAJnMmQDMzJkA/8yZAAD/mQAz/5kAZsyZAJn/ mQDM/5kA//+ZAAAAzAAzAJkAZgDMAJkAzADMAMwAADOZADMzzABmM8wAmTPMAMwzzAD/M8wAAGbM ADNmzABmZpkAmWbMAMxmzAD/ZpkAAJnMADOZzABmmcwAmZnMAMyZzAD/mcwAAMzMADPMzABmzMwA mczMAMzMzAD/zMwAAP/MADP/zABm/5kAmf/MAMz/zAD//8wAMwDMAGYA/wCZAP8AADPMADMz/wBm M/8AmTP/AMwz/wD/M/8AAGb/ADNm/wBmZswAmWb/AMxm/wD/ZswAAJn/ADOZ/wBmmf8AmZn/AMyZ /wD/mf8AAMz/ADPM/wBmzP8Amcz/AMzM/wD/zP8AM///AGb/zACZ//8AzP//AP9mZgBm/2YA//9m AGZm/wD/Zv8AZv//AKUAIQBfX18Ad3d3AIaGhgCWlpYAy8vLALKysgDX19cA3d3dAOPj4wDq6uoA 8fHxAPj4+AD/+/AAoKCkAICAgAD/AAAAAP8AAP//AAAAAP8A/wD/AAD//wD///8AFAQAAAQAAAAD AQgABQAAAAsCAAAAAAUAAAAMAtACwAMJAgAA9wAAAwIBAAAAAIAAAAAAgAAAgIAAAAAAgACAAIAA AICAAMDAwADA3MAApsrwAAQEBAAICAgADAwMABEREQAWFhYAHBwcACIiIgApKSkAVVVVAE1NTQBC QkIAOTk5AP98gAD/UFAA1gCTAMzs/wDv1sYA5+fWAK2pkAAzAAAAZgAAAJkAAADMAAAAADMAADMz AABmMwAAmTMAAMwzAAD/MwAAAGYAADNmAABmZgAAmWYAAMxmAAD/ZgAAAJkAADOZAABmmQAAmZkA AMyZAAD/mQAAAMwAADPMAABmzAAAmcwAAMzMAAD/zAAAZv8AAJn/AADM/wAAAAAzADMAMwBmADMA mQAzAMwAMwD/ADMAADMzADMzMwBmMzMAmTMzAMwzMwD/MzMAAGYzADNmMwBmZjMAmWYzAMxmMwD/ ZjMAAJkzADOZMwBmmTMAmZkzAMyZMwD/mTMAAMwzADPMMwBmzDMAmcwzAMzMMwD/zDMAM/8zAGb/ MwCZ/zMAzP8zAP//MwAAAGYAMwBmAGYAZgCZAGYAzABmAP8AZgAAM2YAMzNmAGYzZgCZM2YAzDNm AP8zZgAAZmYAM2ZmAGZmZgCZZmYAzGZmAACZZgAzmWYAZplmAJmZZgDMmWYA/5lmAADMZgAzzGYA mcxmAMzMZgD/zGYAAP9mADP/ZgCZ/2YAzP9mAP8AzADMAP8AAJmZAJkzmQCZAJkAzACZAAAAmQAz M5kAZgCZAMwzmQD/AJkAAGaZADNmmQBmM5kAmWaZAMxmmQD/M5kAM5mZAGaZmQCZmZkAzJmZAP+Z mQAAzJkAM8yZAGbMZgCZzJkAzMyZAP/MmQAA/5kAM/+ZAGbMmQCZ/5kAzP+ZAP//mQAAAMwAMwCZ AGYAzACZAMwAzADMAAAzmQAzM8wAZjPMAJkzzADMM8wA/zPMAABmzAAzZswAZmaZAJlmzADMZswA /2aZAACZzAAzmcwAZpnMAJmZzADMmcwA/5nMAADMzAAzzMwAZszMAJnMzADMzMwA/8zMAAD/zAAz /8wAZv+ZAJn/zADM/8wA///MADMAzABmAP8AmQD/AAAzzAAzM/8AZjP/AJkz/wDMM/8A/zP/AABm /wAzZv8AZmbMAJlm/wDMZv8A/2bMAACZ/wAzmf8AZpn/AJmZ/wDMmf8A/5n/AADM/wAzzP8AZsz/ AJnM/wDMzP8A/8z/ADP//wBm/8wAmf//AMz//wD/ZmYAZv9mAP//ZgBmZv8A/2b/AGb//wClACEA X19fAHd3dwCGhoYAlpaWAMvLywCysrIA19fXAN3d3QDj4+MA6urqAPHx8QD4+PgA//vwAKCgpACA gIAA/wAAAAD/AAD//wAAAAD/AP8A/wAA//8A////AP///wAAAAAABAAAADQCAAAEAAAABwEDAKEn AABBCyAAzAB4AKAAAAAAANACwAMAAAAAKAAAAKAAAAB4AAAAAQAIAAAAAAAASwAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAIAAAIAAAACAgACAAAAAgACAAICAAADAwMAAwNzAAPDKpgAEBAQACAgIAAwM DAAREREAFhYWABwcHAAiIiIAKSkpAFVVVQBNTU0AQkJCADk5OQCAfP8AUFD/AJMA1gD/7MwAxtbv ANbn5wCQqa0AAAAzAAAAZgAAAJkAAADMAAAzAAAAMzMAADNmAAAzmQAAM8wAADP/AABmAAAAZjMA AGZmAABmmQAAZswAAGb/AACZAAAAmTMAAJlmAACZmQAAmcwAAJn/AADMAAAAzDMAAMxmAADMmQAA zMwAAMz/AAD/ZgAA/5kAAP/MADMAAAAzADMAMwBmADMAmQAzAMwAMwD/ADMzAAAzMzMAMzNmADMz mQAzM8wAMzP/ADNmAAAzZjMAM2ZmADNmmQAzZswAM2b/ADOZAAAzmTMAM5lmADOZmQAzmcwAM5n/ ADPMAAAzzDMAM8xmADPMmQAzzMwAM8z/ADP/MwAz/2YAM/+ZADP/zAAz//8AZgAAAGYAMwBmAGYA ZgCZAGYAzABmAP8AZjMAAGYzMwBmM2YAZjOZAGYzzABmM/8AZmYAAGZmMwBmZmYAZmaZAGZmzABm mQAAZpkzAGaZZgBmmZkAZpnMAGaZ/wBmzAAAZswzAGbMmQBmzMwAZsz/AGb/AABm/zMAZv+ZAGb/ zADMAP8A/wDMAJmZAACZM5kAmQCZAJkAzACZAAAAmTMzAJkAZgCZM8wAmQD/AJlmAACZZjMAmTNm AJlmmQCZZswAmTP/AJmZMwCZmWYAmZmZAJmZzACZmf8AmcwAAJnMMwBmzGYAmcyZAJnMzACZzP8A mf8AAJn/MwCZzGYAmf+ZAJn/zACZ//8AzAAAAJkAMwDMAGYAzACZAMwAzACZMwAAzDMzAMwzZgDM M5kAzDPMAMwz/wDMZgAAzGYzAJlmZgDMZpkAzGbMAJlm/wDMmQAAzJkzAMyZZgDMmZkAzJnMAMyZ /wDMzAAAzMwzAMzMZgDMzJkAzMzMAMzM/wDM/wAAzP8zAJn/ZgDM/5kAzP/MAMz//wDMADMA/wBm AP8AmQDMMwAA/zMzAP8zZgD/M5kA/zPMAP8z/wD/ZgAA/2YzAMxmZgD/ZpkA/2bMAMxm/wD/mQAA /5kzAP+ZZgD/mZkA/5nMAP+Z/wD/zAAA/8wzAP/MZgD/zJkA/8zMAP/M/wD//zMAzP9mAP//mQD/ /8wAZmb/AGb/ZgBm//8A/2ZmAP9m/wD//2YAIQClAF9fXwB3d3cAhoaGAJaWlgDLy8sAsrKyANfX 1wDd3d0A4+PjAOrq6gDx8fEA+Pj4APD7/wCkoKAAgICAAAAA/wAA/wAAAP//AP8AAAD/AP8A//8A AP///wBtkW2RbZFtkW2RbZFtkQAAAAAAAAAAAAAAAAAAAAAAAAAAACEAIQBCAAAAQgAhAEIAQgBD AEMAQwBCAEMAQgBDAEIAQwBCAEMAQgBCAEIAQwBCAEMAQgBDAEIAQwBCAEMAQgBCAEIAQwBCAEIA QgBDAEIAQgBCAEIAAABCACEAQgAAAEIAIQBCAAAAQgAAAEIAAAAAAAAAAAAAAAAAAAAAkW2SrpKu kq6RbZKuka5DPEM8Qzw9PEM8PQBDPD08QzxDPEM8QzxmPGY8ZjxmPGZfZjxmZmZmZmZmPGZfZl9m X2Y8Zl9mX2ZlZl9mYGZfZmZmX2ZfZl9mZWZfZmVmZWZlZmVmZWY8Zl9mPGZfZjxmX2Y8ZjxmPGY8 ZjxmPGY8ZjxmPGY8ZjxmPGY8ZjxDPGY8QzxDPEM8QzxDPEM8QzxDAG2RbZGukW2RbZFtka6RADwA PQA8PD0APAA9ADw8Qzw8PEI8QjxmPGY8ZjxlPGY8ZjxmPGZmZjxmX2ZfZl9mX2ZfZjxmX2ZfZl9m X2ZfZl9mX2Y8Zl9mPGZfZl9mZWZlZmVmZWZfZjxmPGY8Zl9mPGY8ZjxmPGY8ZjxmPGU8ZjxmPGY8 QjxmPEI8ZjxCPEM8PTxDPD08PTw8PD08PDw9AACSrpKukq6SrpKukq6SrkM8QzxDPEM8QzxDPEM8 ZjxmPGY8ZjxmPGY8ZmVmPGZlZl9mZWZlZmZmYGZmZl9mZmZfZmZmX2ZmZmVmZmZmhmZmYGZmZl9m ZmZfZmZmX2ZmZmVmZWZlZmVmX2ZgZl9mZmZfZl9mPGZmZjxmZWY8ZkJmPGY8ZjxmPGY8ZjxmPGY8 ZjxmPEM8ZjxDPEM8QzxDPEMAbZFtkW2RbZFtkW2RbZEAPAA8ADwAPAA8ADw8Qjw8PEI8PDxmPGU8 ZjxlPGY8ZTxmPGZfZjxmX2ZfZl9mPGZfZl9mX2ZfZl9mX2ZfZl9mX2ZfZl9mPGZfZjxmX2Y8ZmVm ZWZlZjxmPGY8ZjxmPGY8ZjxmPGY8ZjxmPGU8ZjxlPGY8QzxmPEI8ZjxCPEI8PDxCPDw8PTw8PD08 PDw8ADwAAJFtkq6SrpKukq6SrpFtQzw9PEM8QzxDPEM8ZjxmPGY8ZjxmPGY8ZmVmZWZlZmVmZWZl ZmVmZWZlZmVmZWZfZmVmZYZmZl+GZmZmhmZmYIZmZl9mZWZfZl9mX2ZmZl9mZWZlZmZmZWZlZl9m ZmZfZl9mX2ZlZjxmZWY8ZmVmPGY8ZjxmQmY8ZjxmPGY8ZjxmPEM8ZjxDPGY8QzxDPEM8QwBtkW2R bZFtkW2RbZFtkQA8ADwAPDxCPDw8QzxCPGY8ZTxmPGY8ZjxmPGY8ZmVmPGZlZl9mX2ZfZl9mX2Zf Zl9mZWZlZmVmX2ZfZl9mX2ZfZl9mX2ZfZl9mX2ZfZl9mX2ZlZmVmZWY8Zl9mPGZfZjxmX2Y8Zjxm PGU8ZjxmPGY8ZjxmPGY8ZjxDPGY8QjxDPDw8Qzw9PD08PDxDPDw8PQAAkq6SrpKukq6SrpKukq5D PEM8QzxDPEM8ZjxmPGY8ZjxmZWZfZmVmZWZlZmVmZWZlZmVmZWZlZmWGZmZlhmaGZYZmhmWGZWZl hmZmZoZmZmWGZmZghmZmX2ZlZmVmZWZlhmZmZWxlZmVmZmZfZmZmX2ZmZmVmZWZfZmVmQmZlZjxm QmY8ZkJmPGY8ZjxmPGY8ZjxmPGY8QzxmPEM8QzxDAG2RbZFtkW2RbZFtkW2RADwAPAA8ADw8Qjw8 PGY8ZTxlPGU8ZjxlX2Y8ZWVmPGVlZjxmZWZfZl9mX2ZfZl9mZWZlZmVmX2ZfZl9mX2ZfZl9mX2Zf Zl9mX2ZfZl9mX2ZlZmVmZWZCZmVmPGZfZjxmX2Y8ZjxmPGY8ZjxlPGY8ZTxmPGU8ZjxlPGY8QjxD PDw8Qzw8PDw8PDxDPDw8PDw8ACGRbZKukW2SrpFtkq6RrkM8QjxDPEM8ZjxmPGY8ZjxmZWZfZmVm ZWZlZmVmZWZlZmVmZWZlZmWGZWZlhmWGZYZlhmWGZYZfhmVmX4ZlZl+GZmZfhmZmX4ZlZmVmZWZl i2VmZYtlZmVmZWZfZmBmX2ZlZl9mX2Y8ZmVmPGZlZjxmQmY8ZjxmPGY8ZjxmPGY8ZjxDPGY8Qzxm PEM8QzxDPEMAbZFtkW2RbZFtkW2RbZEAPDxCPDw8QzxCPGY8ZTxmPGVfZjxmZWZfZmVmX2ZlZmVm AAAAAGVmZQAAhgAAZQAAZgAAAGZlAAAAXwAAAF9mAABfZgAAX2YAAGVmAAAAAABmAGxlAAAAZQAA AABmXwAAZjwAAGY8ZjxmPGY8ZTxmPGU8ZjxlPGY8ZjxmPEI8QzxCPEM8PDxDPDw8Qzw8PDwAAJKu kW2SrpKukq6SrpKuQzxDPEM8ZjxmPGZCZkJmZWZlZmVmZYZlZmWGZWZlhmWGGRkZGWUAZhkZhhkZ ABkZhhkZGQBlGRkZABkZGWWGGRkAhhkZZYYZGWWGGRkZGRmGGYsAGRkZZRkZGRlmXxkZZl8ZGQBf ZmVmZWZlZjxmZWZCZmVmQmZCZjxmQmY8ZjxmPGY8ZjxmPEM8ZjxDPEM8QwBtkW2RbZFtkW2RbZFt kQBCPDw8QzxCPGY8ZTxmPGVlZjxmZWZfZmVmX2ZlZl9mZRllZmUZABkAhgBmGQAZAGUZABkAhhkA GQBfGQBmX2YZAAAZAGYZAGUAXxkAhhkAGQAZAGUZAGUZABkAXxkAAABmPBk8ZjxlPGY8ZTxmPGU8 ZjxlPGY8ZTxmPEI8ZjxCPEI8PDxDPDw8Qjw8PDw8PAAAkW2SrpFtkq6SrpKuka5DPEM8ZjxmPGZC ZmVmZWZlZmVmZYZlZmWGZYZlhmWGZYZlhgAZGYYZixkAZRkAGQCGGQAZi2UZABllhhkAZYZlGRkZ GQBlGWUZAIYZAAAZABkAGQAAGQBlGQAZAGYZGRkAZRkAAGVmZWZlZmVmZWY8ZmVmQmZlZjxmQmY8 ZkJmPGY8ZjxmPGY8ZjxDPEM8QzxDAG2RbZFtkW2RbZFtka6RPEI8QzxCPGY8ZTxmQmZlZl9mZWZl ZmVmX2ZlhmVmZYZlZhkZZYYAhhkZZYYZGRmGZRkZi2WGGRllhmUZAGZlhhlmABllZmUZGWYZGRkZ GRkZZhkZGRllGRkZGWZfZhkZX2UZGV9mZWY8ZmVmPGU8ZjxlQmY8ZjxmPGU8ZjxCPGU8QjxDPEI8 Qzw8PEI8PDw8AACSrpKukq6SrpKukq6SrkM8ZkJmPGZCZmVmZmZlZmVmZYZlhmWGZYZlhmaGZYZl hhmGAAAZAIaLZYuGGQCLhoZli4aLZYumi2WLGQBlhmaGGRkAAGWGZoZlhhmGZoYAhmWGZoZlAGUZ ZWYAZmVmZWZlZmVmZWZlZmVmZWZlZmVmZWZlZkJmQmY8ZkJmQmZCZjxmQmY8ZjxDPGY8QzxDPEMA bZFtkW2RbZFtkW2RrpE8QjxCPGU8ZTxmPGZlZl9mX2ZfZl9mX2Zlhl9mZYZlhmWGGRkZGWWGZYtl GRmGZYZlhmVmZYZlpmWGGRllhmVmGRkZGWWGZWZlhmVmZWYZZmVmX2ZfGV9mX2YZZV9lPGVfZl9l ZWZCZWVmPGU8ZTxlPGY8ZTxlPGU8ZjxCPGU8QjxCPEI8Qjw8PEI8PDw8PDwAAJKukq6RrpKuka6S rpKuZjxmPGZlZmVmZWZlZmVmZYZlhmWGZYZlhmaGZYZlhmWGZYZli6aLZYumi2WLpoZli6aGZYtl i2WLpoZlhmWGZYZlhmWLZYZli2WGZYZlhmWGZYZlhmVmZYZlZmVmZWZlhmVmZWZlZmVmZWZlZmVm PGZlZkJmZWY8ZkJmPGZCZjxmQmY8ZjxmPGY8QzxDPEM8QwBtkW2RbZFtkW2RrpGukjxCPGY8ZTxm PGVfZl9mZWZfZmVmZWZlhmWGAAAAhmWGZYZlhmWmZYtli2WLZYZlhmWGZYZlhmWLZYZlhmWmZYZl hmWGZYZli2WGZYZlZmWGZWZlZl9mZWZfZmVmX2VlZl9mZWZfZmVmQmZlZjxlPGY8AAAAPGU8Zjxl PGY8QjxmPEI8ZjxCPEI8PDxCPDw8PAAAkq6SrpKukq6SrpKuta5mPGZlZmVmZWZlZmVmZYZlhmWG ZYZli6aGGRkZAGWLpoamhqaGZYumi6aLpoumi6aLpoumi6aLioumi6aGZYamhmWLhotli4aLZYtm i2WLZYZlhmWGZYZlhmWGZYZlhmWGZYZlZmVmZWZlZmVmZWZlGRkZAGZCZmVmPGZCZjxmQmY8ZkJm PGY8ZjxmPEM8QzxDAG2RbZFtkW2RbZGukq6RPGY8ZTxmPGVfZl9mX2ZfAAAAZQAAAAAAZYYAGQCG AABlAACmZQAApmUAAIumAACLZQAAAACLZQAAiwAAAAAAAGUAAIYAAAAAZQAAAAAAAABlhgAAAABf AACGZWYAAAAAAGYAAGVmAAAAZQAAAAAAZV8AGQA8AABlAAA8QjxmPEI8QjxCPEI8PDxCPDw8Qjw8 AACSrpKukq6SrpKuta61rmZCZmVmZWZlZmWGZYZlGRkZZRkZGRkZZYsZGRkAGRkAGRmGphkZi6YZ GQCmGRmLphkZGRmLABkZixkZGRkZGQAZGYYZGRkZZRkZGRkZGRllhhkZGRllGRkAZYYZGRkZGQAZ GWWLGRkZZhkZGRkZZmUZGRkAGRkAGRlCZkJmQmY8ZkJmPGY8ZjxmPEM8ZjxDPEMArpFtkW2RbZGu ka61rrU8ZjxmX2ZfZl9mZYZlhmUZAIYZAGUZAIYZAKYZAIsZABkAphkAAACLphmmixkAposZi6aL GQAZAKYZGRkAhhkAGQAZAGUZAIYZGRkAZRkAhhkAZRkAhmUZZWZlhhkAZRkAGQBsZWYZAEIZAGYZ AGUZAGUZADwZABkAZTxmPGU8ZjxCPGY8QjxCPEI8Qzw8PDwAAJKukq6SrpKuta61kbWRZmVmZWZl hmaGZYZlhmWGGQAAGQCLGQCmGaYAGQAAGQAZAIsZGRkAphkAAKYZAACGi6YAGRmmGQAAiwAZi6YZ ABkAGYYAGQCGiwAZhoYZAAAZZQAZAGUZAABli2YZAIsZABkAZYtlGQAAGQBlGQBmGWYAGQAAGQAZ AEJmQmZCZkJmPGZCZjxmPGY8ZjxDPGY8QwBtkW2RbZGuka6RrrWutDxmPGVfZl9mZYZfhmWGZRkZ GRkAGRmmpqYZGRkZixkZGYamhhkZposZGaYZGRmmhqYZGYamGRkZphkZi6YZGRkZhmUZGRkAhhkZ ZYYZGRkZZRkZGQCLGRlli2UZGYsZGRkZZWVlbBkZGRkAGRllPGUZGRkZQhkZGTxlPEI8ZTxlPGU8 QjxCPEI8Qzw8PEI8PAAAkq6SrpKuta61rrWRtZFmZWZlZmWGZYZlhmWGpoYZAKYZAACmAKaLpoum i6YZAK2mi6atpq2mraaLphmmhqYZpgAAGQAZpq2Li4qthoumi6aLposZAIaLhoamhoaGZYumixkA a4tri2uLZYsAi2WLZYtli2UZAIsZAABmAGZlZmVmZWYZAEJmQmY8ZkJmPGZCZjxmPGY8ZjxDPGY8 QzxDAG2RbZGukq6RrrWuta61PGZlZl9mZYZlhmWGZYYZGWUZGRmmGaaLpoami6YZGYumi6atpoam raaLpq2mhqaLphkZGRmGpoumi6aLpoumi6aGposZGaaLpoumhmWGZYZlixkZZYtri2WLZYsZi2WL ZWVlbGUZGWwZGRllGWVlZmVlZWYZGWVmPGVCZjxlPGY8ZTxlPEI8QjxCPEM8PDxDAACSrpKuta61 rrWRta61kWZlhmWGZYZmhmWLhoumi6aLpq2mi6atpq2mraatpq2mraathq2mrYutiq2Lraati62G rYaLpq2Gi6ati62GrYaLpouKi6ati4uGrYaLhouGi2WLi4tri4qLa4tsi2uLa4tli2WLZYtlbGVs ZWZlbGVmZWZlZmVmZWZCZmVmQmZCZjxmQmY8ZjxmPGY8QzxmPEMAbZGukq6RrrWutK61rrVfZl9m ZYZlhmWGZYami6aLpoumi6aLpoumraaLpq2mi6atpq2mraatiq2KrYqtpoumi6aLpoumhqaLpoum i6aLpoumi6aLpoumi6aLpoZlhmWLZYtli2WLZYtli2WLZWxli2VsZWxlZmVmZWVlZmVlZWVlZWVm PGU8ZTxlPGY8ZTxlPEI8Zjw8PEI8PDxDPDwAAJKuta61rrWuta61kbWRhmWGZYZlhmWLpoumi4at pq2Lraati62mraatpq2Kraati62mra2tiq2trYqzi62LrYuti62LraatpoumAAAApouKi4qti4um rYuthq2Gi4aLhoumi4aLZYtmi2WLZYtli2WLZYtli2WLZWZlbGVmZWZlZmVmZWZlZmVmQmZlZjxm QmY8ZjxmPGY8ZjxmPEM8QwCukq6SrrWuta61rrWutV+GZYZlhmWGZYami6aLpoumi4qtpq2mraat pq2mraatpq2Kraatpq2KrYqtiq2KrYqti62KrYqtpoumGRkZpoumi4qLpoumi6aLhoumi4aGZYam i2WGZYtlhmWLZYtli2VsZYtlbGVsZWZlZmVlZWZlZmVmZWVlZjxlPGY8ZTxmPGU8ZjxCPEM8PDxD PDw8PQAAta61rrWuta61kbWRtZGGZYuGi6aLhoumrYatpq2LrYuti62KrYutpq2trYutAK2tswCt rQAArQAArQAAAK2tiwAAAIsAi60AAIsZAAAArYoAAACGrYYAAK2LAACthosAAIYAAIsAAGUAAItl iwAAAABmAACLZgAAi2WLZYtlZmWLZWZlZmVmZWZlZjxmZWY8ZkJmPGY8ZjxmPGY8ZjxDAK6RrrWu ta61rrSuta61ZYZlhmWLZYumi6aGpoumi6atpq2Kraatpq2mraatGQCKrRkAxxkZABkZihkZGQCt ihkZGYsZposZGaaLGRkZiwAZGRmmi6YZGYumGRkApoYZGWUZGQAZGWUZGYZlhhkZGRkAGRmLZRkZ ZmVlZWZlZWVmZWVlZTxlQmY8ZTxlPGU8ZTxCPGU8QjxDPDw8PDw8ACG1rrWuta61kbWutZG1kYum i6aLhoumrYatpq2mraatra2KrYutiq2traatixmtAK0ZrQCtGQAZAK0ZABkArbOtGQAZAK0ZAAAA phkArRkAhhkArYYZAAAAi4YZhosZAAAAhhkAGQCLGQBli2UZAIsZABkAZRkAAABsZYtlZmWLZWZl ZmVmZWZlZkJmPGY8ZjxmPGZCZjxmPGY8ZjxDPEMArrWuta61rrWuta61kbVlhqaLpoumi6aLpq2m raatpq2KrYqtiq2mraatphkAGQAZABkArRkAGQCsGQAZrLOKrRkAGa2LGRkZAK0ZAAAZpoYZAAAA GRkZAKYZAACGGRkZAIYZABkAZRkAAGWGGQAAGQAZAIYZGRkAZWZlZWVmZWZlZkJlZWZlZmVmPGU8 ZTxlPGY8QjxmPEI8Qjw8PD0AALWRta61kbWRtZG1kbu0i4aLi62LrYutpq2nraatra2tra2tra2t ra2tra0ZABmzGbMZAK0ZGRmtrRkZrbOts60ZGa0ArYsZGa0ZGRkZhq0ZGRkZhq0ZGYatGRmGrYYZ GYsZGRkZhhkZGYaGGRkZixkZGYtlixkZZYtli2WLZWZlbGVmZWZlZmVmZWZCZkJmPGZCZjxmQmY8 ZjxDPGY8QwCuta61rrWuta61rrWRtaaLpouKraaLpq2mraatpq2mrYqtrK2mrcetpq2sGQAAGQCs GQAAGQCsrYqtrK2KraytGQAZAKatpq2mp6anpoamp6aGpoumi6aLpoaGhqaGpoamhqaGZYamGWWG ZYYZhmUZAGZli2VmZYZlZWVmZWVlZmVlZWZCZWVmPGU8ZTxlPGU8QjxmPEI8Qjw8PEM8PAAAtZG1 kbWutZG1kbW0tbSLi62LrYutpq2Lraytra3Hra2trbOtra2tra2tGRkZrRmtGRkZGRmts62trLOt s62zGRkZGa2ti62GrYathqeGp4athq2LrYathq2GrYaGhouGi6aLhoumi4aLhouGhmUZGYZli2WL ZYtli2WLZWZli2VmZWxlZmVmZWZCZkJmPGZCZjxmQmY8ZjxmPGY8QzxDAJG1rrWuta61kbWRtbS7 houLrYqtiq2mrYqtpq3HrcetrK2sraytx62sraytrbOsra2zrK2traytrK2KraytrK2trYqthq2m rYanpqeGp6anhq2mi4atpouGi6aGpoamhqaLpoumi6aGpoZlhmWGZYZlhmWGZYtlZmWLZWZlZmVl ZWZlZmVmQmU8ZjxlPGY8ZTxmPGU8QzxCPEM8Qjw8AAC7kbWRtZG1tLW0u7TctK2Lra2trK2trYqt ra2tra2trdSt1K3Urc6tzq2trdSt1K3UrbOt1K2zrdSts62tra2tra2tra2trYatp6eGp6enhq2G rYati62GrYathq2Gi6athouGrYaLhouGi4aGhoZlhmaLZYtli2WLZYtli2VsZYtlbGVsZWZlZmVm QmZlZkJmQmZCZkJmPGY8ZjxmPEMAkbSuta61rrWutLS7tLuGrYatiq2mrYqtpq3Hrcetx62srayt rK2sraytrK2sra2zra2ts6ytrLOsraytx63Hrcetx62mraatpqemp6Knhqemp4atpq2mraaGpoam hqaLpoumi6aLpotlhmWGX4Zfhl9mZWZlZWVmZWVlZmVmZWZlZWVmQmVCZTxlPGU8ZTxmPEI8QjxC PEI8PDxCPDwAALWRtZG1kbW0tbTctNy0ra2ti62traytrK3Hzq2trc6tzq3UrdSt1K3Orc6t1K3U rdSt1K3UrdSts63Ura2nzqetp62trcetp62GraenhqeGp4athq2GrYathq2Graathoumi4uLpouG i6aLhoZmhmaGZYZlhmWLZYZli2WGZYtlZmVsZWZlZmVmQmZlZkJmQmY8ZkJmPGY8QzxmPEM8QwCR ta61rrWutbS1tLu03Iati62Kraytiq2srcetrc6sra3UrAAAzqwAAM6sra0AAACt1K2tAACsAAAA ra0AAKcAAAAArccAAACmrQAAAACmAAAAAKcAAACnAACmAACLposAAACLAAAAi6aLAAAAhgAAXwAA ZgAAAGZlAABmZWYAAGVmZWVlZTxlPGY8ZUJmPGU8ZjxCPGY8PDxDPDw8QwAAu5G1kbW0tbTWtNy0 3LStra2traytra2sra3Orc6tzq3UrRkZAK0ZGdStzq0ZGRmtAK3UGRmtGRkZrdQZGa0ZGRkZrQAZ GRmtrRkZGRmnGRkZGa0ZGRkAGRkAGRmthq0ZGRkAGRkZi4qLGRkZixkZABkZhhkZGQBlGRkAZYsZ GWWLZWZlZmVmZWZlZmVmZWZCZkJmPGZCZjxmPEM8ZjxDAJG1kbWutbS1tLW03LTci62LrYqtpq2K raytrc6szq3OrNStGQAAGQCszq0ZAK2tGa2tGQAAAK0ZAK0ZAAAApxkArRkAphkAraYZGRkApxkA GQCGGQAZAK0ZABkApoumGQAZAIsZAKaLposZAGWGGQAZAF8ZABkAZmUZZWYZAAAAZWVlZjxlPGU8 ZUJmPGU8ZjxCPGU8QjxDPDw8PTw8AAC1tLW0tbTctNa03LTctK2tra2zra2sra2trc6tzq3UrdSt 1BkZGRkAzq3UGQCt1K3UrRkZGQDOGQCtGRkZAM4ZAAAZra0ZAAAArAAZrYYZABkArRkAGa2LGQAZ AK2mrRkAGa2GGQAAhoumGQCGphkAGQCGGQAZhmUZAABlGRkZAGZlZmVmZWZlZmVmZWZlZmVmQmZC ZjxmPGY8ZjxDPEMAtLW0tbS1tLW01rTctNyGra2trK2sraytrK2szq3UrdSt1KwZrQAZzq3OrRkA 1K3OANStGRnOpxkAzqcZGa3HGRkZrK0ZGRkZrBkZraYZGRkZrYYZGa2mGRkZGa2mraYZGYumGRkZ poamABkApgAZGRmGXxkZhmVmGRllZmUZGWVlZmVlZWU8ZWVmQmZlZkJlQmY8ZTxmPEI8Qzw9PD0A ALu0u7TctNy03LTctNy0z63mrbOts62trdSt1M7UztTO1M7UzhkZAADUztQZ1AAAGQCz1K3Urc4Z AK3Op86tzhkArbOt1K2zrbOtra2tpxmnrQCtra2tra2tra2KrYutpq2GrYYZAACGGQAZABkAGQCL hoamhmWGZYtli2WLZYtli2VmZWZlZmVmZWZlZmVmQmZCZkJmQmY8ZjxmPGY8QwC0tLS1tNa03LTV tNy03Ketp62traytrK2srazOrM7O1K3OrRkZGRnOrc6t1BkZGRms1KzUrK0ZGcetp87HrRkZrK2s raytrK2KrYqtpq3HrRmthq2KrYqtpq2KraaLpoumhqaGGRmmhhkZGRkZGRmGZYZlhmWGZYZlZWVm ZWVlZmVlZWVfZWVmPGVCZjxlQmY8ZTxlPEI8Qzw9PD08PAAhu7TctNy03LTctNy03LTmrc6tzq2t rdStzq3UztTO1M7UztTOzs7UztTO1NTU1NTU1LPUs9St1K3Op86nzq3OrdSt1K3UrbOtraytra2n ra2tra2tra2tra2KrYqtiq2KraatpoumrYaLhouGi6aLhoumi6aGZYtlhmWLZYtli2VmZWZlZmVm ZWZlZmVmQmZCZkJmQmY8ZjxDPGY8QzxDALTctNy03LTctNy03LTcp86tzq2trc6szqzOrM6t1KzO ztTOzs7Ozs7O1K3U1NSz1NTastSz1KzOrM7Hzq3Op86t1K2zrbOsraytiq2sraatp62sra2tiq2K raatiq2mraaLpoumi6aLpoamhqaLpoamhmWGZYZlhmWGZWVlZmVlZWZlZWVmX2ZlZkJlZWY8ZTxm PGU8ZjxCPEM8PTw9AADctNy03LTctNy03LTctOat5s7OrdXO1K3Uzs7O1M7UztTO1M7VztTO1dTU 1NvU2tTa2trU2tTUztTOzq3Ozs6t5s7VrdSts62zra2tra2tra2tra2tra2tra2ti62LrYqti62m rYuthq2Gi4aLhouGi4aLpoumhmWGZYZli2WLZYtlZmVmZWZlZmVmZWZlZjxmZWY8ZkJmPGY8Zjxm PEMAtNa03LTctNy03LTctNynzqfOrc6tzq3Orc6tzqzOzs7Ozs7UztTO1M7U1NSz1NTa1NrU1LLU 1NSs1K3Orc6nzqfOrc6traytrK2srcetra2tra2tiq2Kraatpq2mi6aLpoumi6aLpoumhqaGpoam hmWGZYZlhmWGZYZlZmVlZWZlZWVmX2VlZjxlQmY8ZTxlPGU8ZTxCPEI8PDxDPDwAANy03LTctNy0 3LTctNy05q3OzubOzs7Vzs7O1M7OztTO1M7VztTO1dTV1NvU1dTb1NrU2tTU1NrU1NTUzs6t5sjm p+atzq3UrbOt1K2trbOtra3Ura2sra2tpq2trYqti62KrYutpq2LrYathoaGhoaGpoumhmWGZYZl hmWGZYtlZmWGZWZlZmVmZWZlZkJmQmY8ZkJmPGY8ZjxmPEM8QwC03LTctNy03LTctNy03KfOrc6t zs7Ozs7Ozs7Ozs7Ozs7UztTO1NTV1NXU1dTV1NTU1NTU1NrU1NTUrdStzqfOp+anzq3OrK2ss6yz rbOsra2trK2sraatpq2mraatpouKraaLpq2mi6aLpoamhqaGpoZlhmWGZYZlhmVmZWZlZWVmZWVl ZmVlZWZCZWVmPGU8ZjxlPGU8QjxDPD08PQAA3LTctNy13LTc1tzV3NXmzubO5s7VztXO1c7VztXO 1c7V1NXU1dTV1NvU1dTV1NXU1dTV1NvU2tTa1NTU1c7Op+bI5qfOrdSt1LPUs9Sz1K3Ura2tra2t p62trYati62KrYutiq2LrYathq2Gi4aGpoaGhqaGpoZli2WGZYtlZmWLZWZlZmVmZWxlZmVmZWY8 ZmVmPGZCZjxmPGY8ZjxDAIaGhs+Gz4bPhouGz4bPpqempqanpqemraampq2mraatpqamraatpq2m pqatpq2mraampq2mraatpqaz1K3Orc6nzqfOp62ss6yzrLOss6ytrK2sraatpq2mp6atpoumraaL ioumi6aLpoamhqaGpoZfhmWGZYZlhmVlZWZlZWVmZWVlZmVlZWZCZUJlPGU8ZTxlPGU8QjxCPDw8 PDw8AADPhs+Gz4bPhs+Gz4bPhqemp6atpq2mraatpq2mraatpq2mraatpq2mraatpq2mraatpq2m raatpq2m1NTUztTOzq3Ozs6tzq3UrNSts6yzra2sra2tpq2nraathq2mrYutiq2KrYqti4umi4aG poaGhqaGpoZli2WGZYZlhmWGZWZlZmVmZWxlbGVsZWZlZmVmPGY8ZjxmPEM8ZjxDPEMAtNy03LTc tNzV3LTc1dzOzs7Uzs7O1c7UztTO1NTV1NXU1dTV1NXU29Tb1NXU1c7VztXO1NTVztTOzq3Us9St 1K3Orc6tzq2trLOsraytpq3Hraatpq2mraatpoamraatpq2mi4qLpoumi6aGpoZlhmWGZYZlhmWG ZYZlZmVmZWZlZmVmZWZlZmVmQmVCZjxlPGU8QjxlPEI8Qzw8PEMAANy03LTc1tzW3Nbc1dzV5s7V ztTO1dTV1NXU1NTb1NvU29Xb1NvV29rb29vU1dXV5tXU1dTV1NXO5s7OztTU1NTUztSt1K3OrdSt 1K3Ora2tra2tp62nrYatp62mrYatpq2LrYqti62KrYuLpouGi6aLhotli2WGZYZlhmWGZYZli2Vs ZWxlbGVsZWZlZmVmPGZCZjxmQmY8ZjxDPGY8QwC03LTctNzW3NXc1dzV3M7mzs7O1M7UztTO1M7U s9TU29TV1Nuz29rb1NvU29TVztXO1M7Uzs7OzsjOyM6t1LPUrdStzq3Orc6szqytrK2srcetp62m raatpqemp6aGpoumi6aLpoumi6aLpotlhqaGZYZlhmWmZYZlZmWGZWZlZmVlZWZCZmVmQmVCZjxl PGY8ZTxmPEI8Qjw8PEM8PAAA3LTctNzV3Nbc1tzV3NXmzubO1dTU1NXU1M7V1NTU29Tb1Nva29rb 29vb29XV1dXm1dTV1NXO1c7myObO5s7U1NTO1c7UrdSt1K3Urc6tzq3Orc6traetp62GrYatpq2G rYathoumrYuLpouGi6aLpoumi6aGZYamhmWGZYZli2VmZWxlbGVsZWZlZmVmPGZlZjxmQmY8ZjxD PGY8QzxDANXctNy03NXc1tzV3NXczs7O1c7UztTO1M7UztTO1M7U1NrU2tTb2tva29Tb1NXO1c7V ztTU1M7OzubI5s7mztTO1K3UrdSt1K3UrdStzq2trc6nraetpq2Graatpq2mraatpoumi6aLpoum hqaLZYamhmWGZYZlhmWGZWZlZmVmZWZlZmVmQmZlZjxlPGY8ZTxmPEI8ZjxCPEM8PDxDAADc1dzV 3Nbc1tzW3Nbc1ebO1c7V1NXU1M7VztTO1M7U1NXU1dTb2tva29vb1NXV1ebV1NXU29TVztXO5s7m zubO1c7VztXO1a3V1NWt1a3mreatzqfOra2tra2tra2trYutra2GrYaLpq2Gi6aLhoumi4aLpouG i2WLhoZli2WLZYtlbGVsZWZlZmVmZWZlZjxmQmY8ZkJmPGY8QzxDPEMAtNzV3LTc1ty13NXc1dzO zq3UztTO1M7Urc7Ozs7OztTN1M7U1NTU29Ta1NXO1c7VrdXU29TU1NTOzs7myObO5q3OztSt1K3U rc6tzq3Orc6nraetp62nraatpq2mrYqtpq2mraaGpoamhqaGZYZlhmWGZYZlhmWGZYZlhmVmZWZl ZWVmZWVlZjxlPGY8ZTxmPEI8ZTxCPEM8PDw8ADwAANzW3Nbc1dzW3Nbc1tzV1c7VztXUAAAAAAAA 1M7UztTOAAAAAAAAAAAAANsAAAAAAADUAAAAANsAAAAAAObO5gAAAAAA1c7VzubO1c7mrebOzqfO p62nzq2tra2tra2zra2LrYutpq2Gi6aLhoami4aGpoumi6aLhotli2WLZYtlbGVsZWZlZmVmZWZl ZkJmQmY8ZjxmPGY8QzxDPEM8QwDW3NXc1dzV3Nbc1tzV3M7mztXO4uLi4uLiAM7UztTO4uLi4uLi 4uLi4gDi4uLi4uIA4uLi4gDi4uLi4gDO5uLi4uLiAAAAzubO5qfOzs6tzqfOp62nraetp62mra2t iq2Lraatpq2mhqaGpoamhmWGZYtli6aLZYtli2VmZWZlZmVmZWZlZl9mZWY8ZUJmPGU8ZjxCPGY8 QjxCPDw8PAAA3dbc1tzW3Nbd1t3W3NzV5tXV1eLi4uLi4gDU1NTU4uLi4gDU4uLi4uLU4uLi4uLi 2+Li4uLa4uLi4uLO1eLi4gDO4uLizubO5s7mzubOzq3mrc6n5q2tp62tra2zrbOts62ti62Lraat houmi4aLpouGi6aLi4uGi4aLZYtmi2WLZWZlZmVmZWZlZkJmZWY8ZkJmPGY8ZjxmPEM8QzxDANbc 1tzV3Nbc1tzW3LXc5tXO1c7i4uLi4uLU1NSt1OLi4uIAAOLi4uIA1NTi4uLiANTi4uIA2uLi4uIA zuLi4uIAAAAAAADIzqfOp86nzq3Op86nzqetp62mraytiq2Ls4qti62mraaLpoamhqaGpoZlhmWL ZYtli2WGZYtlZmVmZWZlZjxlZWY8ZUJmPGU8ZTxCPGU8QjxCPDw8QgA8AADc1t3W3Nbc1tzW3dzc 3NXV1dXV1OLi4uIAAADU1NTV4uLi4uLi4uLiANTb4uLi4gDb4uLiANTi4uLiAM7i4uLi4uLi4uIA 5s7OyObOzs7mzs6t5q3Op62tra2trbOts62zrbOtrYuthq2mrYaLpoumi6aLhotli2aLZotmi2WL ZYZlhmVmZWZlZmVmZWY8ZjxmPGY8ZjxmPEM8QzxDPEMA1tzW3Nbc1dzW3Nbd3NzV1dTVztXi4uLi 4uIA1NTUrQAAAADU4uLi4gDb1OLi4uIAAOLi4gAA4uLi4gDV4uLi4gDO4uLizs7OyM6nzq3Orc6t zqfOp62nra2trK2ts4qtra2LrYutpoumi6aGpotlhqaLZYtli2WLZYtli2WLZWZlZmVmZWZCZWVm QmU8ZTxlPGY8QjxDPDw8Qjw8PDwAANzW3Nbd1tzW3Nbd3N3c1dXV1dXU4uLi4uLi1dTV1OLi4uIA AOLi4uLb2uLi4uLi4uLi4uLi4uLi4uLV1NXi4uIA4uLizs7Ozs7Ozs7VztSt1c7Orc6tra3OrbOt s62zrbOtrYuti62LrYutpouGi6aLhoumi4aLZouGi2aLZotli2aGZWxlZmVsZWZlZkJmPGZCZjxm PEM8ZjxDPEM8QwC03Nbc1tzW3LTc1tzW3M7VztXO1eLi4uIA1NQAAADU4uLi4uLi4uLa1Nri4uLi 4uLi4uLizuLi4uLU1NXO1eLi4uLizs7OyM6nzq3Orc6tzq3Orc6sra2trK2srYqtiq2KrYqtpq2m raaLpoumhqaGZYZlhmWGZYtlhmWLZWZlZmVmZWZlZWVmQmVCZTxlPGU8QjxCPEI8Qjw8PDwAPAAA 3Nbc1tzW3Nbc1tzW3NbV1NXU1dTi4uLiAADi4uIA29TV1NvU29Tb1NvU29rb1NvU1dTV1NXU1dTV 1NXU1dTV1NXO1M7OzubOzs7UztTO1M7OrdStzq3Ora2ts62zrbOtrYutra2LrYutpq2Gi6aLpoam i6aLZYumi2WLZotli2VmZYtlZmVsZWZlZmVmPGY8ZTxmPGY8ZjxDPEM8QjxDANXc1tzW3Nbc1dzV 3NXcztXO1c7i4uLi4uLi4uLiANTa1NvU2tTb1NrU29Ta1NvU1dTVztTO1c7U1NTU1NTV1NTO1M7O zs7Ozs7UztTO1K3Orc6tzq3OrK2traytra2traytiq2Lraatpq2mhqaGZYZlhmWGZYtli2WLZWZl i2VmZWZlZmVmZWVCZkJlQmU8QjxlPEI8Qjw8PEI8PDw8AADc1tzW3dbc1tzW3Nbc3NXU1dTV4uLi 4uLi4uLi4trb2tva29Tb2tvU29rb1NvU29TV1NXO1c7V1NXU29Tb1NXU1dTU1NTO1M7U1NTU1NTU ztTO1K3UrdSt1K2trdStra2tra2tra2thq2Graathoumi4aLpouGi2WLZYtli2WLZYtlZmVsZWZl ZmVmQmZlZjxmPGY8ZjxDPEM8QzxDPEIAtNzW3LXc1tzV3NXc1dzU1dTU1NvU2tra2tra27nb2tva 29rb1NrU2tTU1NvU1NTVztTO1K3OztTU1NTU1NTU1NTU1NTO1M7UztTU1KzUzs6szq3UrM6szqyt ra2sra2tpq2mraatpq2mhqaGpoami2WGZYZlhmWGZWZli2VmZWZlZmVmZWVlZkJlQmY8ZTxlPDw8 Qjw8PDw8PDw8ADwAANzW3Nbc1tzW3Nbc3Nzb1dTV1Nva29rb2uja6Nro2uja29rb2tvU29TV1NvU 1dTV1NXO1c7VztXU1NTb1NvU1dTV1NvU1NTU1NTU1NTUztTO1M7UztSt1K3OrdStra2tra2tra2t hq2GrYathoumi4aLpoumi2WLZYZli2WLZYtlZmWLZWZlZmVmZWZlZkJmPGY8ZjxDPEM8QzxDPEI8 QwDW3Nbc1tzV3NXc1dzV3NTV1NvU2tra2tra29ro2uja29rb1NvU1dTU1NXU1dTV1NXO1c7OztTO 1NTU1NTU1NTU1NTU1NTa09TU1M7UztSs1K3UrNSt1KzOrc6tra2tp62traathq2Gp4atpoumi6aL potli2WGZYZlhmVmZWZlZmVmZWZlZkJlQmZCZUJlPEI8QjxCPEI8PDxCADw8PAAA3Nbc1t3W3Nbc 1tzc3NzV1dvb29rb2tra29rb2ujb29Tb2tvU29TV1NXU1dTV1NXU1c7VztXU1dTV1NTU1dTV1NXU 1dTb1NrU2tTU1NTU1NTU1NTO1M7UrdStzq3Ora2tra2tra2trYathq2Gi4uLiouLi6aLpotli2WG ZYtlZmWGZWZlZmVmZWZlZkJmQmY8ZjxmPEM8QzxDPEM8QzxCALTc1tzW3NbctNzV3LTc1NXU29Tb 1Nra2rPa1NrU2tTVs9TU1LPU1NWt1M7UztTO1c7UztTO1NTUrdTO1K3UztTO1NTU1NTU1NPUztTN 1M7UrNTO1K3Orc6sra2tx62traatiq2mraatpoumi6aLpotli2WLZaZlhmVlZWZlZmVmX2VfZjxl PGY8ZTxlPEI8Qjw8PEI8PDw8ADwAPAA8AADc1tzW3Nbd1tzW3Nzc1tXV29Xb29va29Ta1NXU1dTb 1NXU1dTV1NXU1dTV1NXU1dTV1NXU1NTV1NTU1c7UztXO1M7V1NTU2tTU1NTO1M7UztTO1M7UztTO zq3Ora2tra2trK2trYuthq2mrYuLiouKi4qLpotli2WGZYZlZmWGZWZlZmVmZWZCZjxmQmY8Zjxl PGY8QzxDPEI8Qzw8PEMA1tzV3Nbc1tzW3Nbc1dzO1dTb1dvV29Ta1NTU1NTU1NTU1dTU1NXU1NTV ztTU1dTV1NXU1NTU1NTU1M7UztTOzs7UztTU1NPU1NTNzs7Ozs7O1M3Ozs6tzq3Op62traytrK2K rYqtpq2mi6aLioumi4qLZYtli2WGZYZlZmVmZWZlZjxlZWY8ZTxmPGU8ZTxCPEI8PDxCADw8PAA8 ADwAANzc3Nbd1t3W3Nzc1tzc1ebV1dvV29Xb1AAAAAAA1NvUAAAAAAAA1QAAAAAAANQAANsAAAAA 1AAAAADV1AAAAAAAAAAAANTUAAAAAADUzs7OAAAAAAAA1AAAAAAAAK0AAAAAAAAAAAAAAAAAAAAA AAAAAAAAi6aLZYtlhgAAAAAAAGVmAAAAAAAAQmY8ZjxmPGY8QzxDPEM8QzxCPEM8QgDV3NbctdzW 3dbc1tzV3M7VztXV27PVAOLi4uLiAADU4uLi4uLiAOLi4uLi4gDi4gDi4uLiAOLi4uIA1OLi4uLi 4uLi4gDU4uLi4uIArM6t4uLi4uLiAOLi4uLi4gDi4uLi4uLi4uLi4uLi4uLi4uLi4uLiAGWGZYZl ZuLi4uLi4gAA4uLi4uLiAGU8ZTxCPEI8PDxCPDw8PAA8ADwAPAAA3Nbc1t3W3dbd1tzc3NbV1dXm 1dXb4uLi4uLi4uIAAOLi4uLi4tTi4uLi4uLV4uLi4uLi4uLi4uLiANXi4uLi4uLi4uIA1OLi4uLi ANTO1OLi4uLi4q3i4uLi4uLi4uLiAKzi4uLi4uLi4uLi4uLi4uLi4ouLZYtli+Li4uLi4uLiAOLi 4uLi4mZCZkJlPGY8ZjxmPEI8QzxCPEM8PDxDANbd1tzW3dbd1t3W3NbcztXU1dTV4uLi4uLV1OLi 4gDb4uLi4gDV1OLi4uIA1OLi4tTb4uLi4uLi4tTO4uLi4uLi4uLi1NTi4uLi4tTU1K3U4uLi4gDO rOLi4uIA4uLi4gAA4uLi4gCt4uLi4gCL4uLi4gCLZYtlhuLi4uIAZuLi4uIA4uLi4gBCZjxCPEI8 QjxDPDw8PAA8PDwAPAA8AADd1t3W3dbd1t3c3dzc3NXV29Xb1eLi4uIA1dXi4uLb1OLi4uIAAADi 4uLiANvU29QA4uLi4tTi4gAAAOLi4uIA2+LiAAAA4uLi4gDU1dTU1OLi4uIAAADi4uLiANTi4uLi 4uLi4uIAhuLi4uIAi+Li4uIAioumi2Xi4uLiAGXi4uLiAOLi4uIAZkJmQmZCZjxmPEM8QzxDPEM8 QzxDPEIA1tzW3dbd1t213Nbc1tzV1bPV1NXi4uLiANXU1dTV1Nvi4uLi4uLi4uLi4gDU1dTi4uLi 4tTU4uLi4uLi4uLi1K3i4uLi4uLi4uLO1NTU1NTi4uLi4uLi4uLi4gCsAAAAAK3i4uLiAK3i4uLi AIvi4uLiAItli2WG4uLi4gAA4uLi4jzi4uLiAABCPEI8QjxCPDw8PDw8ADwAPAA8ADwAAN3W3dbd 1t3c3dbd3N3c29Xb1NXV4uLi4gDU29QAAADa4uLi4uLi4uLi4uIA29Ti4uLi4tTb1Nvi4gDV4uLi AM7VzuLiAM7i4uIA1dTU1NTU4uLi4uLi4uLi4uIA4uLi4gAA4uLi4q2L4uLi4gCm4uLi4gCKi2WL ZYbi4uLi4uLi4mXi4uLi4uIAPGY8ZjxmPEI8QzxCPEM8PABDPDw8QwDW3dbd1t3W3dbd1t3c3NXV 1NXU1eLi4uIAANTi4uIA2+Li4uIA29Ti4uLiANTi4uLi29QAAADU4uIA4uLi4gDOzubi4gDi4uLi AM7U1NTO1OLi4uIAzqzi4uLiAKzi4uLi4uLi4q2mreLi4uIAi+Li4uIAi2WLZWZlZuLi4uLi4mVm 4uLi4uLiPEI8QjxCPEI8QgA8PEIAPAA8ADw8PAAA3dzd3N3c3dzd3N3c3dzc1dvV1dTV4uLi4gAA 4uLiANri4uLiAADb4uLi4gAA4uLiAADi4uIA2+Li4uLi4uIAztXO4uLi4uLi4gDUztXU1M7i4uLi AADO4uLi4gAAra2tra2tra2trYvi4uLiAIbi4uLiAIqLa4tli2VmZWZlZmVmZWbi4uLiAAAAZjxm PEM8QzxDPEM8QzxDPEM8QzxDANbd1t3W3dzd3N3c3dbd1dXU1dTVzuLi4uLi4uLi4gDi4uLi4uIA 4uLi4uLiAOLi4uLi4uLiANTi4uLi4uLiANTOzuLi4uLi4uIAztTO1M7i4uLi4uIA4uLi4uLiAK2t raatiq2mrYri4uLi4gDi4uLi4gCLZYtli2VlZWY8ZTxlPGU84uLi4uLiADxCPEI8QgA8PEIAPAA8 ADwAPAA8AADd1t3c3dzd3N3c3dzd3NbV1dXV1NXU1eLi4uLi4uLb4uLi4uLi2uLi4uLi4tvU4uLi 4uLi4tTb4uLi4uLi4tvU1NTi4uLi4uLiztXO1M7V4uLi4uLireLi4uLi4q2tra2tra2trYut4uLi 4uKG4uLi4uKLi4tli2WLZYZlZmVmZWZCZkLi4uLi4jxmPEM8QzxCPEM8QjxDPEM8Qzw8PEMA1t3W 3dbd3Nzc3dzd3N3m1dXV1NXU1dTV1NvV29vo2tva29ra2tva29rb2tvU29TV1NvU1dTb1NrU29Ta 1NrU1NTU1NTO1M7UztTOzs7Orc7O1K3Orc6tzq2zra2traytp62mrYqtpq2GraaGpoumi4qLZYtl i2VsZYtlZmVmPGU8ZjxlPGY8QjxDPEI8Qjw8PEIAPAA8ADwAPAA8ADwAAN3c3dbd3N3c4tzd3N3c 1tXW1dXV1dXV1dvV29vh2+jb6Nvo2uja29rb29va29rb1NvU29Tb1Nva29rb2tvU29Tb1NrU1dTU ztXO1M7VztTO1c7UztXOzq3UrdSts62tra2tra2ti62GrYaLpq2Gi6aLi4tri2yLZYtmi2VmZWZl ZmVmPGZCZjxmQmY8QzxDPEM8QzxDPEM8QzxDPEM8QwDW3Nbd1tzW3Nbc3NzW3ebWz9XV1dTV1NWz 1dXb1dvb6Lnb2tva29rbs9rU29Tb1NvU1NTV1NTU29Ta1NrU1NTUs9TU1NTUztStzs7Ozs6tzq3O rc6tzq3Ora2traytra2mraatpq2mraaGpoumi6aLZYtli2VsZWxlZmVmZWVCZjxlPGU8QjxlPEI8 Qjw8PDwAPAA8ADwAPAA8ADwAPAAA3dbd1t3W3dzc3N3c3dzW1tbV1tXV1dXV1dXb1dzb3Nvo2+jb 6Nro2tva29rb1NvU29TV1NXU29Tb2tva2tTb1NTU1dTV1NvU1M7VztTO1M7UztTOzq3Orc6t1K2t ra2trYathq2GrYaLpq2Ki6aLpoumi2WLZYtli2WLZWZlZmVmPGY8ZjxmPEI8ZjxCPEM8QgBDPEI8 QzxCPEM8PDxDANbd1tzW3Nbc1tzc3Nzd5tbm1ubV1dXV1dXV1dXV29Xb2+jb29vo2tva29Tb1NvU 29TV1NXU1dTV1NvU2tTa1NTU1NTU1NvU2tTa1NTO1M7Ozs6tzq3Ox86tra2tra2mrYatpqeGraaL poumi6aLpoumi2WLZYtlbGVsZWVlZjxlPGY8ZTxlPEI8Qjw8PEIAPAA8ADwAPAA8ADwAPAA8AADd 3N3W3dzd1t3c3Nzd3NbW19bW1dbV1dXV1dXV3NXc1dzb6Nvo29vb6Nvb2tvU29Tb1NXU1dXV1NvU 29Tb1NrU2tTa1Nva29rb2tvU29TU1NTO1M7Ozs6tzq3Orc6traetp62GrYathq2Gi4qLi4umi6aL ZYtli2WLZWZlZmVmZWZlZjxmPGY8ZjxCPEM8QzxDPEI8QzxDPEM8QzxDPEMAtd3c3bXc1tzW3Nbc 1tzV1tDW1dXP1dXV5tXm1ebV1dXV29vb29vV29Tb2tuz29TV1NXO1c7mztXO1dTV1NTU1NTU1NTT 1NTa1Nra2tTa1NTU1M7UrM7Hzsetp63HrcetpqeGp6aGpoumhqaLpoZlhmWGZYZlZmVsZWVlZjxl PGU8ZTxlPEI8Qjw8PEIAPAA8ADwAPAA8ADwAPAA8ADwAAN3c3dzd3N3c3dbc3Nzc1tXW1tbV1dXV 1dXV1dXV1dXV29Xb29vV29Xb1dvb29rb1NvU1dTVztXO1dTV1NXU29TV1NXU1NTa1NrU2tTa1NvU 1NTUztTOzs7Op86nzqetp62GrYanpq2GrYathoumi6aLZYtlhmWLZWZlZmVmX2Y8ZjxmQmY8ZjxC PEM8QjxDPEI8QzxCAEM8QzxDPD08QwDW3dbd3N3c3dzc1tzW3ObV1dbV1dXV1dXV1ebV5tXm1dXV 1dvV29TV1dXU29Tb2tvU29TVztXO1c7VztTU1dTU1NXU1NTU1NTU1NTU1NrU1NTUztTOzq3Orc7H rcetx62nraanhoamhqaLpoami2WGZYZlhmWGZWZlZl9lX2U8ZTxlPEI8QjxCPEI8PABCADwAPAA8 ADwAPAA9ADwAPAAA3dbd1t3c3dzi3N3c3dzV1dbV1tXc1dXV1tXV1dXV1dXW1dXV29Xb1dvV1dXb 29va29rb1NXV1dTV1NXU1dTV1NXU1dTV1dXm1ebVztXU1NTV1NTO1c7Orc6tzq3Ora2nraethq2G rYathq2Gi4aLpoumhmWLZYZlhmVmZWZlZjxmQmY8ZjxDPEM8QzxDPEI8QzxCPEM8QzxDPEM8QzxC ALXc1t3W3dzd3Nzc3Nbc5tXm1dXV1dXV1bTV1dXO1ebVztXV1dTV1NWz1dTV1NXU27Pb1NXU1c7V rdTU1c7UztWt1c7Vzubm5qjm5uatzs7Orc6tzq3Orc6sra2tx62nraanpqeGhqaGhouGi6aGZYZl ZWVmZWVlZl9lX2U8ZTxlPEI8QjxCPEIAPAA8ADwAPAA8ADwAPAA8ADwAPAA8AADd3N3W3dbd3N3c 4tzd3NbV1dXV1dXV3NXV1dXV1dXV1dXV29XV1dvV1dTV1dXU1dXb1NvU1dTV1dXU1dXV1NXV1c7V 5tXm1ebm5ubm5s7VzubO5s7Orc6tzq3Ora2nraetp62Gp4athq2GrYaGhoamhmWGZYZlhmVmZWZl ZjxmPGY8ZjxDPEM8QjxDPEI8QzxCAEM8QzxDPDwAQzw8PEMA3N3c3Nzd1t3c3Nzd3N3V1tXW1dXV 1dXV1dXV1dXV1dXV1dTV1dXU1dTV1NXU1c7V1NXU1dTVztXO1c7V5tXm1c7VzubO1c7mzubO5ubm zubO5q3Orc6tzq2tp62nrcethq2Gp4aGhoaGi4aGhoZlhmWGX2VfZl9mX2Y8ZTxmPEI8QjxCPEI8 QjxCADwAQgA8ADwAPAA8ADwAPAA8ADwAAOLc4tzi3N3c3dzi3OLc3Nbc1tzV3NXV1dzV1tXc1dXV 29Xb1dvV29Xb1dXV1dXV1dXV1dXV1dXm1dXVztXm1ebV5ubm5ubmztXm5ubQ5ubm5s7mreat5q3m ra2nra2tp62nz4aohoaGi4aGhoaGhmaGZoZfhmVmX2ZlZjxmPGY8ZjxmPGY8QzxDPEI8QzxDPEM8 QzxDPEM8QzxDPEM8QwDc3dzd3Nzc3Nbc3N3c4tXctNzV3LTV1dXm1dXV1dXV1dTV1Nuz1dTV1NXU 1a3VztXO1ebVztXO1c7VztWt5s7myObI5sjmyObI5s7myebm5sjmreanzq3Ora2nrYathqeGp4an hoaGhl+GX4ZfhmWGX2ZfZl9mX2Y8ZjxmPGU8QjxCPEIAPAA8ADwAPAA8ADwAPAA8ADwAPAA8ADwA PAAA3dzd3Nzc4tzc3N3c4tzc29zc3Nzc1dbV1tXW1dXV1tXb1dvV29Xb1dXV1dXV1dXV1ebV5tXm 1ebV5tXm1ebm5ubm5ubmzubm5ubm5tDm0Obmyebm5q3Vrc6tz62thq2Gp4athqeGjIaGYIZmhmaG ZoZlhmZmX2ZfZl9mZWY8ZjxmPEM8QzxDPEM8QzxCAEM8QjxDPD0AQzxCPEM8QzxDANbd1t3c3Nzc 3Nzc3Nzi1dzb3Nvc1dzV1tXW5tbm1s/V1dvV29Xb1dXV1dXV1dXm1ebV5tXm1ebV5tXm1ebm5ubJ 5snm5ubO5ubm5ubm5snmyeao5qfmrc6trYathq2mp4anhqeGhqKGYIZfhl+GX2ZfZl9mX2Y8Zjxm PGY8ZjxCPEI8PDw8ADwAPAA8ADwAPAA8ADwAPAA8ADwAPAA8AADd3N3c3dzd3OLc3Nzi3NzV3Nzc 1dzV1tXW1tbV1tXW5tbV29Xc1dzV3NXW1dXV1dXW1dXm1dXV1dbV1ebV5tXm0ObQ5tDm0ObW5ubm 1ebm5ubJ5qjm5uat1a2tp62nrYathqeGqIaMhoaGhmaGZoZghmZmYGZgZl9mZmZCZkJmPGY8QzxD PEM8QzxDPEM8QzxDPEM8QzxDPEM8QzxDPEMAtdzW3dbd3Ny73Nzc3NzV1bTW1dbV1tXWz9bm1s/W 5tbP1ebV1dXV1rTW1dXV1dXV5tXm1c7V5tXO1ebVz9Xm5s/m5tDJ5ubmyebm5s7mzuan5qfmp+an 5q2tp62mp4anpoaGhoaGooZfhl+GX2ZfZl9mX2Y8ZjxmPGY8ZjxCPEI8PAA8ADwAPAA8ADwAPAA8 ADwAPAA8ADwAPAA8ADwAAN3W3dzd3N3c3dzd3N3c3NXW1dbV1tXW1tbW1tbW5tbQ0ObW1dXV3Nbc 1dbV1tXV1dXV1dXV1dXV1dXV1dbm1ubQ5tDm0ObQ5ubm5ubmzubO5qfmqOan5q3mra2nrYbPhq2G rYaGhoyGhmCGZoZghmBmYGZgZl9mYGY8ZjxDPEM8PDxDPDw8Qzw9AEM8PDxDPDw8Qzw8PEM8PABD PD08QwDW3dbd3N3c3dzd3N3c3dXW1dbm1ubW5tbm1ubW5tbm1tDW5tbV3NXc1tzV1tXc1dXV29XV 1NXU1dXV1dXV1ubW5tDm5ubQyebJ5sjmzuat5q3mp+an5qfPp62GrYaths+GrYaGhoZghmCGX2Zf Zl9mYGZfYDxmPGY8Zjw8PEI8PDw8ADwAPAA8ADwAPAA8ADwAPAA8ADwAPAA8ADwAPAAA3dzd3N3c 3dzd3N3c4tzW1tbW1ubW0NbQ1tDW5tbV1ubW0NbW3dzd3N3W3NXc1dzb3Nvb29zV29Tb1dzV3NXW 5tbm0ObQ5tDm5ubmyebm5s7mzuat5q3mp8+nrYbPp8+Gz4aGhoyGhoaGhoZghmaGYGZgZmBmYGY8 ZjxDPGY8QzxDPEMAQzxDPEM8QzxDPEM8Qzw9PEM8QzxDPEM8QzxDANzd3N213dzdu93c3dzd1tbW 1tDWz9DQ0NDQ0NDm0ObW5tbW1rXd3d273NbctNbV3Nvb29y029XV1NXV1tXV1dbm0ObQyebJ5snm yean5qfmp86n5qetp62Gp4athqeGrYaGhoZghmaGYGZfhl9mYGY8YDxmPGA8Zjw8PDw8PAA8ADwA PAA8ADwAPAA8ADwAPAA8ADwAPAA8ADwAPAA8AADi3eLc3dzd3N3c3dzd3N3W19bX1tbQ1tDR0NfQ 0dDW0NbW1tbd3eLd4tzd1tzV3Nvh3OHc3Nvc1dvV3NXW1dbV1ubW5tDm0ObQ5tDJ5sjmyOan5q3P p8+nrYbPhq2Gz4athq6GhoaGZoZmhmZmYGZgZl9mX2Y8ZjxDPEM8QjxDPDw8QzxDPEM8PTxDPDw8 Qzw9PEM8PABDPEM8QzxDPEMA3eLd4tzd3N3c3dzd3N3W19bd1tfQ1tDQ0NHQ0dDR0NDQ1tDW1t3c 3Nzc29zb3Nvc3OHc4dzc1dzV3NXW1dbV1tXW5tDm0Mnm5ubJ5snmp8mn5qfPp62GrYathqeGhoaG houGhoaGYGZghl9mYGY8Zl9mPGY8Zjw8PD08PAA8ADwAQwA8AD0APAA8ADwAPAA8PDwAPAA8ADwA QwA8AD0AAP/d/93i3OLc4tzd3N3c3dfd193X19DX0NbQ0dDX0NfQ19bX1t3W3Nzh3Nzb4dzh3OLh 4tzi3NzW3Nbc1t3X3dbd1tbm1ubm5tDm0MnQydCo5qjmp8+nrYathq2GrYaLhq2Gi4aGhoZmhmaG ZmZmZmBmYGY8ZjxDPGY8QzxDPEM8QzxDPEM8QzxDPEM8QzxDPEM8QzxDPEM8QzxDPEM8QwADAAAA AAA= ------=_NextPart_01C8E823.DA10E9A0 Content-Location: file:///C:/8E69C634/Classof2004_files/master04_image001.jpg Content-Transfer-Encoding: base64 Content-Type: image/jpeg /9j/4AAQSkZJRgABAgEAYABgAAD/7QE0UGhvdG9zaG9wIDMuMAA4QklNA+0AAAAAABAAYAAAAAEA AQBgAAAAAQABOEJJTQPzAAAAAAAIAAAAAAAAAAA4QklNJxAAAAAAAAoAAQAAAAAAAAACOEJJTQP1 AAAAAABIAC9mZgABAGxmZgAGAAAAAAABAC9mZgABAKGZmgAGAAAAAAABADIAAAABAFoAAAAGAAAA AAABADUAAAABAC0AAAAGAAAAAAABOEJJTQP4AAAAAABwAAD///////////////////////////// A+gAAAAA/////////////////////////////wPoAAAAAP////////////////////////////8D 6AAAAAD/////////////////////////////A+gAADhCSU0EBgAAAAAAAgAC/+4ADkFkb2JlAGSA AAAAAf/bAIQADAgICAkIDAkJDBELCgsRFQ8MDA8VGBMTFRMTGBEMDAwMDAwRDAwMDAwMDAwMDAwM DAwMDAwMDAwMDAwMDAwMDAENCwsNDg0QDg4QFA4ODhQUDg4ODhQRDAwMDAwREQwMDAwMDBEMDAwM DAwMDAwMDAwMDAwMDAwMDAwMDAwMDAwM/8AAEQgCWAMgAwEiAAIRAQMRAf/EAT8AAAEFAQEBAQEB AAAAAAAAAAMAAQIEBQYHCAkKCwEAAQUBAQEBAQEAAAAAAAAAAQACAwQFBgcICQoLEAABBAEDAgQC BQcGCAUDDDMBAAIRAwQhEjEFQVFhEyJxgTIGFJGhsUIjJBVSwWIzNHKC0UMHJZJT8OHxY3M1FqKy gyZEk1RkRcKjdDYX0lXiZfKzhMPTdePzRieUpIW0lcTU5PSltcXV5fVWZnaGlqa2xtbm9jdHV2d3 h5ent8fX5/cRAAICAQIEBAMEBQYHBwYFNQEAAhEDITESBEFRYXEiEwUygZEUobFCI8FS0fAzJGLh coKSQ1MVY3M08SUGFqKygwcmNcLSRJNUoxdkRVU2dGXi8rOEw9N14/NGlKSFtJXE1OT0pbXF1eX1 VmZ2hpamtsbW5vYnN0dXZ3eHl6e3x//dAAQAMv/aAAwDAQACEQMRAD8A791yDZeqn2lAsvWlHDqm SW+xVHOUX2KBViMKWLqCTnJKQBC0J2tTtU2tSJXMq2qw32oLfal6ijItXEn9RDssQ/UVey5GOPVk jPhXusVVzk9liCrEI0F5nxLOTJ1JSLoxYQnaEoTykv8ASya1ECG1yQcmkMUskWyHIjFXYrVLVFPR hlkTVVOcrLKtqVLWq7VW1VMmRgyepqChyZ1W1aD2taqlzmpsZklrSwNX6LkWu9zUCxyGHKXhsasU sXC6TMjcjC1ZbLEZlqjliWeqLoB7UiVUFyRvUftlXEmc5qq2uamsucqtj1NDGu4lWOaglRe9qhvV gRXjK2G27EQZZCqApykYA7s4zFsuzCg2ZJKCXIT7E6OMdmQZZSZW2EqrY5O+0oDnkqeEGQC1nOQn FO4qJU4C7gYkpiU5TFOCQwJUC5SchOTqTxUsXhRLwmKZAwQcqxMqJCnBShRyYpZEJaolqOWqJaoi WIm0BUZRXBQKYQimBUSpkKG0ppC6loShTDU8JhCaRbVEhGIhDcEwhcAiIUHIjlAppDIAEZUCiEKB EJlJpgVEhTITGECEhGQokIhCiQmUupGVEqZCgU0hDEhQIRCExCYQi0RCiQilqgQmlDBMpkKJCYQp ZIFJMmpZpKIKlKSlJinTFJIWSSSSUV0ySSSFJJk6KlJJJJKUkkkgpeU6inSUukmSSSuhHlF7IR5U WXogv//Q3vUchvtQtyW5b4gqTNOh7lJEhjlJSdqgn3JUx8aRqlKHuS3IUs40m5LchqLnJCK73V7L FXc5Sco7VJEAJjlRJIkJbU+2aMmG1PtU2tTwha73kKSLtS2o2xyySRlJpTuTbkkRjKSWtzWqzXaq G9TZcmyha+QjF2KMjarrMlqw6rVYZequTCC1pZHUfk+1VrLNyALUOy1Njioq4mVj0Pchucm3KYRW SThyIHqmbUvVS4GtMSk3hakbQqHrqJyEvaYuBu2WgKrbc4qu64qO9ykjipdUkm9Sa5Vw9TFieYro xk2Ui5BFikbEzhLPEMXuQHlFe9AepIBsQAYOKE4ojkJymizxYOKgSpkKBCkC4rF6gXJyCokFOADG SxKYqRCcBOWHIj2JbAiQmKZIsJkSx2BMQnJTEphSAxKG5TJTRKaQv4dEJCiQrBrUXMUclkiA14SA U3CFEEBRFQK4akWwE7SFJ0QmkMltd6E5FeguQpMTqjcolSKiU0xZhsxJUHKTioEppASQxJhRJnhO SokJpC0Glx4Ji1LVOCmELr6oyFBwRnCdVAhNpdYKJIBSIUUwhaQotUC1GGqTmSoytLWIUSEYsUC1 NQjIUSpkKJCBCbYpwUkyYUspSTJJKUkkmRSukmToIWSTpkkrpJJIqUkkkghSSSSSlJ0ydJKihqag os3RBf/R0FJQSXSUxSkkTKCk1CmvKTJJPCi7a1Bi4mUqbUCURqRCuJmm2oja1NtaYZUs4kLa03pq 62lM6lN9xfxNM1qG1WHVqDmp4kyRyI4TSk5RTmSMmSE5yk5DlOAXcSnlDIU9qdlW5PBAVLLwo2tc 5TYxHazapbE0za2TPxMAHIzA5Oxm1PMKMyth42O4ptyi5yi5yQDNGa7nKJcoOcoEp4iqSTcnJQi5 R3p3Ct4UjnKG5D3Jk4RXcDLckoblII0rgZAKW1RBUkCjhW3FN6hTuQSkBa8LusKgXlRc5Rc5SCLN BmSokoTnqDrCniDYATEpihAlEaUapaZBRamLFIlOELYzJH6aW0ooUoS4lhFtVwKE4qw9AenKGNGX Ji5IpQgYs0YBSkAkGooamSWZCAGEIb0ZwQnqGRapNlC9AcEZ6C4phXBbUKJsKTioFKmQFdzyhu1T lNCFJDFRKIQoFNIbECichlFchFMISSxTJ0kwhaSsmhSShNVbGdFEhTKiU0hINIyExCkVEppCbUDC mFBOCo5BBK5aChlqLKiVGQsQuahlqOVAhNSChITIhaokIFNsEk5CZNSpJJJJNqTKSZJSkkkkkKSS SSSpJJJJSkkkklKSSSSUFKCmoKLL0UX/0tBrVL00VtaTmrouLVpSkhhTaEkkiWPhU521Ac7cnsdu ck1qcBQTw8LOtqsVhRrajt9qjnJjkza1Ta1Da5Fa5QytXClIQrHbUz7Nqq2WJQgSrhZ2PQHWKLnK JKnjGly25QUtqeE9d7jHamDUQBJK0SmxDERsBQlOCgWKckkpwUMFPKbTDqk3KBKYuUSUgEqJUCnJ USnhcCsVEpyoEpwXCSiopFJOXiSxTKUJQiuE2CScqJJRTxMgVLehhOWpUgyXc9Qc5M5DdKcAqJWc 9CcSibHqPplSCmeE5BEU0KUFNBTl/uGXVQdCXqFItKbYSjosK/qlOLkzaSeVMUgIHhRxhIx8ohIQ CY4SDymcLLCizeAgOrRS6VEoheTSA1p9qmVFIlillK7YUpCimKikWGcrU4oTypuQ3JhY0TkJzZRn KBTaZAWu5hUCEd6gQE6lwIRwnhPCUJhZYi2BQnIrihO1KaWUaIXSoGVY2SmNSjNIJa4ClCJ6ZCWx MKrRQkiEKBTaRbAhRIUyoOQpFsCmKcpoTSF1sU6SdMIVayZOVEphClioqRUUwhCxCgQiQmITCFIy FEhEIUSE0ptgkpEJoQTaySdMkq1kk6SClkkkkUqTJ0kk2snTJ0lKTpJJKWUFNQUWXoov/9PccWtV WyxNbcq+5zl0cIdS1/bS+oluc5QaxHbWnGgnhjFg2tFaE6W5MJJa0vVJLuSdYgusQfUQELVwtn1E 3rKv6ibduTuBSd1zlDeoQpQlQC2S0qbQoAIgKJWELhsJikXKJcmqXJUC5M5ygXJ4Cme5IOQtykCj SjFKCnlQCkE0hYYrymKeExSWlYlRJTlRKIQFiVAqcJBkpy66YBsqbayisqRm1JpmsllAa4qTFitF oCE+E0TtYMhJazmqBajOhDKlBZ4yNMdqfaknlG1SkxLQkKwpKJSspjm4WYaxRc1ijKSVHur3SUbm BD2BH2yl6aeJLhk8WuWpAIzq0NwRBtlhET/SWUXJGUxTgzjAN7RuTBFhNCNsc8nBswCRUoUCkSwn OSsVEqRShNJVxsEiVKExAQK0yYEobiiEKJTSEWiKgUUqDkKXcRROCiQiOUCUCvBLGExTkqJcEyTJ CRCNyh3RCVA8qMs/HozaxTDBCashF7KOTGZIXVhBc2FZchOTUiTXc1DIRyFBzUFSkhIUSEQtUS1A lbxIi1Rgo+1MWJpKRJFCUIhbCiQmFdxIyFEhEKgUwpBYFMkQkmkJtSZOkUwhFsVEhSTJpCbYkKJC mVEppTbFMpEKKalSZOmRSukmTpKUmTpJJWSTpkkrpkkklKUFNQUWXop//9Sx9JGrYmrYj/RXSyl0 CxZrUQFDdYo+omUSwZJM3OQ3OUXOUHOThFjXc9RlMk1qfS3iUCjAbWpmM/OTuO521NJtMBKUmTG7 nKRYpsZtao2OTLs6MmTHwxYEwm3KJKaU6muQyLlAuSKiU4BVKJUSU8JbU5KwU2hOGIjWJpKCs1qI GIjKkZtSilNhnNr7FAtVo1qBrQEmPiaxao7VZ9NL0k7jVxgIG1orKkQMhS0CBmxyyKawBJxAUXPh BfYmiJLFqV7LFXfYk9xQHOKnhBnxwZOsUdyGSkFLwtkRoJNyUqAUwEFklSkQSphqkGIXTEZUjDCn FaLwoOKFkrbUICaVHcklSCVRKjslTAUg0o3ShnmOrXNSY1K0KnlOKHI+54rvvk+7UFKkMclW20nw RW1nwTTlY5czItD7N5JnY4HZX3NQHhIZCUDKS0nVAKBYFYeEF5CkDLGRROEITipvcq73J4DNFdzk Nz1FzlBxTuEMgiyc9QLlEpFMIXcK5Kg4pFRJTJLwFnFQc5O4qJUZXgLFyinShMKSWQKIHaIWoUhK ZILbZOKgSnMpimEKtgVEhTKiUwqsoyFGEQqKaVBjtS2qYCltkJhKbpA4IbgjuahPCakFCVAohCgQ kvYFRUyE0JpSsmUkyYVMSoqRUSmlcFkxSSKYQpiUycpkCErJk6ZBKkkkkkqTpkkkrpk6SSQskkkk lZRU1BRZeiH/1dP2tUH2IbnIZculEWvNnuS3IQUmlPpZKK8ptqdoRGhC6YpSYAIgYpAJ00yQpztr U1A3O3OUVMO2tQOzYwx4UtjkE6ptxKSAFIyzs2smhSTJzXkWMJQnUmiUrW2xDVMMRGMRBWmmaOJE 1iNXUptrViutRSmxZMlBjXUi+mptACckKEyJLVlksoXMQyxHJCgSiCVvGi2JiAplyG5yeLW8RLFx hCc5ScUJykiF4CznFDMqcJEJ4XhA4ILgrLghOCkiWaEkG1OGom1TaxOMmQ5NGDWIja0VtaIGKOU2 vPKhDE8QilqG5AG2HitG5QKdxUSU8J1UApBiiCptISNqMZLtrRm1hQDgnFgTDZWGBbDGhEAaqZvh QdknxTfbkVvtEtx72hVrL44VV+SfFBdeVJDCzQwNp95QX3KubUM2SphjAZBiTPtCC96YiVBzU8Uy iICKxyC4or2oZanMgCMtlIsKMGhS2hMlOl/FTWLEi1WSxQc1RnInjazmoblYc1CcxMMlwKEpFsqZ YltQJX2j2pbUSExCbJBLCE4CR0TtIUZKwlcNSczwUgQlPioza2yhIhRIRSAVAhBcCiIS2ypwnDU0 6Lr0YbVIaaKe1NChkVpKN4QXNVkoTghaQS1nMUHNVlzUJzUbZBJAQokIrghkIMgLBMpFMUCuYlQK mVEhNKQwTKUJQmFLApKRCiQmlSyZOmQSskknQUsknTJLl0kydJSySSSSVlFSUVFm6Kf/1rbwhbFZ ITbF0wkxxihaxT2IjWKWxIyYsxRtYiNClClCYZNeTCVFTUISC+MVpSShPCLJLJwxWJTSk5QJRAa0 pspSlDlOCjTEZMwiMCG1GrTZIMmxWxHbWoVBWWgQq05MU50xbWpiAkSAoOemalrTmSyL1EvQy5RJ ThFiJZl6gXqJKiU4BIXLlHlOApbUdlwREKBCM5CcU4FeCxUSUiVElPAXhi5DIRCm2p4XA0wDUVjU mtRGhCRWykya1ThMCkSo2EksXIL0VxQnJ0VBE4KG1FKZSAsnFTANS4TuKg5ycLKo2ovUDYouchuK eIsoCR1iE56ZxUCU8RXgKdYobkimhPADIFAqQTAaKSZJRUmKcqLim6qROCgQilRKNrrYwpJlIJky glYhRcFMqDlCShE4KDgiFDckyBGQolqIU0IlcSjITQi7UixMJVxIHMMIRJaVbLUG1gKC5G2xSLpQ CCCptMppiFcPVmCniVEIjUwrTottTQi7dEzmqGRRbBMQplMVEVIyFAhEMIbiEhquCNyE5EcUFzka ZIhg5QcpOKiUmQMCokKSYhNK4MUxUimQK5jCaFJMmlTEhRIRCFEhNKkZCZSITIFcxSTpk1SkydJJ KydMkklSSSSSllFTUCos3RL/AP/X09ifapppXQ2V8osYUoTylKVtWUWG1JydRcixcKyUJpUmhFcq FFwU1FxQDVzSROQ3IrghOUkWG2KkE0KQCcUMmo9aCEVhhRyQW5W6Eb1FTbZCRtUBhbDIW2nWqBfK r+pKm10o8FMMopeUoTNUk0sZCxCjCkUyS8BcBOU0qLikpg8oDnIjyguUsQviFiUkyQT2Sl0gEk6S iuFIFQlNuQpaQk3Ji9DLlAvREUcKUvQy5DNig6xPEEjGkL1B1iC+xBfanxgzRwlO61QdYq7rE29S jGvGBNvlJCBRAlVKMKWUYRQE21K1iPakGooanDUuJdxIg1Iou1DcEFcSNyiXKTghlIrrWSKRUSmF NrpSolKUySCzJUHFIlRJTCEhi4qBUimISZAwhKFKEoQKLUlKYpEppClnITlMlQKK8FDY2UIAgo7g oFqYSuElBEYoAIjdFGUSSDhMQkEioZBj6ozomJTuQ3OTKXDVZxQnuUnOQHlEBkjFi9yGSncoGUiy iliUyeE8JpXWwhMQiQokJpVbAhRUyolBcGKSRSQKVkxTpimlTEqJCmVEhApDGE0KRCZNSsmKdMgp SZOmSXKSSSRUsoqSioc3RL//0NMOS3IO5NuXScLNKSfcm3IW5LclwtaSTeo7lHcklSzhZNKJKHKf ckQw5JM0nKO5JCmlkYEIZGqMltCcCsRBqkAphqRCVqYgKQMKJKaUkM96bcoSnCVLSlaUVhQWorSm SYpBM0qW5CDki9R8KzhZlybehOeoGxOEF3C2N6iXIPqJb0eBHCzcUMp9yYlELwGMJJ0kVyyRKdRK KFiVEuSJUHFOAUpzkNz0nFDcVIAviFy9Dc9IlNtJTwAyxADBxKHBVptKcUI8YDJ7kA0nMKaCrrqE J1KcMgT74RNRGpticBIljlIFkFMIQKm0ppDGUgCltTNKIEwlYSjc1Dc1HIUHBLiW8TWc1CcFYeEF yQK+JRkKBRSoEIFfbApFThRITSm2JTFSKiQmlLEhKFKEoQJTxMYTEKcKJCYSm2BQ3FTcEMorwFiU xSKSBK6mJCaFNJRkrbYhqcNSUgUwpVCZynooOUZRSNyE5EchPQIXAIXEobiiPCGQkyhgU0KUJQml dbGEoUoTEJpTbEhRKmVEhBIYFRIUyExCBXoyE0KcJEJpVbCElIhNCapgVEhTITEIJDAhMQpJigQk MSoqRUSgQlZJIpILlkkkkUrqCmoKHN0U/wD/0T7ktyilK6mmv7yWUpUJUpTaTGS6koJylSpSVuS3 JlBKmtOXEm3JOehblFzkeFr8KfeptcqjXKzUxyEogIlHhTKDiiPIaIQYLio4sYCxUVMtKiQnhRKy kFGU4KRWSKQKYKECn3JpCxLuUS9D3Ji5IRXALueo7lElNKcAlnuThyFKeUaRSXcn3IW5OHIcKaSg p0MFTBTSEFcqJTymKQQjchuRXITk8KtG5QKm5MApAviVmslFZUnraEZpATZSKJTKm1KfphNvATeo FHqWuTMqdWEF9aKbAoucjEkIiS1XsQnBWXoLwpolmhMoSUmlJwTBSM0UzHIrSqzXKYsTJRWyCcuU XOQTcoutTOErPbKnlCcVJxlDThFmhGlymKQTIEJIUQowpFMUwhDApQnKSaUrQlCdPCYSgljCYhTh RITCUcSJzUNzUdwQnBG2aMkRCiVNygUiWS1JJlIBRkrVkgnhNCaSq15UCU5UCU0rmLihuKm5CJQI SAxdqhwiSolNK8MITEKZCYhNXMCE0KcJiE1LAhMQplMUCutgQokIhUCU1VsSExCclRJQKViFEqRK gShSVFRKeUxSpIYlMU5TFAr2JTJymTSlZMnTFBSySSSS5SipqChzdFP/0iSknaE5C6pzl5TyoylK DNGTMFJzlHclKFMcpcUlkpTJoRY5KlRUoUmV7ijdIXqrJcr9TNFGmmArTWhoVfJktrzmgdUSh7Np Vh7/AAQXOTYksZygLQIQrNoTveUBxJUkYreK1EpAqOqcBSKLOUpUUkFLymlMkjS5SSZOkpZNKRTE orgF5TgocpwUqXUmDlIOQgU4cmkLSE25NKhuTbkKWFmUMp9yiU4BYwITBScoJwXsg+EnXILioOJT hAFfwWmN6QtVfVSCdwhPthOLFLeghSATSAsMAzJlNEpwFJoTbpiOiFzEFzYV0tQbGJ0ZJhkarnQo OeUVzUNzFMKZwQwLynaSpCtSbWgaXGQWASIUw1IhAreJEQmKm4KDgmkLhqsSokpOUSmmLIIsgU0q BKeVHIKMGcp5QpT7lGQslBnKYlQLkxcozFZwqc5DJSc5Qc5KmWMVEqBSJTFIslLhSCgCpAqMoIZQ mISlMUwlaxcoORChuStcCjchEojlByTIGBUZTlMUCF4UmKSZMIXLpkimJTSFLFRJTlQKBCVEqEpy ooELgolRlShNCalgmKlCYhJLBMpEJiECpiUxTlMUCuCyZOmTClZMU6YoJWTJ0yCVKKkoqLN0U//T K0JyVEFIldVTQjFclNKgSnlGl0vSuSnlQJSaEqYkjU8JgVNpTStKmsVipiEwKw0gKOZY5lOwwpEk hBDlIOUJDTmVyFEsUwUoStrGaBzEI1q5sSFScJ0kTaYpUxQrraUQUhA5l/uOe6lCdWtJ9KA6tGOR kjNpemVHarnpqLq1IJp42ttTEIzmoZCILIERUCUQhRhPDIGCcJ9qkGI2q1gmJU4Q3JBSt6behuco 7k7hXGDY3pbkAOUg5LhYzBKmhIKQCaxlEWKG1WdqbYjxLhNritOGo21LajxLuJgGqYapAJwE0lZI rBqk0KQCcptsEisUF6I4oTijEJiEJCiWhEcoqQFktYNCeAmJTFyRTqvCg5OSmKQKYsShkKblApEs oLBwUCEUqBQJZBJgQmKmVApkl3EsU0pFMmEJIUSokpymKBC2tWJKg4qRUCgQyxisSmJTEpiUwheY spTgqEpwVFJZIMwUpTSkUwsdKJQ3FSJUHFCkgMHFDKmSoFFkAYFMU5TQgV60JoU4ShNKbYFMVMhR ITbTaMqJUyExCRXWwhNCnCeEwqtHtTEIsJiE1VoiFEhFIUCEk2jIUCiEKBQXBgUykVFArlkxTlJN SxSKdMglZMVJMUFMVFTUFDm6Jf/UdrkxchtKeV1tNKEWYKkoNCJCBVOLEhPKRCi4oMTOVNrkDcpg pEIMWyHJ9yC0pw5RmLXk2WuU2uVYOU2uTTFgnFtsKnKrh2ikLFGYteWNsAooCqtsU/VUZiWHhLaB CkHBVPWUxammBX8BSPKHCibFHeiIldGLKENwT71Fzk8Ar4o3hBLUdyjCkBpeCg2KOxH2pbE7iXca DapBiLsS2pcSeNE5qA8K04ILwnRK+E2o8IaO8IRCnBZwWKkEoTgJEoKVqM0ILQjtUUmvJkGpQnBS TFjCFGFJMnBeFoSTFygXogIISlyg6xBdahutThBAxWnc9RKALJRWmU7hpccdMoUXBTCg8ILURUC5 SehlOZQGYKRUJTgpqiFyhlTKgUCUrFRKcpimkrgsVAqcJiE22QFGQokIhamKBK62JCgVMhRKBUjK gUUhDIQLJGSMqMqZCgQmlfxBaVIFQSlMIQQCllMXIZcmLkwhbwsy5QJUSUxKFJ4VyVFOlCBTswIS hThKE0lNsQE8KUJoUZRbEhRLUSExQVaItUSEQhRISXMIShSTJpVbGExUimKam2BUSplQKC4I3IZR XIbkVwYFRUymhNXsUykmQSsmTpIKYplJRQSsoIhQ1Bm6JD//1Qgp00p2lde14jRI0ojShtKnuTCt l8qnFQKcuUWpAMQC4CmxqdjEXYgZImwUUUtQ9qALBKLJrk7XKMpIUsME+/RIWKuXJw5DgYjBti1I 2qv6ibcm8DD7TbY6VLegsdomL03hsruBK6xR9RAL1DenCCeBt+olvVQPUw9LgVwNjcn3IIcpBNpY QlCeFEFTATStWhPCkAnhC0WhcEF7VZc1Dc1OjJlgWm9qG5qtPYhuYpoyZwWvtUg1F2JwxO4kmTFr VMJw1JMJtiOq6aU0qJckAuEFy5Qc9QL0N1ieIr+BI56C6xQfYhOepYwTwMn2ITnpOUFIAyRASNej scqgMIjbEJBUogt0OTOKA21TFiiIYDjU9BciuchFALgFinBTKO5Cl/CzJUHFRJUSU2QRwspSUAVI KMqIpkAnhOEgEwlbbHaoFqKQouCbxJ4kRCiQiFqgQlxLgUZCg4IpCiQja8FEQoEIpUHJtrgURCgU QqBTSvBYEqKkQmhArrWSTwnATSUkqASATgJ4TSVpKoShPCSYVrGEipQolNXUsVEqRUCUKTSxUSnK iSlSVkkgUxTaQsUydMU2ksHKBU3IZRpcGLlAqRUChS8KTJ0kCuC0KKmolNSxTFSKiUErFMnKZBKx QyiIZUGbokP/1ggp2lQBUgV2BDEYaJAUi5QLkxKbTHIMpU2CShNKNUNUpaBbTcqbopkBMw6JEqsd 1k1FqG9sIsoFjkY215MYUCVOUxCkCJI5SlIhRTlkmYcpBQBThyFMabdomLlDckXJtLVOcoSncoSn AJSAqYQgitCBQSkARAFAFSBUZYyUoKmEEOThyYQtThyYuQS9RdYgIKjC0+5KJVcWIzXSiY0y8FLF qi5isASlsQ4kGVNXYm2qwWIb2pwla3iQuQy9Ss0VWx6lhG2TGLZmxQdYgOeo7iphBtCFMy9QLkya E4BRWJUYU4TQnIYJEKagUQUgFg5R3JyoJUyCKRrkVr1XaitTZBEopQ5RcUwTOKjpZSziokpOKgSl S4RXcVGVElRJTCF3CkBU2lABUwVGQslFO0oiC0ogURDFILwmIUlEqNawIUHBTcouTmQIyhuU3FCc UF4DFxUCUi5DLkaXgLkqBSJTEoELqUU0JJ0wpVCcBIKQCYUWoBKFIBMQmotZJIhJBcsmKcqJKbSW JUSVIlQKSWJUCVIqBSSqUpUUgUCFUyUSlKRTKUwcoFEKgUlwRlRKmVAoLgsknSQXLJipKJTUhiol STFBLFMpJiklbshnlEKGVBm6Jf/XrJg5O8wEPcuxDGSkLkpQy5O0o0xpWKzWq9aO0wo5pLYa5I2I Behm1RiFsM2zv0UHOQt6bciIsUglUgEIORQUCGCZWIQyiuOiC4oxWWrcluUCU25Ppam3JtyFuS3I cK3hZlyjKiXKO5OAXcKdrkZrlVBRGuTZRWGLZDlIOQWFEaoiFhSBSTBqltTChg5Dc5EeEJ4Tos+M KY5WKnKsEatyUgzzGjdYiAKux6KHqvINDJdsnNVewIznoFjkYArYNO4qo8K3aq7mq3A0G5jNNfal tRiFAqUFlBJRwlCkSooporJk8J4RUjhRIRtqbaiCvBDXLU21H2JvTR4wy8QRNapAKYYn2phLHI2w hRcpqBTVoDByGSpuQygWUBZMnTAJpUVKYUAFJRFZJI0orSggqYcoywyCaVEptyYuUdLKWKG4qTnI TnI0yRCznILnJ3OQ3FFkAYkqBKcqKBXgLSmlIpkF9LynUU6aUUzCmEMFSBTCFpSBIqIKRKbSKUVF OSokoUvCiokpEqMpqFFRKdMU1NsCoORCFEhK0goimUyFGElyydMkmpUokKSYpqQjIUSFMqJSXBim TpIJWKYp0kEsColTIUSgkMUydIoFLE8IaIeEM8qDN0S//9CneYCGDop5JQJXYg6NUSsMwUViC1Gr STeqevhT3KDTomcU2tVEqc9QL0NztUpTxFYdkm5Sa5DlSagQwTTtKMHKswooKjkGvk3SE6ITyiSo EJoWoiEMopaoFqkBUGO5JMpBqcljCkGora0VtSaZgLTJAK0drCitqRW1KKWRjMkVdSsV1IldaO2t QTyLDJEK0ixWdii9ij41oab2qu8K5Y1VrApoFtYkEp2vUHFNuU1No7NptiM2xUWvRA9Ryg1MkG0b EOyxBNiG+xKMFggye5Bc9QfYhPsU8YM+PHbMvUC9CL0hqpBGm2IABnKcBM1qIGoE0xzkAxAUg1SD U8KMyYTJiGpbVKU0ptqsrFqRYnBSJQ4igzLAtUSEQlDLkhJcJI3IZU3IZTgWaJYOQypkKBRtfYWS TJpTSglknUNybcoisKQFOHIO5OHplLSE+9MXoO9PuTaW8LNzlBxTblElKl4DBxUCVIqEIMgYpip7 U21C02jhNCJCaELTbEBJPCSaq1SnlRSlIoLPckXIZKYlAhVMy5MXKEppTaXgMiUxKjKUpklEMpTF NKdMK2limITpJqmBCgQikKJCVrgURTKbghwkuC8qMpFMUFwUVEp0yFJWTJ0yClJinTIJDEqJUyoF BeFkydMgUlY8IZ5RShFQZuin/9HOyDJQ09p1UQuuB0acdkrQi1lDbwpsKdEr4hMDooucog6JEo0g sDynATqQCNsUytClKjCU6pLBqUrSigoLSiSoy18m6RIBQDlIFNpbwqIUS1TlKErW2i2IldamGorG ISmtMlq6kYVqbWhTUMpFj1LEMCIGhQ3Jw9NNruBM1FaVWD1MWKMxLGYNmVFyGLEi9NESkMLFUtVm xyqWOU2MM+JA5DRHFRAVgNq9FAKUpAJ0GCSNzkFz0Z7UFzU+NKihe5BcUV4KFtU0abGMgKGqKxqZ jEdjE2c6W5c1LtYphqkBCYuUHGS1DMkseFBzknvQnPRAZIhk5ybchueogpUvpMHJy5BBTlybS0sy 9CL0zihOJQUGbnqO5DJUdyQZQkJUCm3JiUbXWsSoEpyhlJNr7lHcmKim0vZb0+5DlIFNIQQl3JwV AJ0wrSzlMknhNVbGE0IkJQm2oyYbUxCmQmIQRaOExCmUNxQpcCWJUSnJUZRpeAukU0pFNVTEppUi opWpaVGU5TIErwVSlKZKU2SbZSlKaUpUZC0hkE6iCnTChdMQpSkmqROahlqsEIZalaQUJCG5GcEN wRC8FgkkkivWTJymTSpSZOmTUrFQKkUxQXBikkUkiuWKEUU8IR5VfP0U/wD/0smw6pgdVAnVODqu qtqgJwdE7Tqhh2idpTgWXYNgFMCogqTeE+2KRZBTlQGii5yNsGpLKUwOqjuUpRtVUlBT7kPcluQY THVKHKQcggqcoEIITbk4KDuUg5N4WMhsNKK1yrB6kLEwxWcDa3pjYq3qJvUTeBeINj1E4eqwepBy PAuIbAepB6AHKQcmmLFINgWKW9ABUpTDFjpdz0B7lNxQXFPiGfGxKYFOQmhSM3FozBUoUApgppYZ FYtlCfWrIapbEuKmI5Kc91SH6S0TWEM1hH3VDO1W1wpgQpEQhudCbdqsyZOfCE6xQfYgvsUkYM8M TJ1iGXqBcoypRFnEKZynCGERoUcislokaE+1OxqK1ihJa05U1y1DNZVz01B1abxIGRpFiiWK4a0N zEgWWORqEKKsOrQnMRBZBK0ajCltShIL7YFqgQiwolqISCihJT2pAJpXkrAIgCQCkAmErDJQCkAn AUlGSxksYTFTKgUKULLEqBKclQJRpkEViVBxTkobijTJGKxKhKcqKVMgDKUpUUpTSEEMpTJpTymU tpYhRIUlEoFKyZOkmkptSSSdNKLUCpAqCUphVTOUpUZS3IUikk6KLgkCmJTSFMHIZCI5QKS4IiE0 KZUSnLwWBTJymQK4LJk6ZNpKxTFOUxQXBiknTILlFBPKMeEE8qvn/RSX/9PCBTgoYKmCulBYOqUF TaUMKTSpAUEpmlEB0QQVIO0TgVkmTnIbnKJcmJTgVRjQtm1ym0oTVIFG1mRJuTyoSnaU5hKZhUpQ 2FOSktLPclvUC5RLkdFiX1FL1FX3JbkKCE+9OHoIKmClQVacOUw5ADlIOTTFBKcORGlVg9Ea9MlF aW0CnlCa9S3qMhYVEKJCluSASCuKke1LajbU2xHiQcyENUgFPYm2pWtOS2TSpbkKYTb0CGM6pS4I L3KJsQn2ICKoQVY5V7HKT3oLnKSMW3iCOxyCXKb0OFPEN2ACyQCkGKYYkZL5UxaEVgTBqk0KGZau QpGFFaUEFPuVc6tWUbTEhMSEA2KPqJCKRjTOIUHAKHqJb5RpeMZWc1Cc1GmVEhJcNGsWKEI7ghlq IXgo1GFNNCNrrYQpAKUJ00lJkttSTpiVEsOrJNKjKaUKVTIlRSSRpcNFiEJyKQhuRDJFG5QKm5QI SZYhgU0KUJQkVxLFMpwmhMJW2wSUiFGE0oVKSSZNISsnSTphQskVKExTULFRlSKgUkhUpSmlNKVJ ZynlQBSlNIVSiVFOSokoJAWJQypEqBSXBSZOmSSsknTQmlcxKiVMqJTV4WSSSSXLFCRChqtzH6Ki /wD/1OfCmEEFTBXQgtclKnaVCU4KkBUl3Ji5QLlHcngrQLSblJqC0ozEQqRoUuVJpTJBSRLFejJT aotUmpGVBjkWYKRKaVElN42IlclMSoynTuJbalIJgphqdaLXAUgmCkEbRa8pSlCiSkplvUhYgFyQ ejS6m42xTFipteihyjlFjIbIeiNcqrXIrXqEhilFsgqQKAHqYem0wyiUiG5PvUHPQBWgFi4oL3qT 3qvY9SAs0YqdYhG1DfYgusUgizxxpzYoF6D6iYPThFmEaScpNCZqIwI8VMnHTJtakGKTU8qIyWSy oy1RRCFAhRksZla0piU8qBTEMSVHckVAlPDJFkHKQchSkCiyUnDk5KECpSmUtkFFQKnCjCVrWEJo U9qZNJTbGEk6iU1VsSokpyolIBIVKSZKUl1MglKjuTbkEiLIlDcU5coEpUyRisVGFJKELX3TGE0K aZC0EsSkU6YpqGJCiQppk21WjISUkoQtNrAJ04STCtJWTFOVEoKWKgSpEqBSC4MSkEikEiuXSTpk 0qWUSpwokIKCMqKIQowla4MUlKEyFpYpJ0imkpYOUSpFRQZIrJFOokpL1ihlTKgVX5j9FD//1eam DCcOUHmHJg7Vb0Swyi2N2ieUAOU2u0UoKw7My5RBUXFIFEFQ2TMKI1yC0qYKeCskbTg6JKLTopBO ElhLNqmot4ScU2U2vIrkpiVElKU0FjtlKcKEqQKeCqkgUwoAogUiqXCdMnCNoK6G4KZQ3lIFQLAl MCmcUwKfa9K0ogKE0qYKYStKUOU2vQNycPTCtMGyHp/UVcPS3phisONseohusQt6gXocKBiSOsQH vSLkIuT4hljjYvchFEIUNqliWaIYSnap7EgxEyZCF2lEaUMBOFGSwybDXp96AHJ96iIYiEsqO5D3 JbkCFM1B6W9QJTFwWchEqTnIRKfFliF5ThyGXJgVIGYRbDSpgoDSitKZIIkEqZIJiVEwlYlRlJzk PclSqZqJCaUtyaimJCiQpFRckviGBTSnKiUQyAK3JSmShBcKCkylCUJWusMYTpJpTSjdRUSUi5QL kEgLym3KJco7kqXcLOUpUJSlNKCGaSiCpAphWFdJIJJpQxKgSplQcgkMSVAqRUSkuCyQTJSgSlkn UAVIFNSumhONU6CmBCgQikKDkEhgoqRTIJCyYp1EoLgxKZOUxSZYsSolSKikuWUFNQVfmP0Vpf/W 5a4ayhgolplBlbUJaIItK1ym0oAcptKmBWGNhJKkCoSnanArCNEgRGoYU2o2wSTsRIQ2I+2WyhxM RWadExKaYUCUdyxEarynlQlOnHRaQklKVAlLcnQVEJg5TDkAOUg9TLuFsblIFAD1Nrk0rCkJQ3lE lQcmgrAhJTAqRTKTiX2yBT7lGUpStIZbkg5RlIIWvSByfchhSCaVui8piU4ShC0aIyFEopCGQkCv BCNSDVIBTaE7iXCTAMTFqKoOKbxWm7RkKMpOcoykgxZKMqMpJqwxXlPKimlBVM5US5RlMShSRFRK GSnJQ3FIM0YqJSBUCUwKezCKdpRmlVmlFaU0rJRT7kxcobkxcmMfBqs5yhKRKilSeBnuSDkOU4cm rTBnKiU0pJqQKYwmhTTwhabphtUtqnCSbxI4mG1MUQobilaoklgVBxUnFDcUWaItZxUC5JxUCUmQ RUXJSmlMkkrynlRTphKwsgVIFRCkFGWMsk6iE8pqKWcoFTKjCSmBCiQiQokIWuRlQlTeoFJcFAqQ UQnTSlmFKVCU8oIpclQKRKiUFwCxTJFMmpUVEp0xQXBiVEpyVEosgWTJ08JJtiUMopQiq/Mfoof/ 1+TsKEUS1BJWtCSFwURpQlJpgqYFScKbEEFEaU+1kgmaiNQ2qYStrzGqZhVhhkQqjUdjoSYiFPEF QKm8yhp8SwkKCkFFPKcStIXlRJSlRKdAqgGe5OHIcpSprXpw9EY5Vg5FY5ArZNkFMVFrlIlRksRG rEqBU3FQJRBSFSmlNKQKda8MgphRCkE0yQZKUgkFIBDiVxKATppS3JpKCsQokKW5KUrRbCE4TymJ QtQmouQHlTcUJxT4llhJG4qMqRCW1SWy8QYyknhMQmFCyUpkxQRSiUxKYlQLkgvjFkShlNuTEpwD PGKxSTJwlS5m1ECGEQKMscmYKYpwmKbay2BTKRUCklUppTFMhSiGcpwoAqQKaVhDMKSgCpgqMrF0 0ppTEoJEbUShuKclQckyRDBxUHFTchlOZosHKBUimhK15K0J4TgKQamEscpMdqfapBqfamWx8TGE 6eEk21KSSSQUpJJJBS0JEaJ0ighA8IZCMQoOCVrwjSSKZArgvKeVFJApZSmKZIppUFimSKZBcpRK kVApJDEpk5SSX2tCdJJJTEoRRShFV+Y/RS//0ORc4EIJKW9QJWjA0pkCpAoYKkCrEStStciNcgAq QcngoLaa7REBVZrkQPRYphtsMqYVet6O0yEL1YJMkySZOEmCQUVGU5QyU8SQIpJSJUJTgp4TSpSl MU0qW00zBRWFBBRGoGS0hsNKluQgU+5Ntayc5QLknFDJRBUAylSBQpRGlIlKQKYQ2lTBTCVhZhOm CUpWilFygXJyVElJK+5PuUExKRUQzlMXIZclKCKZEqJCcKQCI0UDSPan2ogCUI8S8SQlqgWoxUCh a8FCQoEIxCg4JWyAoHBDcjOCG5qMSyRKKU0qZCgpAWUFkE7VEKYTSVEsmorQoNRAopFikWSYp0xT GO0blAhTcoFOtlixKZSUSErTSycOUSEkEGKUOUtyDKfcmkLOFJuUdyjuSlNXAUvKiUpUSUqXBRQy plRKSQWBCaFOEoTSU8SwCkAkApAJhLHIrQnTpk1YsmTpkkrJinTILlJSkmQUvKYlNKUoKpRQ3KZK iUEhE5QKK4IbgkvCyQKZIIFLJMUpUSUEqSSToJYlMU6ZBIYwmKkokpLgpMUkySVihlTKgq/Mfopf /9HhA9SlV2uRA5XwhJKkChSpAqaJWlICpByECpAqUFSVrkVrlXDkRrkbWT2bLHaqxW8Kk1yKxyBa 8m5uSJQGvUt6ILEQzJUSm3JEpwKKpYlKUyaVNEppJMplEOUgnWimbURqG0IgQkVpZgpSmSJTbWKJ USU5KiSncSQqU4chkpByNppsNciNcq7XIrXJpK0ppSJUAUiULWrkppUSUxcnBcAylMSob0xcjSaX JSCaVJoSKJM2qYCiAphMJYypMU8qDiha4MXFQJTuKgUGSKiVAp0ikyBGQoOCKVApwXXSJzUMtRyF EtThJImhhOFPanDUjJdxqCmCoBSBUZWk2ylKVElNKSgFFMlKSC8FZNCnCaELXWjIUSEUhRIStVsE lIhMlaFkklEoKIXlNKZJBSpTJBOgSq1QnhKE4CYStKgE6dMmrVKJTpkFKUU6ZC1LJlJRQSFkydMk uYkpSkVGUFMpTcppThBLFwQ3BFJQ3JLgwKinKiSgkBeUyZOEly6SSSaVKTJFMUErEoZKm5QRXBSZ JJBcsVAqZUCq/Mfoqf/S87BUgUIFSBV4FamBUgUIFSBT4lBTJ5UAVJSxkhmCpAoYKkCn2tKYOU2u QA5TDkgxSi2Q9TD1WDlMORWGKcOT7kEOThyIWEJZTKIcpAp4KAFKTCownCfxKpO1TCG0qW5C2Mhm mJUS9MXIIpnKiSokpi5OCAs4pApi5IFOX0zaUVrkEFTDk0rSE4KRKEHKW5JZTIlQLkxcolyfEr4s i5MCmlSaE4lJXaiNUWhTCjkWOTMJ5UZTbk21oDIuUCUxcolybbJGK5TQmBTyku2YkKJUiVBzkgkF iSoymcVGU8LmUpKIKkCgStKtqW1SBSTeJFlhCiUQqBSBXRLFJJOAiygrwn2qQanhNJQSwhMpEqDi guibUSoFMXJpSX0uU0JSkhaLYplJKELUWEJQpQnhAyRbCE+1ShPCaSttjCdPCZNtCkkkkLUxTKRU SlaVkyRTIKUolSJUCUrUFSkmlOkuWKgVMqBQUxlOHJikgUhclDcVIqBSC8MSoqSaElwYwpAJ4SQJ UskkUyapRKiSkUxKC6lioqRTFFcxSTlMglYqHdTUO6r8x+iov//T81BUwUIFTBVsFCUFSBQgVMFP BWlKCpgoIKmCpAVpSAqQKgE4TxJBSAqQKGCpApwktSAqYcgynBTlpCcFSBQQ5S3IhYYpg5SBQQ5S BTrQYpwU6EHKW5OBYyEodCluQdyW5FFJNyW5DlMSiqku5MSoSm3IopnuSlRlIFOtSQFOCoJIIShy feg7ktyQVSUuS3IRckCnJpM0orSq7SihyZIrJWlBT7kEvUTYgtEbbG9NuVf1E/qIELxBK5yG5yiX qDnILwEm9P6irlyW9FRCcvQ3PQy8ppJSCRFkXJpSAJUw1JTFSCfaokwgo6sg5LchFyfcm0tMUkpl GU4SQNFQptCYBS4Stey4UXFIuQ3OSSBanOQ3OSc5RJRZAKVykkpAJspUqUqWhPCkGqW1R8THxo4T 7VOEtqHEjjYQmhEhKE21cTCEoU4UShaLYlMnKjKSV0kwToWq1ioFTKi5K0hESlKZygT2RX0y3JKI KeUFVSk0piU0opDKUxTSnlAqYlRKkVEoErgsVEqSYoWkMSEoTpJWuCyYp1EpqVFRKdRKSQoqJTlM kuUknTFBTFMpJkFzEqBRChlQcx+ip//U8yUgUySshTMFTBQgVMFOBWlI0ogKCCiNKeCtKUFOFAFS BTwVrMJwohOnArWaUqMp08FTIFTBQwnBTwVpCQFSDkMFPKIQlDlLchSlKcFpCbcnlBBUwUVhFJJS lRlKUbW0yJSlRlOnWpkFIKIUwgZUtKkpSTEpAqGqiUxKiSmLk4FcAylIFQlSBRtJSNKmHITSpSmk rCyLlBz0nFDcUQkBl6iQsQ5SBRJC+kwelKg1SCYStKk0p0gEbSFgFNrUg1Ea1AlRU1qltUoTOKZb GdWDjCE4qb3ID3Igr4hRckChlycORXEJ2qYQWuRA5MK0xSSmLlHcouckEiK7noZcmc5RJTmUBclN KjKcFApLMKbUIFSDlGWKQTBTQQ5T3KMsZBZ6JlHcm3IaooskyjuTbkqKeEs5USVEvUC5KlwiuSoS olyUo0mmYKmENpRAmlVKKi4KSHY6AmpARPMIR1Kk50lRTl4C4SlNKaUk0uopSkipeUiU0piUCpcl MSmlNKaV1LpiUpUSmpCkpSTJJVKYp0ySVimTpJKYlRUimQXBSZOmKCVimKdMUkrFDPKIUMqvzHRL /9XzNMnSVlCgpAqKcJAqLMFTaUMFSBTwVhTgqQKC1ymCnAopJKkhgqQKcCimSkCoJ08FDMFOCoAp SngoSAp5UJTynBBDMFOoAqQKcDS0swpAqAKmEbWlkCnUJT7krWUylOCoSnDkbUQkBUgUKYSD4StZ w2m3IbnJpkaKBKUUiFLucm3KJKhKevASgqQKE1ymCkSgpWlTBQgVIFNtjK5UHBEUS1EFIYQpBqfa nASMl1rgJ4SBSlNtBVCcNTAqQKVqOjJrVMCEwITlyFrCSuTCG56Zz0F70guEbXe9Bc5Jz0MlPAZR FeU4UQpBIpKRpUwUMKaYUFlKi4pJilaRTElMpQlCXEusMUykQolC0E2oFOHKBKUoISh6feg7ktyb S3htNvTb0Hcm3JUkRTb0tyFKeUqTwsy5QLlElRJSpQDLckCoSpN5QITSVviiShgiEznqM6lbTN1g CrveXFM50qKVJAVKSSYpJWlKUoSRTSk0pJJKpUppTpkCpaUkimTSuC8pkkk0pWSSSQUpMnTJJUmT pikpiVFOUyS5SZOmKCVikkmSSshlEQ1Xz9Ev/9bzRMnSVhCySSSSFwVIFQUgUQUJAVIFDBUgU8FV JAVMFCBUgU4FaQlBUkMFSBTwVpZJJk6cCheU8qCkE8FTMFPKgJTo2ghICpbkOU8oreFJKUwhypSl aOFmDKdDBUgU60cLKZSJhRlPKNp4VbiE5MqKRStFKKiU5KYp1qCwKmCogKYCBKCzBRAVABTATSWM sgkkmJStAUUpUSVEuRXAJNybch7kpQVSQOUw5BBUgUiVEJg9MXoe5MSgFvCu5yE4pyVApwK8MSmT lMnWvC4UgoBSCaSkpApyhgqUppK0skybcluQtAtkmJUdyYuQXUVEqBKcuUCUQkBRKaUkkrVSpTSm KaUk0vKdRlOEbTTKU6jKUoWilFMUpTSEFLjlSBhQlPKBUzLlAkpSkmlVLFKE8J4TSUMYS2qcQouK CQGJUSnJUCUUgLpkycJWkhdMnS7IEoYlRUiooLgpOmTppSpRTpkFKTJ0ySVJinUSkpZMU5TFJKyZ OUxQSskkkglYqCkVBQZ+iQ//1/NEkklYWqSSTJKUnTJJKZAqYQ1IFEFRSApwVEJ5TwVpZgqQKhKc FOBWkJQU8oYKcFOBRSQKcIQKK0p1qXhKE6WiIkhiFJNCSeChdKYTJ061LynBUeE6NqZSlKinlK0M pSTApSlaFJJJkbQuERoQwiNMIWghKApBQBBUpTSVvCuoykSokogqEViUxKRKiSnWuEVJwU0pwECV UuCnlIBOAgtNKlIpJFJaxJUSnKiSiLXAErFMmLk0parwCyTqMpwgSkhmCn3IcpSgtpnuS3Ie5KUV wDPcm3KMpJJAC6UJJ5QTS0JipKJSUwKiSVMqBlJIpUwn3KMFLhJTLcluUeUoQtFLymlJNKCqZSlu UJSCKqSAp5UAVIJhRTNJR3JByaUUyJUSlKiSkkBi4qBKclRSXBkOVIKIUkFFSYp0ySAFiolSKiUF ykkkkCpSYp0yClkkkkFLFRlOSoohICkydMkVykySZBSkxSTILlKCmoKDP0U//9DzRJMkp1ikkkkk qSTJ0UqTgpk6SGYKkhAqYKIQWcpwVCVIFPBRTMFOFEFSBTgUFmFNpQgpgogoKYOSlDBTyitLNJMC lKdaGUJJgU8p1qXSSlNKNoXSlMknWpeU6inStS8pJkkrQzCkEMFTBStBZgqQcoSE0oWkJCQVEyo7 ktyNqpYplIwVEhG0qEqYKikCkSgpAVKQhhwS3BBYQWcqJKYvUC9IIESVyVAlMXKJciGWMaXKZJJJ dS6cFRTygUELyko7ktySKZJBRlOCkqmSQTAp0krpJJ0lWslBTwpBqBKCQEe0lLYihqfammSzjQFs KOwqztTFohC1caDYou0RXkBCOqIXx8WBUVIhRKK8BZPKbVPBCBKaX3BIvUCm7oK4UgKmChBSlArS znRRcUxKiSgoBRKQSTgJJUE6ZJBFLpkkkkrJlIpkCpZJJMUFUopkpTEoJpSRKaUxSTSySSSSVkik kkUrFRKkmQSGKSdMkpYqKkoqvn6Kf//R8zSSTKdapJJOklSSSSKlJJJJIUnBTJJKZgqQKgCnBRtC QFSBQwVIFOBRSQFOChynlOBRSQOUg5C3Jbk4KITbk+5BDlLcnLSEu5Lch7k8pyqSbk8oYKeUUUzl PKgCpApWgskpTSlKFoXlOop5StC8p5ITSmRBSy3pF6jKinJADPcpAoUp9xCNqpNKUoQcpbkEUyTa hNKcEHlG1UQxLiEi4qe0FRLErChTDeUxcU5aokQjYXClElJMkkvAXTgqIThJVMgko6pJaI0XTJJI JAtUpSmSlJBizBTgocp9yCKSynBQgVIOhBbSUKYhB9Q9k4cgQsMSnkJShbki4lNNLeBmXBDc9MSV EglK0iKnOlDcU7lGE4MsYsSSeE+2U5hNKRZdF4ATFOmKC2mBEpQpFNCSlk6SSCKUUySSClJJJJIV KUpJpQUvKUppSSTSpTJJIKUUyRTFBKyZOUyS6lSmTpkFLFJJMkldJJOkqlkydJBTEqJUimQSxUVN QUGfogv/0vM0kklOtUknSRSsknSSUskkkkpSSSSSlJwUySKqZgqQKHKcFEFFJAU8ocqQKIKqZSnl QlPKeChkCnlRlPKcCimYKkChynBRtFJAU4KgCnBRtFJAU8qEp5SWkM5TyoSlKSqZylKjKUooplKW 5RlLlK00ylNKaEkQU0ulKZJG00yBSBUUpStVJAVJCBThyVlaQkmEi5Q3FNulIWrh7syQoHVKUpTg u4QFoKaCpJwkuDGElJJJW7FJPCYhAoIWSSKZC1Cwuo6p0kbTaySSSCKZSlKipBJVBkFMKACIAgSs K4TpkkwrVFQJUiVBxSSAsSokpEqEpwZIhclIJJJLqXTEpSmSUumSlNKBWrpiU0p0lLJQnSQJQpJO mQUsSkkmQSApJJJJJUkkmQWqTJ0yS5ZMnTJKUVEpykUEhZMkkkuAUnlMkgml0ySSSFimKdMgpZQU 1BQZ+ii//9PzRJJJTrVJJJIpUmSSSUpJOmRUpJOkgpaElJNCSVk6SSSl5TyopSiCpkCpAqCcFOBR TOU4KhKeU60UzTqAKkCja1kCnBUZTp3EpnKUqIKeUbRTKUpUZTSiimcpwVBSCSqZhSCi0IgCVppZ MVOFEhK11BiU0pFMnAqpdJRSRVTKUpUZSlJVM5SlQlOChaGaSjKeUrQyBCeVCU8pWpklKjKUorqX TFJMUk0uopFNKCCF0ySZJC6Upk4CSlBTa0pNAUxokStJXATpk0ppWMpTEppTFwCClEqDnKLn9gok lFfGK5KaUySLJsySTJJIXTEp1EoJUSkkkkqlJ0ySBRS6SZOgtKkxSKZBSkkkklykpSUSggrymlMk khdMU6ZK1LJJJIKWSKdMkuAWTJ0kF6ySSZJSkpSSKClkkk6CFih90QoZ5UOfoov/1PMt6W9V0k/9 YhsbktyrpJfrFNjcluVdJL9YpsbktyrpJfrFNjelvVdJL9Yps70t6rJJfrFNjelvVdJL9YnVsbk2 5ASS/WK1bG5PuVZJH9ajVtbk+9VEkv1ym5vTixUkkv1yG96if1FQSS/XLdHQ9VL1FnpI/wBI6J0d D1EvUWekj/SUaOgLFIXLNSR/pKtHVGR5Jxk+SyUkP6Sl1/tXkmOT5LJSS/pKXV9fyTesstJH+kq1 dT1EvUWWkj/Sv5Uh1PUS9RZaSX9K/lSnU9RL1FlpIf0r+VKdX1UvVWUkl/SkOr6qXq+Sykkv6UkO r6qXrLKSR/pStXW9ZN6yykkv6Up1fVS9VZSSH9KU6vqpvVWWkl/SkOp6qf1llJJf0pWjrfaPJS+0 +Sx0kP6Sj0uv9p8kvtHkshJL+ko9LrHIKibpWWkl/SVel0/US9RZiSP9JXun6iXqLMSS/pKnT9VL 1lmJJf0n+VKdP1U3qrNSS/pKdXS9XyS9VZqSX9JVq6Xqpeqs1JD+kqdH1UvWWckl/SEOj6yXrLOS Q/pCNHR9XyS9byWckl+vS6Bu8kxsVBJL9ejRv+ol6qoJJfr1aN/1U3qqikl+vVo3vUS9XyVFJL9c rRu+p5JeoqSSX65cG76ibeqaSH65OrbL0t6qJJfrlatrelvVVJL9arVtb0t6qpJfrVNneooCSZPj 04lP/9l= ------=_NextPart_01C8E823.DA10E9A0 Content-Location: file:///C:/8E69C634/Classof2004_files/master05.htm Content-Transfer-Encoding: quoted-printable Content-Type: text/html; charset="windows-1252"
Click to edit Master title style
Click to edit Master subtitle styl= e
‹footer›
‹#›
------=_NextPart_01C8E823.DA10E9A0 Content-Location: file:///C:/8E69C634/Classof2004_files/master05.xml Content-Transfer-Encoding: quoted-printable Content-Type: text/xml; charset="utf-8" ------=_NextPart_01C8E823.DA10E9A0 Content-Location: file:///C:/8E69C634/Classof2004_files/master02.htm Content-Transfer-Encoding: quoted-printable Content-Type: text/html; charset="windows-1252"
‹header›
‹date/time›
‹footer›
‹#›
------=_NextPart_01C8E823.DA10E9A0 Content-Location: file:///C:/8E69C634/Classof2004_files/pres.xml Content-Transfer-Encoding: quoted-printable Content-Type: text/xml; charset="utf-8" ------=_NextPart_01C8E823.DA10E9A0 Content-Location: file:///C:/8E69C634/Classof2004_files/slide0001.htm Content-Transfer-Encoding: quoted-printable Content-Type: text/html; charset="windows-1252" CHSAA Hall of Fame
CHSAA Hall of Fame
A Celebration of Those Who Represent the Highest Standards in High School Activities
------=_NextPart_01C8E823.DA10E9A0 Content-Location: file:///C:/8E69C634/Classof2004_files/master05_background.jpg Content-Transfer-Encoding: base64 Content-Type: image/jpeg /9j/4AAQSkZJRgABAQEANQA1AAD/2wBDAAgGBgcGBQgHBwcJCQgKDBQNDAsLDBkSEw8UHRofHh0a HBwgJC4nICIsIxwcKDcpLDAxNDQ0Hyc5PTgyPC4zNDL/2wBDAQkJCQwLDBgNDRgyIRwhMjIyMjIy MjIyMjIyMjIyMjIyMjIyMjIyMjIyMjIyMjIyMjIyMjIyMjIyMjIyMjIyMjL/wAARCAGQAhYDASIA AhEBAxEB/8QAHwAAAQUBAQEBAQEAAAAAAAAAAAECAwQFBgcICQoL/8QAtRAAAgEDAwIEAwUFBAQA AAF9AQIDAAQRBRIhMUEGE1FhByJxFDKBkaEII0KxwRVS0fAkM2JyggkKFhcYGRolJicoKSo0NTY3 ODk6Q0RFRkdISUpTVFVWV1hZWmNkZWZnaGlqc3R1dnd4eXqDhIWGh4iJipKTlJWWl5iZmqKjpKWm p6ipqrKztLW2t7i5usLDxMXGx8jJytLT1NXW19jZ2uHi4+Tl5ufo6erx8vP09fb3+Pn6/8QAHwEA AwEBAQEBAQEBAQAAAAAAAAECAwQFBgcICQoL/8QAtREAAgECBAQDBAcFBAQAAQJ3AAECAxEEBSEx BhJBUQdhcRMiMoEIFEKRobHBCSMzUvAVYnLRChYkNOEl8RcYGRomJygpKjU2Nzg5OkNERUZHSElK U1RVVldYWVpjZGVmZ2hpanN0dXZ3eHl6goOEhYaHiImKkpOUlZaXmJmaoqOkpaanqKmqsrO0tba3 uLm6wsPExcbHyMnK0tPU1dbX2Nna4uPk5ebn6Onq8vP09fb3+Pn6/9oADAMBAAIRAxEAPwD1aS+4 zmsu7vA4PNZzXZ285qq0xfODxX0NPDJBLcneTdULHJprMcU1TziupRsZOSHhM1YhQbqhQ8VJ5uPS lK7BVF0LokCDg1HNcYXrVRpcDrVGe4LHrUwo3ZrCrZ6D7qfJqhId1DOWOTSYJrtjHlRuqinqxCtC rzmnEECm1Zo6sIkyAKM1Yjk7CqROOKnhYA8nis5I5pYjm2NS3QvgCte3tOmASaybWdVxW9a3cYUc 152IclsctV3VmBsdo5qlKoRs+laFxeqw4PWsi4lznJrKlzS3OKdCBZivGQYBq9FeZHWufElTxzY7 1pOimcc48mtzoROp9KilnUDtWSLrjrUctyNvJrJYfUhVNSS5uFPas55AxPaoZ7rJ4qASbj1ruhSs jSNVrRF9Llk+70pzX8uOtVAcVFLJin7OLZ3QrT6Es127dTWXcS5zzRLISapSNXXTpJHXBOW42R81 XYmlduajLjHNdkUauKQjE1Xd8VI8melQNz1rVIOexE0h9KjYk9alMRNKIfepkkjGWIKrJmomjq8Y wKicAVzSTMHJyKLKRUbA1ZZc1EUrCUbE6IrHk0uypxGDT/K4zWMkjRIplOKgcVck4NVJDWLiawRX cVA1WGqJ8YrJxNrFcjJqNlqZiB1pnU81nKI4kDCoWq0ymoHWsnEq3YgYZqJlqwRQU4rFoh3KZXmm EVZZMVEy1k1cVyKlBpSuKZ3rNoZJSHpSBqXrUjQ2lBpKKY2FFFJQhC0UUU2FgpwNNozSEPzRTQaX oKRRC33jRQeTRXE3qQfSfm5pd5qHOKXea+05TKpUJy4PrSb8VGnNK3yjJPFTY45VXcnElLn1qsrn NWUUvSasZupYiclqiMRzyK0I7csala0OOlT7VII1XuZBiI60LHzmrzxHuKgf5a0U7nTGvdERjpjK F61Jk1DI2TzVK7NHJPcjc7TTPN9KcwJNSx22DuYVpdJajeIjTVhIZn4zWlDdEYANVUt8HAqwEVO1 YVOVnnzxDky0bv5cZqrJKTyaiLjOKheSpjTRop3ROZsU3z2qoZDmmmbHFa+zMZLmZaa6YVBJcuT1 qs0pamF+ea0VNC9iTmUkdTSrKRUIPrUoPFU0hqkkTrcY70yS4GOtV5OBxVaR/WlGmmdENCV3BOc1 Xk5pjSYNQtcYFdEYM9CnsOZaiZDSrIWPNScYrXVBOaKpjNIIzVzANO8sGnznNJ32KJGKiZqszKKp P1oauTGk76is1MwWNAUk1NHHkVnJWNpRUERGIdarSJjkVfdcVSl4Brlmzicm2Vd4XjFSeam3moXI zUDnNZWuaxkOlIPeqjcmpGJJppWpcTam9SBhiq7E1acVVk61lJHW3oQtzTcU+kxWMkZ31Ghu1MdQ KlK0xqzaKUiswoXrint1plYyiNu454wwqu8XtVlW7UOAa55IzbM90IqIrirzqDUDJWb1BMr4op5W mVmVcKTFLSgUFXEooooFcKKKKB3CiiigQDrSmkopDRGetFB60VxNakn0ikWRyKCmDxVuQrEvvVJp xk19nFuR58oykSjCqc9qrO5kOO1OZ2kGFGBT44sdapK2rIlDk3JYIjgVoxKBgGqyFUoNxg1hK8mZ ct2acQC81HPMqDjrVH7eQOMVWkud5OazjRbeoOFieafceKpu5LUm8saeErpUVEFO2xEF9aPL5qUg A0xnxVXG6jaFVVFShqrb6eHzScTnqXZZD013zUW+mk8UlEysDGomNOY1GxrRItSGMRUec0p605Y2 PatDRTsREU0irfkHGTUTxYpqSKVdPQgzineYQKQx804JxVaFuoRvLzVWSTJ4NW2hyetC2id6pSii oS0vcynJNRkVqy2iYwDVVrYA1tGpFnQsRfS5U3lelJ5r9s1aMA9KcIUHOKvnRPtF0II5JCeRVpZR jB61G/A4qAHmpaTNacusiaUBqqvEtTAmmNT2KnXS2ZEFFSbgB0ph4NBPHNZTuzlnVb3GyNVOTnNW XNVnOawlEyjLUqyR5qs0fpV1qgK0KNjZTRX20jDAqbbUUorKR1UmmVJRkkVWZGq6E3NiphAD1rCT NZTsZSoaUpWhJbhearutYtE81yqRxUTACp2FRMuaholzK5phqVlIpu3NZyRSncZikJqQrxUbCsJI fMRtTDT2pKxkgISvNRstWCKYy1i0CZXxiipCtNNS9CrjTSYpaQmkMSilxRigaY2lFFFMYoFBpe1N pDIz1ooPWiuN7k2Poma4aRsChISTk0sEOeTVncij3r7VytoiHZIcsQQZpC+2mGYYwKgeXipUW9zh k+Z3JJZyelRecc1ESTT0jLH+dacqSIckSDLDcaeF46UKu+TavQdasSYRcY6VDfQ0dJ8nMyBRtpxf AqJm5phY07XOZrUkaSoGekYnNNwTVqKQcooY5qZKYkRq3DAWpSkkKVkMVSaGGKvi2IGajeE+lYqo rnK5plBhTNpJq6bcmnLb461XtEifaJFSO3LHpVxLcKOalUKgqOW4wKhylJ6HNOq5aIbLtXiqMjLS TzGqTyE1vTps3owbJiRRuxVcOaeuTW1jomrEhYUzdk8VIseakWMDqKm6RzudiDBbtQYR3qVmC9KZ uzRdh7VrYheIdqrOhFXwuRTvJLdFzVqdjenmLgtUZZU56UGM+lav2Vj1Wpo7Qd1NDrJE1sy51sYR hcjhTUbQuOorongVRwoqjMgHamqvMYRxLexkmM+lMZcdauSkLWfNJjNaJXOmM3IY2AahcimvKSar s5qnTNlFj2IzULcUEmo2bjmsZI0jEazc1EzZpXbmoTWEkdENAB+eraOCtUwDmpVJrCUdAc7kkhqr IuTUzEk1GwrFqwc5WdAagaOrjCoiBmsmK9yv5dNMWBVsLmmyRkVk2NSsUWGKhfrVmVcVXcVDVzRM rsvOaTFSMKbjFZyRdxp5ph61IRxUbVi0NDDzUZFSUxqyaKRHSHrTqaetTYpCDrS5pKKCkOpDQDS4 oKQ2iiikMjPWig9aK43uI+j2mVeAKqtNlqSUN2qNUYmvuIxSOdxctSQvkUBN1KIjU6R4PNDaWxxz dthiRetS52KQOtOOAOKYcE81F7hTjzMlgIjQs33jTHbcaaeetJmklrc6K1Sy5RCOKaRS7qM5NUcE p6gEzUywn0p0CZOK0Y7fI6VnOpYh1EipHb5rRgthxUkcGOTU+4LXJOo3scNfEdENMQFQPEKleX3q BpfepimcntWNKAVBIQOlPaSoXBNbRXcItvcgdzmoGBbnNTsvPNMYAVujaJSlTiqrR81fkFQ7Mmt4 ysjqhVsiFISatR29SxR1bVMCs51DGriLlPyttRyHirkgqlIM0RdznUrkTdacqg0zaTThla1Kt0uW I4lHWrUZRazGnwOtRtdHHWodNyJ9hc22uYkXqM1Rnvh/CRWTJdN61Uack9auGG7m1PCrqact6T3q nLck1U3lu9OArdRjE3jRUSOaUkVQkJJNaEijFVGStVJHRFIreUWOcUG3OKtKvNP28VjUqNGnPYz3 ixVaRcVqSJVV4wRWDqNlRqXM4g5o8sVaZKYVqWzbnK5QClVealKk1AxMbZNYyIbuTBB3qN0x0oWY EUF8msGmRqQMtMCZqzt3UbMVnJ2LUiER4oZSV96nxxTGFcjlqTfUoyR5qq8eK0XXvVaQCi5tGTKD LioSKtOOagYUHRFkRqJqmIphArNmiICKaQcVMVpCvFZNDuQGmmpGWmEVFikM70uKXHNFSNDR1p1N pR0oKEpDS0hoGM70Ud6K4HuB9HFMnpQsXOaskAUYBr7TnY6kOVaEXlheacMAZp5ximOeKV7nnSp6 jG5FM2ZpwOTUmMVV7Dfuq5CeKgdsVYkwelVZOKuJ50qjbGhqlQ81CAc1Mgq2Z3L9t1Fa8O0LzWLA 22rf2naOK4qsXJ6HPUbasaLygdKrtLmqn2jcetSoc1Hs+U4ZpjySajapaYaETFCKlJJhRUmcCq8z 1S1ZaIJHqEtmkYnNN710RVkdEVoBGaVUGaBTgcVVxslTipC4xVXzKY0uKnkuZOFyeRh61WYio2nq tJcYFaRpsqFGTLLOF71A8ox1qlJdc1XNxmuiNFnRHDSLjyZqFm7VEjk1Lt3Vpaxbg4kLHNR7c1Z8 ulEXNVzWKUrECr0pScCpimBUDg4qdyua4x2qE0p60wnioehSYDrT85FRbqN3FYz1E3qJJVZ6mds1 CRkVmkawIjzQEzT9tHQUpDuNMY61XmQFcYqwTioXOahIuLM50MbU9TnBqWRc1Gq44rOTNLposRjN PZBimx8CpCeK5KiMXoyE1G5FPc4Oaru9c/LcpakcrYqlI/PFSTOc1UYnmqtY6YRsNZuaibrUmCTR tqWbaEJHNMqZhg1G1ZspMjNIRxSnrSGoaKI2WoyMVMajYVDQ0yI0lSEU01mWNPpTad3pD1oGhKKK Q0FDDyaKO9FcD3A+kPNwKPNql5tOV8ivueQupVUkWjJTS5JqDdTgTilynM0tyZDipM1U82nCXik4 nBiJE7/NUDxkninGYZxSo4amk0efYYI6dgCpiABULHNJO5O47fgcUm8k1FmnLVWIkWYyauI2Kooc VMJMVjONznlG5bMnHWojNiqrzcdagM2T1pRpgqZoGbjrUbPmqXm+9PElV7OwKBIwpuKTfmndao0t YTpUbNUjVDJTWohjvVZ5DT3Jqu5zW8UXBajXkNQNufpVhYS9W4rXjpWnOom/tY0zH8hiKiaFlro/ sgxVeW1HpRHECWOWyMhARUwNSSQ7TULcGtL8wOop6lhCDUypkVTjkq3G9ZyTRlK6EdKqypV0sKqz sO1TzGak2yk681C61Oxy1MIps6NUiDB600jipmBqNuKyZSZEaTbUm2jbWbZXNYjK1E3FWdtQyJWd 9Soyuyqx5qPrUrpioiMUNm6SGlc0gUZ5p9FYSJTFVKGGFoU4pHasZIdrleQ1SmPNXJDzVSTBrNou BUc5qPFTlaaVqWdCZFtpCOKkIxTSKzZS1IG61GwzVgrTCtQ2aJ2KxXJpNtTlaYRUMdyI9KjIzUx9 KjNQNMiIphGBUhpjVLRokRmm04imkYqLFISlFJRTZQw9aKD1orz3uB77mnKSRTVXIpw4r75nmRm7 6kmad2qINSlsipsa1KmyQMwIxTd2KQk005NVY45auwjOSeKu2kRfmoLe3Mj+1bdvbhF9qyq1ElZG FWSirFWbPQDiovKJWr8pQcAVUeQKOKxjJvY5XVjsVnUr1pobmklkZjTBnNdCWmpDd0WA+KDJUWaa TS5RJEjPmo91JRVJFhuxS76jJphbmnYpRLKvmpleqStUofBqZRCUS1mo36UwvSb6lRMmROKgxzU7 c1CetbRCLLERUCpftKqKzWkIPFQGRie9P2XNuW6XNubH2sGmmYMKy1YnvUyk0nSSM3h0iWTk1Ukj Jq0ATTzGCKpS5SFLkMzkU8T7R1qSeLB4qk8ZrdWkdKkpInN2c9aYZS45qEQk81MsZFLkii7RWxER SGpmWoWHFS0UncaTTDzQxOajLYrKUDRUySlAqLdQJK55IiUHYkOMVG+AKQyc1FJJWFnciMXcY+Kr NUjvUROaOh1xTsAGadimqakDcVjIT0GEYqF6nY81C/Ss7hFlaQ1XY81PJzxVduKGrm8Rp5NNIGKD xSE1k0bJCYphGBTyaYxzWbQxpNRO3NKxNRMeahxKSEY1GTTyM0wjmosWkRsTTCakYVGRQyhh60w0 89aYetRI0TGEU0jipD0ph6VkMZRS0lIoYetFHeiuB7jPflIAprPimB/lpm7ca/QVE82CViXdSB+c U3FC8UWM5O7J1HFPWMbuahVuasxsOtZyujGTsXrdAgzVsPkYzWcsxzjNTLJk1yyi2edXbZZKg1E8 WalQ5FSLg1ndo82UpJ6mf9k3HpUqWJ9K00jUHmp1CilKuylWdjEktcdqrG25rdmAPGKrtEM1cKzN 41dDG8gg801lxWnJGKpyJzxW0Z3NoT7lFqjINW2iOKb5VbKSN1NECg0rHAqyIuKhmTFNSuyk7lcy kUCaoJAQaZkitVBM0dNMuCTNLjNV4yd1XI1zUSVjmnGxXaHPSm+TzzWh5fFNaMZpKoKM2Uli5qZY 8VJtpelDlcJSBY6fwFpDIFqF5gRU2bOVptjJuaqlQanLEmmMMDNbR0NVohgAFISKjZyKYHzTZpys c3WoHwalJOahfg0NmsXYidaiK8VMxqM1DkdEZMiPWmZp7dajOaxaNN1qITUbGpGGOahc1DSCMdSN jzUZbilc1CTWckdSirEm6ng1XDVIG4rnkjKcSQmonPFKzioXesuUhQI5Dmq7VMxqNhTsbRREeaQr UmKdtrKTLvYgIqJ6tMlRtHUXKUiqRTdmasFKTbUSK5iDZTSlWMVG1ZDuVmWoWFWnAxVd6C4sgYU0 09qbjNQzVDCM000+kIqGihmKbinmmnrUjIj1ooPWivPe5R7grcU9OTUIIFTJiv0VnJGNkT4BFRsc DAp+4AVETlsVCRzyj7wqsc1YQkc02OLPWpvLIFTJoxqx6CLJzUyyYNVQMHmnA85qHFHHKlc0hNgC pkn96yDMemakWbA61k6RxVKF0bH2rHenrdHHNY6SkuMmp2lxWborYzjQsX2uab9oB71lvP70wXBq lRL9iabSg0zg1TWbNShyelHJYHGxLsBo8sUqnNShc1LdieZohKcVVmXitErxVeSPIpxnqXTlqY0q HNQ7MVpSQ81B5NdkZ6HcpFdE5q5FwKRYsVJtxUSlcxqakm7imsRmmFuKhklwalRuKNIkZgKgebFQ vOBVSSfPet4U7mnsrk8lyQetQfaNzVVkY561GGwetdCpqxtGjGxsRyBhTpCCtZ8U4FWRMGFZSjZm E6LvoRyjmod2KmlINV6noXGJIG4pjkUzfgcVG0hNRK9h+zHEim9TTA2alQZrCUh25RjJUbLirIGa ay8Vk5jUyoy1Ewq0ymoWFHPc0Uio61C6VcZe9QOBipcjVTKpBFNL4FSOKhYVm2ap3EMmaaTRigDN Zt2K0sFLtzTgOKcBxWcmS2R7aNtS4ppGKxYldkZGKjYZqVqiY1NmWkRMKaRTmNNJqXcGMPWmNxUh 5qJ+lZ2KRExqu9TOagY0WNYkZFNIqSkxUM1TIiKaeKkI5pjVLKQw9KaelONNNQyiE8GihutFec9y 0e2A5FSq2Bmq2dtO38V+kONzCUUiZnzT4uWFVt2at245BqJKyMeQ1YlCxinbQRUKy4Wk8/riuPld zmqobKAGwKhcHtQz5agZNapWOWWi1IScUqsaV1wKjyBWm5hPUsI2Dmnl6qqwzTi9S4mLY52OaRWq J5M0I9Vy6DbLsfJqwgAqqjjFTq4rGSMZMtq3rUgkAqopNDMcVi43M+W+haaYZ60Bg9Zzyc9angfn FN07I6o0LRuWTFUbQYNXYxkU9ohjNZe0szCdSzsZTLtqrJKFq/cDaDWLckkmuqkuY1ormYj3OO9V 5JsmoypPWk24rsUUjvSithrMTUZGTzUu2mmrQiIqR1qN6mOcVC4Jq1qawhci3kGp45DUOw1KqkUp JFzgkiYPkVE7cUuSBUTk4NYWMlG4jPUJekZqjNRJI1UNCZXqdGyapL1qdGwa5poxnEvAhhTWApEb NKxrlluczIWAzUD8VM571Wkf1pm0UQyGq7tinSv1qs7UWN4oGbNRmkLUmalmtrCgc08LzTRUiVjI GKF4o6VIBxTSKyJT1GnpTD0p2ajY1DRYxuKhc1I1RP1pXKRCxpN1D1HnmkyrEhPFRP0pc80h5rK1 h2IGFQtVhxULLSNEiPFGKdjik7VLLI2pjCpWFRNUNFoYRxTafTT3qWUiA/eooPJorznuM9kmfDAV GX7Ul0cTVErbmr9JT0Obnui3Hk4q/GdoFUIe1WWbAqJ6hfQlef0pgn9aptKS2KFbin7NWOefcurJ npVmMkis5GxVuN+KznE4KrJpCSKqOSKstyKrupHSpgYMj8zmjzKjdSKFBNbWQWQpkzTkY+lSJbk1 ajtKmU4omUkRpuxVyNWYjipIrX2rQhtsY4rkqVUjnlJFZYT6U2ROK1fIqrPHgVzqpdig9TJk4anx SBTSTjbVbfzXWlzI9WCTgbcVwKmM/wAvWsSOb3qY3HFYSo6nnVaPvFi5fINZUqgk1JNcVRluK6aV No3o03eyHORULNULTZoXLGulRtuegqSitR3UUoWpAlPCYqXOxhKSWxD5eRTTDnmrPAFGR0qPasFV aKhgxR5YFWyR6VC5Ape1bGqvNuVX4FV5OlWJDVZ8mmpG8LEB603GTmnNxTC2KUmW2KBipFbFRbxT TJzXLIxlqXUk5p5k461QEvFL5uRWLRi4FiSSqcr04vmoJDk0jWESKRs1CakIJppQ0mzdWRCaTrUh Skxg1DZVxB1qQNUZFGcVDE9ScNSF6gL4NMLmocQSJmaoy3NRl6burOSLcSTNRnBoBoNYsixGwqFh g1ZIzUbLSuXFkB4pM051xURJFSzRCsc1E1OJph5qbGiGUhFONJUsY01E1SmomqS4jMU0jrTj0pO1 RIsrkfMaKVvvGivOe4Hq87ZmJpYhnmoZG/eGpYm+Wv0NSOKMb6FuJsAZqRnyOKrRvnipC3OK1uma TVhu0k0/GKVQKViAaq5xzd3oOU/NVlDgVTQgtU4YAVEkc1ZXskWsg0EZqBXFSqwIrJqxg42EMeaf FB81OUgmrUW0VEpNIxk2SQ22BVlYgtRiYKKY1wM1zvmZMabe5dTaKsxuB3rKE/HWpFuDWcqbZM6R sbwR1qtORiqy3HvTZJuMVnGm0xQWpTuOTVFh81WZmyar55rugrI9On8I5RTZCQKlXBoZMinfU55b mbK7YqjIxJrVlgJ4qo9sc10wmkbU6kYsrRoW61fhi4pI4doqfcEWs6lVvYyrV3J2QhUAVDI/vSSz gA1TebNTGLe4qdOT3JnkwaQS81ULkmpEyaUlY0krFhparyTc04qagkjY1k2jNSQx5smmGTNNZGqJ gRQpHRFisagd6cWNRsMmnzGiYxpDimGQ05lNREHNTZGi1JBJmnBqhXrUyjIrKRLQ/OaTbmnqtP2V i2Rz2INlIV4qcjFRMcVG4KTZEVxULYqVmqu5osaxTYnegnio93NG7ik0aOINTCSKcTkU0jNRcEMJ NJmg5ptQ3oaJkmaUdajpQeaxkiGiXqaCuaQEYpd1YtEkUkdV2XFXjgioJFHNTcpMouOabU0i8VFi rRvFjDSUp600mokikIajbmnmmHpUFxGUhpaD0pM0KzfeNFDfeNFeY9wPS9/Oamjfiqatmp0PFfdx ncwWhbjOKsJyc1Tjap1fGa2UjObuTFwoxUYlyagaTNNU/NWikZqmkrsurJ3p3mVVVuKerc4qk7nL NalxD3p4aq6N8tLv4otcxki2suD1qZZ/eswye9IJSO9JwTM+VGn9opRKSazlcnvU6PipdNDui+rm plcmqCy1NHKKylAzlqaC5pJDUayAjrTiwNY2szG1mV3BzTNlWgm6gxVfNY0+sJIrrU6DdSeWRRna aG7mM6t9iUxqRUEkajqKUzYFV5Z+OtRZmC5myKTC1RmnIBqWaXJrPnbPSt6cT0cPTT3GyTZqAvk0 mCTT1jJrp0ienyRSBBVyFRUCpirC8GuSrI4K/kWVRStNeIEUzztophua5tWcSpybEeEVVkhHpVkz g00sGp6nRGMkZssXtUO3FaMicVVdOapM3jIrFeKjKDNTkUmzNO5pGViJYzUirUgUCg4rCb1JlK+w qjFOLDFRl+KbuzWVibXBjkcVA5IqaoZBVJG0LEDmq7VO/WoWBzTOqC0IqOaftpCtRJjbGbqXOaCu KbWTJEam4pxoArKQCAc0Gn7aaelZvUm43OKN9MPFN3UuUqxYD8UxzUYakZs1DiFhrdKhc4qRm4qB zSSNEhpppp3akxQ0aIYaYakIqNhWTNIjaTtS0hpM0RWYfMaKU9TRXlN6iPQlYVMrDFUw2DUyv8tf Zwkc7vctI2KUyVX34FMMnzVupEbstK+6pscVUjYAZq0rZFaxZFR9B6njFSoMGoFPNTr61o52Ry1J WJc4FMZ6aWpuQahVDlch5OTSqKRealQCtFIm45RUgyBSACngcVfMIaXxSrMahkyKi3c9apWZSRpp ccVOs2TWXG3vVhHrCcV0MpxNWN6nV81lpLxUwnxXO1Y5J02X2Ix1qrIcd6ia54qrJc570o3IhTYs 02O9UZLnB602ebPes+RyT1rphG53UqNy20+RURbcaqbj61NG1aWUTsUeQsRJmrIiAqCN8VP5grGp U1M51nsMZaZT2fimE56VzyZlzXI3bioGfFSSHnFVpGwaIs0gh4fFSLJVPfUiPzVuOh0cty2zZqFq cpyaUgZrJuxk42ICtJtqRsUw1DYrjGPFQsalcGoWBqdBx1EzSioixFIXxQaqNybdUMjU0tTSc0rG 0YWGsM03bT+aDUtmnNbQj24pCMCnM2KYXFQybMaVqNlqTdSdazdw1RHtp2KdilxWcncTkMPFRsak aoWNQCI3NRj71OY03vQ9jRD8U2nZzxRis2xkLCoiDmrJXNRsvNK5SZDg0hFSEcU3FS5FJjDwKhNT N0qI9ag2ghuKYxpzGozSNSJutFB60V5b3JudrI+2QinLJmorgjfmo1fBr6unPQUoXLwk+WkU81Aj ZFPU810KRg4WuW0erMTVTWrcPWr57HLNtFheoqVjximsuADUbvQ5cxyVLtjt3NKDmoQ3NODYFPbQ wasWEbmrCMMVRD81KsgFdUdi+UvZFKelVllqYEMKTdjKRFKeagBOamlFQY5q4y0KT0J0bipPMqvm jNJ2KirlpZqf5pqkCcVICTUNIHBExlOKheQ0oGRSFeKjQSiiu5PeoSm41Oy5pyRitFJI3i0iv5We 1GzFWyABVeRgKTnctvm2Gg4p3m4qEtimls1nIwlAn82jzar5xSF6hq5PISO/FVZG5pzNUEjUkrM6 KcBGfNPRuarM9PR61vodfJoaUZp5biqsb8U4vxWElqc0qbbFkkqPfmonbNM3YqWtBOmywWyKjbpT A/FBOazaCMbEbGm1JtBp6oMUnKyNOaxCFpdtT7RUb4FTzAp62ITxUbPTnNVnag3jG4rOaiLnNMZq bnHSg15bIk3Uobmoh1py1jJmckTg5FOqNeKfmsWY2GvUDdamfmoytIaIGFMJxUzLVdutJ6miHBqe DmoVqQGs2VYlqN6XdxUbNUsaRG1NNKx5ppNQ2UkMaozxUjVExpG8BjU2ndaCMCg0bK560UN1ory3 uTY62Y/NUOeakmYHnNQBucV9FSndFFqNs1PGRmqKNg1ZjcV1qRElcvpVmNsGqUcmQKsxEGnc4akd TRBDx81Xb0oVjikPWqhI46i1BacTURbFG7Na3uYuNxd/NOEmKiYgUm6umEtDRFxJcmrcb5FZaNzV 2JqJMzmrlhhUTU4uKhZxUJszUbClqVeah3ZqVDVOVjTZEw6U5QaatSA4rPnZHMxwGKGGajZwKZ5m am4MeVpMYpC/FNL8Urk8zQkj8YqlITVl+ahMea0hI6KdTQr80fWrBi4qNo8VUpJmnNchzTGansuK hfIqLlKNxGcVE7A0x2IqMtWkUddOCQvenpTO1SKOamVi5bE6U9ulCLTiBisHM5m9SBuKYWqR+tQt QUkG6ng81EelAfB5qGTKJZWn5xUKsKcXFYtGXKxxbAqGRqC+ajY1JrGFiFyc1Xc1YfpVdhmqudUH Yhxk04LTgtSqtRKRM5EQQU4LUwWggVi2c/NcjApaUikPSpGFIRmjNGahgNcDbVR1q4xzxULilcqJ VPFGaV+DTM0jVD91ITxTQc0E8VmxoaTSGgnNITxU2LI2NR4qRhTDxQaJiAUjU6mMaRSK7daKG60V 5b3GdCZdwpoPNVI5al317dN2G2WQ1Sq9VA/FSK1dkZEl+OWrcMuDWUj4q1HJgiruc9VG0jblpSao RTnHWp/NGKUWcE1ckc8VHuxRuzTCc1tCRKj0JQ2Rim5qINTwc10qVgsTJzVpDgVWjFTA1Mpamcib fUTnNBIqNjQpEocDg1OjZNUi+Kkjem2No0UOafuqsj08txUXMhzNTKaX5phkGatFKI9iRUe6kZ8n FIoyaLA42RMozUgWkQYqSocjPqRsOKgepnaqzGp5jaAxhVaRc1YPNMYUczOmJSePmoGUg1eYc1C0 ea1U7GsaliuvFTRmm+XTwu04pSkU6iZYUilJFRA8Um6sTK12I/JphFOzmjGaVzaNiFlqPpVkrUbJ S5itBgNLuNIVxSUm7k8qFLU0nNNZj0puakEKaZilHNOAqZMdxm2pFWlAz1p1Yt3M5NsaRxTetOJp vSoIGmmGnmmnrSuUhpPFNJxSmmPUssXdTGpuaUHJqRpETioCOatPiqz8Gg0WwwHFDGmk0gOTU2LS HCg8mig9KhjGEUxzink1C3JpIuImeKa3SlzTT0pGhEetFBory3uBcV6lR6pq1TI1etGQFxGqUGqi NU6tXTCZFydWqdHxVRWqRTW17mclcvxyYqdJqzlapkeqOeUC+JOKcHzVNXqRWq4sxcSx2zSocNmo 1apK2UiWrFxOlSAjFVVk4xQZPele5k4lgtzTWfNQeZTS9VEnldx7E5pynmoNwNOV6tltF5Hx1qXf kVQWQ1IJeKlIycCwz1EXNRGTJoVua1i7LUtKyJVyRVhBUS4xUoYCs5SuZydyYHAoZ8VCZARTGfis 2xRgPZqbjNQNLzQJhSNuWw9hULtih5RVd5c00VG48txQOah3Zpyk03IbWhLsFIVxSB+KC+az5mZ6 kbDmkpzc0qLk07m8ZChc0u3FScAVE70m7lXdxrHFRM2aR3zUdI2VrajzzTCOaUA5pdtQ5C5kREcU bam2Um3FQ5k8yItnNOC4qTbQRis3IjmGUUuKMVNxXIyKYTUrCoHODSuUncM5pjUFsDNNJ3Urj6iZ oNJ0pC2aCiNqaCQaewqM8VLGgduKgbmpGNRkUGqIyM8UqrTsUHpUtljTxSFsClaoycioGkIxqM9a cetGKDRaERFIaeaYelSUR/xGikPWivMe4rCqcVKrVDTlNd6ZbRaVqmQ1UVqnjat4yMmi0OlPU1Cr VIprVSM2TK1OBqIHFOzmtoyJLCyVKr1UU4qQNWqZm0XFfFSiTiqKtzT95q0zOUbl3zKXfmqiyE1I G4q0zJqxNu5o3elRbqUGrTFYl3Zp4PFRrUlDmQxc4pN5prHFRF+KpMaiTGTNPR+aq7s1Ip5puQ5J F8S8Uxp8Cq+6opG96hEKCuW/tGO9BnzWfu9zT0JJ605JGvLYstJmo95FIORSYyalWEtRd7HvTlQk 0InNWkTApN2CTsRBAKa/y9KncgVSlcCpTFG7Avg05WzVUvzUsb0MpxLKjNSDgVErihn4qBRix7yY qs7013yaiLVZ0RjYfnJp6jNQg1Ir4NZTZM72LCoKfsqNJOak8yudtnM7ibRSYFBcU0vS1BXHHpUT HFDSCoHl5osWosdupwOag3VMlJodgIqtLVo+tU55ATipTLiiFm5xS7qZSFqZpYVjSZpC2eKTNMLD ye1RmgtTC1QykhaYeDSk8UzrUXLQpPFMalpDQWhh6UwipCKa3SkNMjoNLSGpLGmmmnGmGkykQt1o obrRXlt6sYUClIpK77jHqamQ81XBxT1arjIhl1XqQNmqitipletUyWizkU5WxUKtUg6VtFkMkDcU 8NUNKDitoskn3U8HNQA808GtFKxLRYWpAcVArYp+/NVzGMlcmzSqah3Y604GmpE8pYD0/wAzAqru z0pBJj3FNkezvuStJzUJkwaGOelRNVplxiTq3FSo1U0ap0aiUhSRb3ZGKjcUq08jNSpGSIQvNSqo pKXcBQ5F3HYFOCioi9PVxSuLoWEQYp5YKKhEox1qKSX3qb3ISbY6WaqUsnNJI5JqAnNaRN4RSHA5 qZDioVqVKUmWycNQzcUlIai4k1cYcmm4xUuBTGOKXOXzDDQHpjNUe6lcRZEpFL51Vd1NL1NieQtG ajzc1WB5pwNHKVyokaSoi/NNY803vSsgSJUOTVkNtWqqELQ8pNZSQOJJLccECqpJJoPJoxUtWBKw 0nim5NPK9zTTQmUkNzRzQaBTHYac03NONMPWoY4oUmmmlorNl2EpD1ozSE0hoKYxp2ajbk0DQ2kN KeKaTSLQh9aaaUmmnpUspELck0Up60V5j3KHUhFLRXeITFKpxSZpM0ATK1SqarqcGpVOauMhMnVq mVqrKRmnq1bKRm0WRS9TUQfinq1aRkTYlANOpVIIp1aKYmAalzTAMUua0TuQSbs09WqHvSirTQWR Nupc5qLNKDTuJjyaaeaM5pCaakTYVQKsxrxVdKtIwxxSciJIlUYoLUmaYzVKZnyaiF6jLkGgmmZB q7mihoSBqeGqIA08LU3E1Yk31GxpRTGpXIRG1MpzMKj31fMzWKY4cVKjVDup27FQ5FNFjdijzKrl +KbvpCUSwZKYz1FuoFBaiBJNJT+Ka1K47ERPNJupWFRc9hTuUkiYHFLuqDOOtHNK4miUtSbs1GTx Td2KVxcpPupc1XDVKDmokFiTFKAAKbvFBbNZvcmwjmoGanu3FQE5oLSHDmnimLT6VxyEJ4qM9aea Y1SNISiiipYxppKU0lSAhPFRmnMaZTRSQhNNNKaaTSKEprc0pNNqWXYjPWig9aK8x7jHZpDRRXaJ IKKSlpoYDrUitio6M80xFkGnKarq1SKauMibFgcipFOKgVqkU1opEstI2Kk31VD08PV3IaZZzQMG oRIKcHFapkWJh1pahElO3Zq0wsPzRmmbqcDmq5hD80Zpu6lBzRzCZIpqVTVYH0p4lxRe4rFkSU0k HpxUBkFAfNNXHYewOaaOeadmkzjpTuFx6tUobAqruIpPOJFBDjctFsVC71AZs0wyE0WHGl3JGamU zPNKGpm3KPzS5po6Uh60mJxH5FGeaizRuxSFy2J+tKOlRBuKkDcUrhsOoxmgHNSoBSciZSsReVnr QYeOKsgKKGIFQ5My52U/II60x1CjirDyjpVZz1NCNINvchamGnk5PAo8vuaq50cthgbvR5vFOYCo 9tSFkSK1Sb6hFKelSyGris2aZ3ooBxSGOHFLmm7qN1SKwp5ppFLuppakxhTSc0pNRk81I1EU0hOB TSaQmkUoiUhoJpKCrAaYwp9IRSKRHimmnsKZUvYYyiiivMe4ri0mKWlArtGJRS4oxTASiiimAA4N PDUyihBYsK1PDVXDYp4erTJsThsUu81Du4pQ1axYmidXp4eq4NPBxWiZPKWA1PDVXDU8NzVqRLRO DxTw1QhqcGpXIaJc0uai3Uu6mhOJLuzSZqPdRk007DUR1AYjoaZmjNXcqxMrkU7dmoM0oai4cpYB 9RQVUiohJmgv2ouRysGQVHTy2aTiquaKNhlKKeFHpRgUXLG/jRmlxTDSbJaYpPFNJxRmg80XKumG +nK2eajpc4pE8pOsuOlSLIT15qstToDSbIlFEwc9qaxPrQOKQnisnuZ2QxsevNQkU9zg1Czc1UTW ERWIoBptLmmbWA9aaRR70hNJksWmk0bs8UYpEsTNLQOtKam4hDTcmg+tJU3KSFJ4pKKKQmIaYelP PSmGkUhtITS008g0mUIaSiigpIdnikpKKQ2hp6009acaaalgRHrRQetFeY9yB9FN8wUbxXXzx7lD qQ0m8Um4U+ePcB2KTFG8Um8Cn7SPcB2KQjFAkFLvWlzx7jQAUuab5i0bxRzx7jJM05WqAOM04OKt VY9xOxYDc04HNVw4pwkFX7aHclosg04Gq4lXFOEq4qliILqSWd2aXdVfzlFL5wqliKfclxJ91KrV W80CnrOo60/b0+4uUtpzUuDVVbqMDvUn2yP3o+sU+5aQ89aZmmtdRn1qMzp71SxFPuOyJtwo3VD5 wpPNFV9YpfzBoT7qXdVfzVpfNUUvrNP+YRZyKUHFVvOWl89aPrNP+YVi1uo3VV+0Cj7QtNYil/MN IsZpMgVCblcUnnqaPrFL+YehLmmk1H5y0hmWl9YpfzCJc0oBJqETLT1uUHrR9ZpfzCZZRMDrUmQK rfa4x60hu0PrUvEU31MnFstbqjZsdarm8XtUTThuppe3p9wUHcnd8mo81H5q0eatNV6fc3VkS5pa h85aPPWj29PuCJCeaSo/OXNHnLS9vT7j0JKXNRectIZ1pOvT7iaJqQmovtC0nnpUutT7kWJKKj85 Pegzp70e2p9yh5amk1GZVzR5q0vbQ7k2JKYetIZlxTfNU0e2h3CzH0h6U3zV96TzVpe1h3KihaSk Mi00yCl7WHc1uOJpKb5gpPMFL2sO4rjqD0pvmCkMgqfaR7gMPDGikJyc0VxPcmx//9l= ------=_NextPart_01C8E823.DA10E9A0 Content-Location: file:///C:/8E69C634/Classof2004_files/master05_image002.gif Content-Transfer-Encoding: base64 Content-Type: image/gif R0lGODlhMgCSAXcAMSH+GlNvZnR3YXJlOiBNaWNyb3NvZnQgT2ZmaWNlACH5BAEAAAAALAAAAAAw AJABgAAAAMv//wL/DIynyesN3Zux0husxrz1v2khSHrjWR7oSqZs+LqcHFc1PeE3s+uK38sAfcNd kHisJXFF3TLWVEZl09eTel1lU1XXFtXVhltfUHk0Pp0/aXN78+6s4XNM3RIX5S97Wz93RxEY8Qcx CFi4cGiSiLAo8ejY+BOpMmlwaVmZKbRZ2TnJ+QkgmlnqeTl6Gvqp2mr6ihrpmgpbK9tIO2u7i7uo m8sb7FsI/Ct8TDxoXIzcrNzHvOw8DX0nHU2dbZ2Hfa39zT3n3Q1eLv5GPm6+jn6mns4e754G/y5/ T/9lX4/frx+G3z5/AwFmERiQYEKDVRAeVPiQ4ROHDSFWlBiF4kSL8xsxJtGYkWNIj0VAfhR5kmQQ kyVRtlQJhOVKlzNhGqEZE+dNm0509uQpBSgNmTmFWvEZlNUtpb2YDnOaDOozqdWobrMaDus5re24 zvOaD+w/sQXJLjQbEe1FtR3ZjnSbEu5LuTXpFrW7E+9PvUkfrfIbi+9QpIONeiF81LAYxSWI5gW8 FHJTyU8pR7U8FXNVzVc5Z/W8FXRX0V9JhzU9FnVZ1WdZp3W9FnZb2W9px7U9F3dd3Xd5P070F3hg 33uJ9xUeGflk5ZWZX3aeGfpm6Z2pf7YeGvto7aW5n/aeGvxq8a3JvzYfG/1s9bXZ33afG36QAgA7 ------=_NextPart_01C8E823.DA10E9A0 Content-Location: file:///C:/8E69C634/Classof2004_files/master05_image003.gif Content-Transfer-Encoding: base64 Content-Type: image/gif R0lGODlhxQAJAHcAMSH+GlNvZnR3YXJlOiBNaWNyb3NvZnQgT2ZmaWNlACH5BAEAAAAALAAAAADD AAcAgAAAAAAAZgI1RIynyesNn4x02oqvznz7Dn5iSI5miZ5qyq5uC79yTM92jd96zu9+D/wJg8Sh sYg8KpPMYQEAOw== ------=_NextPart_01C8E823.DA10E9A0 Content-Location: file:///C:/8E69C634/Classof2004_files/slide0002.htm Content-Transfer-Encoding: quoted-printable Content-Type: text/html; charset="windows-1252" CHSAA Hall of Fame
CHSAA Ha= ll of Fame
nIn 1989, the CHSAA establishe= d the Hall of Fame to recognize those people from its history who nurtured and guided the organization to its current position as a national leader in high school sports and = activities. nCurrently, there are 99 members in the CHSAA Hall of Fame
n
------=_NextPart_01C8E823.DA10E9A0 Content-Location: file:///C:/8E69C634/Classof2004_files/master04_background.jpg Content-Transfer-Encoding: base64 Content-Type: image/jpeg /9j/4AAQSkZJRgABAQEANQA1AAD/2wBDAAgGBgcGBQgHBwcJCQgKDBQNDAsLDBkSEw8UHRofHh0a HBwgJC4nICIsIxwcKDcpLDAxNDQ0Hyc5PTgyPC4zNDL/2wBDAQkJCQwLDBgNDRgyIRwhMjIyMjIy MjIyMjIyMjIyMjIyMjIyMjIyMjIyMjIyMjIyMjIyMjIyMjIyMjIyMjIyMjL/wAARCAGQAhYDASIA AhEBAxEB/8QAHwAAAQUBAQEBAQEAAAAAAAAAAAECAwQFBgcICQoL/8QAtRAAAgEDAwIEAwUFBAQA AAF9AQIDAAQRBRIhMUEGE1FhByJxFDKBkaEII0KxwRVS0fAkM2JyggkKFhcYGRolJicoKSo0NTY3 ODk6Q0RFRkdISUpTVFVWV1hZWmNkZWZnaGlqc3R1dnd4eXqDhIWGh4iJipKTlJWWl5iZmqKjpKWm p6ipqrKztLW2t7i5usLDxMXGx8jJytLT1NXW19jZ2uHi4+Tl5ufo6erx8vP09fb3+Pn6/8QAHwEA AwEBAQEBAQEBAQAAAAAAAAECAwQFBgcICQoL/8QAtREAAgECBAQDBAcFBAQAAQJ3AAECAxEEBSEx BhJBUQdhcRMiMoEIFEKRobHBCSMzUvAVYnLRChYkNOEl8RcYGRomJygpKjU2Nzg5OkNERUZHSElK U1RVVldYWVpjZGVmZ2hpanN0dXZ3eHl6goOEhYaHiImKkpOUlZaXmJmaoqOkpaanqKmqsrO0tba3 uLm6wsPExcbHyMnK0tPU1dbX2Nna4uPk5ebn6Onq8vP09fb3+Pn6/9oADAMBAAIRAxEAPwD1aS+4 zmsu7vA4PNZzXZ285qq0xfODxX0NPDJBLcneTdULHJprMcU1TziupRsZOSHhM1YhQbqhQ8VJ5uPS lK7BVF0LokCDg1HNcYXrVRpcDrVGe4LHrUwo3ZrCrZ6D7qfJqhId1DOWOTSYJrtjHlRuqinqxCtC rzmnEECm1Zo6sIkyAKM1Yjk7CqROOKnhYA8nis5I5pYjm2NS3QvgCte3tOmASaybWdVxW9a3cYUc 152IclsctV3VmBsdo5qlKoRs+laFxeqw4PWsi4lznJrKlzS3OKdCBZivGQYBq9FeZHWufElTxzY7 1pOimcc48mtzoROp9KilnUDtWSLrjrUctyNvJrJYfUhVNSS5uFPas55AxPaoZ7rJ4qASbj1ruhSs jSNVrRF9Llk+70pzX8uOtVAcVFLJin7OLZ3QrT6Es127dTWXcS5zzRLISapSNXXTpJHXBOW42R81 XYmlduajLjHNdkUauKQjE1Xd8VI8melQNz1rVIOexE0h9KjYk9alMRNKIfepkkjGWIKrJmomjq8Y wKicAVzSTMHJyKLKRUbA1ZZc1EUrCUbE6IrHk0uypxGDT/K4zWMkjRIplOKgcVck4NVJDWLiawRX cVA1WGqJ8YrJxNrFcjJqNlqZiB1pnU81nKI4kDCoWq0ymoHWsnEq3YgYZqJlqwRQU4rFoh3KZXmm EVZZMVEy1k1cVyKlBpSuKZ3rNoZJSHpSBqXrUjQ2lBpKKY2FFFJQhC0UUU2FgpwNNozSEPzRTQaX oKRRC33jRQeTRXE3qQfSfm5pd5qHOKXea+05TKpUJy4PrSb8VGnNK3yjJPFTY45VXcnElLn1qsrn NWUUvSasZupYiclqiMRzyK0I7csala0OOlT7VII1XuZBiI60LHzmrzxHuKgf5a0U7nTGvdERjpjK F61Jk1DI2TzVK7NHJPcjc7TTPN9KcwJNSx22DuYVpdJajeIjTVhIZn4zWlDdEYANVUt8HAqwEVO1 YVOVnnzxDky0bv5cZqrJKTyaiLjOKheSpjTRop3ROZsU3z2qoZDmmmbHFa+zMZLmZaa6YVBJcuT1 qs0pamF+ea0VNC9iTmUkdTSrKRUIPrUoPFU0hqkkTrcY70yS4GOtV5OBxVaR/WlGmmdENCV3BOc1 Xk5pjSYNQtcYFdEYM9CnsOZaiZDSrIWPNScYrXVBOaKpjNIIzVzANO8sGnznNJ32KJGKiZqszKKp P1oauTGk76is1MwWNAUk1NHHkVnJWNpRUERGIdarSJjkVfdcVSl4Brlmzicm2Vd4XjFSeam3moXI zUDnNZWuaxkOlIPeqjcmpGJJppWpcTam9SBhiq7E1acVVk61lJHW3oQtzTcU+kxWMkZ31Ghu1MdQ KlK0xqzaKUiswoXrint1plYyiNu454wwqu8XtVlW7UOAa55IzbM90IqIrirzqDUDJWb1BMr4op5W mVmVcKTFLSgUFXEooooFcKKKKB3CiiigQDrSmkopDRGetFB60VxNakn0ikWRyKCmDxVuQrEvvVJp xk19nFuR58oykSjCqc9qrO5kOO1OZ2kGFGBT44sdapK2rIlDk3JYIjgVoxKBgGqyFUoNxg1hK8mZ ct2acQC81HPMqDjrVH7eQOMVWkud5OazjRbeoOFieafceKpu5LUm8saeErpUVEFO2xEF9aPL5qUg A0xnxVXG6jaFVVFShqrb6eHzScTnqXZZD013zUW+mk8UlEysDGomNOY1GxrRItSGMRUec0p605Y2 PatDRTsREU0irfkHGTUTxYpqSKVdPQgzineYQKQx804JxVaFuoRvLzVWSTJ4NW2hyetC2id6pSii oS0vcynJNRkVqy2iYwDVVrYA1tGpFnQsRfS5U3lelJ5r9s1aMA9KcIUHOKvnRPtF0II5JCeRVpZR jB61G/A4qAHmpaTNacusiaUBqqvEtTAmmNT2KnXS2ZEFFSbgB0ph4NBPHNZTuzlnVb3GyNVOTnNW XNVnOawlEyjLUqyR5qs0fpV1qgK0KNjZTRX20jDAqbbUUorKR1UmmVJRkkVWZGq6E3NiphAD1rCT NZTsZSoaUpWhJbhearutYtE81yqRxUTACp2FRMuaholzK5phqVlIpu3NZyRSncZikJqQrxUbCsJI fMRtTDT2pKxkgISvNRstWCKYy1i0CZXxiipCtNNS9CrjTSYpaQmkMSilxRigaY2lFFFMYoFBpe1N pDIz1ooPWiuN7k2Poma4aRsChISTk0sEOeTVncij3r7VytoiHZIcsQQZpC+2mGYYwKgeXipUW9zh k+Z3JJZyelRecc1ESTT0jLH+dacqSIckSDLDcaeF46UKu+TavQdasSYRcY6VDfQ0dJ8nMyBRtpxf AqJm5phY07XOZrUkaSoGekYnNNwTVqKQcooY5qZKYkRq3DAWpSkkKVkMVSaGGKvi2IGajeE+lYqo rnK5plBhTNpJq6bcmnLb461XtEifaJFSO3LHpVxLcKOalUKgqOW4wKhylJ6HNOq5aIbLtXiqMjLS TzGqTyE1vTps3owbJiRRuxVcOaeuTW1jomrEhYUzdk8VIseakWMDqKm6RzudiDBbtQYR3qVmC9KZ uzRdh7VrYheIdqrOhFXwuRTvJLdFzVqdjenmLgtUZZU56UGM+lav2Vj1Wpo7Qd1NDrJE1sy51sYR hcjhTUbQuOorongVRwoqjMgHamqvMYRxLexkmM+lMZcdauSkLWfNJjNaJXOmM3IY2AahcimvKSar s5qnTNlFj2IzULcUEmo2bjmsZI0jEazc1EzZpXbmoTWEkdENAB+eraOCtUwDmpVJrCUdAc7kkhqr IuTUzEk1GwrFqwc5WdAagaOrjCoiBmsmK9yv5dNMWBVsLmmyRkVk2NSsUWGKhfrVmVcVXcVDVzRM rsvOaTFSMKbjFZyRdxp5ph61IRxUbVi0NDDzUZFSUxqyaKRHSHrTqaetTYpCDrS5pKKCkOpDQDS4 oKQ2iiikMjPWig9aK43uI+j2mVeAKqtNlqSUN2qNUYmvuIxSOdxctSQvkUBN1KIjU6R4PNDaWxxz dthiRetS52KQOtOOAOKYcE81F7hTjzMlgIjQs33jTHbcaaeetJmklrc6K1Sy5RCOKaRS7qM5NUcE p6gEzUywn0p0CZOK0Y7fI6VnOpYh1EipHb5rRgthxUkcGOTU+4LXJOo3scNfEdENMQFQPEKleX3q BpfepimcntWNKAVBIQOlPaSoXBNbRXcItvcgdzmoGBbnNTsvPNMYAVujaJSlTiqrR81fkFQ7Mmt4 ysjqhVsiFISatR29SxR1bVMCs51DGriLlPyttRyHirkgqlIM0RdznUrkTdacqg0zaTThla1Kt0uW I4lHWrUZRazGnwOtRtdHHWodNyJ9hc22uYkXqM1Rnvh/CRWTJdN61Uack9auGG7m1PCrqact6T3q nLck1U3lu9OArdRjE3jRUSOaUkVQkJJNaEijFVGStVJHRFIreUWOcUG3OKtKvNP28VjUqNGnPYz3 ixVaRcVqSJVV4wRWDqNlRqXM4g5o8sVaZKYVqWzbnK5QClVealKk1AxMbZNYyIbuTBB3qN0x0oWY EUF8msGmRqQMtMCZqzt3UbMVnJ2LUiER4oZSV96nxxTGFcjlqTfUoyR5qq8eK0XXvVaQCi5tGTKD LioSKtOOagYUHRFkRqJqmIphArNmiICKaQcVMVpCvFZNDuQGmmpGWmEVFikM70uKXHNFSNDR1p1N pR0oKEpDS0hoGM70Ud6K4HuB9HFMnpQsXOaskAUYBr7TnY6kOVaEXlheacMAZp5ximOeKV7nnSp6 jG5FM2ZpwOTUmMVV7Dfuq5CeKgdsVYkwelVZOKuJ50qjbGhqlQ81CAc1Mgq2Z3L9t1Fa8O0LzWLA 22rf2naOK4qsXJ6HPUbasaLygdKrtLmqn2jcetSoc1Hs+U4ZpjySajapaYaETFCKlJJhRUmcCq8z 1S1ZaIJHqEtmkYnNN710RVkdEVoBGaVUGaBTgcVVxslTipC4xVXzKY0uKnkuZOFyeRh61WYio2nq tJcYFaRpsqFGTLLOF71A8ox1qlJdc1XNxmuiNFnRHDSLjyZqFm7VEjk1Lt3Vpaxbg4kLHNR7c1Z8 ulEXNVzWKUrECr0pScCpimBUDg4qdyua4x2qE0p60wnioehSYDrT85FRbqN3FYz1E3qJJVZ6mds1 CRkVmkawIjzQEzT9tHQUpDuNMY61XmQFcYqwTioXOahIuLM50MbU9TnBqWRc1Gq44rOTNLposRjN PZBimx8CpCeK5KiMXoyE1G5FPc4Oaru9c/LcpakcrYqlI/PFSTOc1UYnmqtY6YRsNZuaibrUmCTR tqWbaEJHNMqZhg1G1ZspMjNIRxSnrSGoaKI2WoyMVMajYVDQ0yI0lSEU01mWNPpTad3pD1oGhKKK Q0FDDyaKO9FcD3A+kPNwKPNql5tOV8ivueQupVUkWjJTS5JqDdTgTilynM0tyZDipM1U82nCXik4 nBiJE7/NUDxkninGYZxSo4amk0efYYI6dgCpiABULHNJO5O47fgcUm8k1FmnLVWIkWYyauI2Kooc VMJMVjONznlG5bMnHWojNiqrzcdagM2T1pRpgqZoGbjrUbPmqXm+9PElV7OwKBIwpuKTfmndao0t YTpUbNUjVDJTWohjvVZ5DT3Jqu5zW8UXBajXkNQNufpVhYS9W4rXjpWnOom/tY0zH8hiKiaFlro/ sgxVeW1HpRHECWOWyMhARUwNSSQ7TULcGtL8wOop6lhCDUypkVTjkq3G9ZyTRlK6EdKqypV0sKqz sO1TzGak2yk681C61Oxy1MIps6NUiDB600jipmBqNuKyZSZEaTbUm2jbWbZXNYjK1E3FWdtQyJWd 9Soyuyqx5qPrUrpioiMUNm6SGlc0gUZ5p9FYSJTFVKGGFoU4pHasZIdrleQ1SmPNXJDzVSTBrNou BUc5qPFTlaaVqWdCZFtpCOKkIxTSKzZS1IG61GwzVgrTCtQ2aJ2KxXJpNtTlaYRUMdyI9KjIzUx9 KjNQNMiIphGBUhpjVLRokRmm04imkYqLFISlFJRTZQw9aKD1orz3uB77mnKSRTVXIpw4r75nmRm7 6kmad2qINSlsipsa1KmyQMwIxTd2KQk005NVY45auwjOSeKu2kRfmoLe3Mj+1bdvbhF9qyq1ElZG FWSirFWbPQDiovKJWr8pQcAVUeQKOKxjJvY5XVjsVnUr1pobmklkZjTBnNdCWmpDd0WA+KDJUWaa TS5RJEjPmo91JRVJFhuxS76jJphbmnYpRLKvmpleqStUofBqZRCUS1mo36UwvSb6lRMmROKgxzU7 c1CetbRCLLERUCpftKqKzWkIPFQGRie9P2XNuW6XNubH2sGmmYMKy1YnvUyk0nSSM3h0iWTk1Ukj Jq0ATTzGCKpS5SFLkMzkU8T7R1qSeLB4qk8ZrdWkdKkpInN2c9aYZS45qEQk81MsZFLkii7RWxER SGpmWoWHFS0UncaTTDzQxOajLYrKUDRUySlAqLdQJK55IiUHYkOMVG+AKQyc1FJJWFnciMXcY+Kr NUjvUROaOh1xTsAGadimqakDcVjIT0GEYqF6nY81C/Ss7hFlaQ1XY81PJzxVduKGrm8Rp5NNIGKD xSE1k0bJCYphGBTyaYxzWbQxpNRO3NKxNRMeahxKSEY1GTTyM0wjmosWkRsTTCakYVGRQyhh60w0 89aYetRI0TGEU0jipD0ph6VkMZRS0lIoYetFHeiuB7jPflIAprPimB/lpm7ca/QVE82CViXdSB+c U3FC8UWM5O7J1HFPWMbuahVuasxsOtZyujGTsXrdAgzVsPkYzWcsxzjNTLJk1yyi2edXbZZKg1E8 WalQ5FSLg1ndo82UpJ6mf9k3HpUqWJ9K00jUHmp1CilKuylWdjEktcdqrG25rdmAPGKrtEM1cKzN 41dDG8gg801lxWnJGKpyJzxW0Z3NoT7lFqjINW2iOKb5VbKSN1NECg0rHAqyIuKhmTFNSuyk7lcy kUCaoJAQaZkitVBM0dNMuCTNLjNV4yd1XI1zUSVjmnGxXaHPSm+TzzWh5fFNaMZpKoKM2Uli5qZY 8VJtpelDlcJSBY6fwFpDIFqF5gRU2bOVptjJuaqlQanLEmmMMDNbR0NVohgAFISKjZyKYHzTZpys c3WoHwalJOahfg0NmsXYidaiK8VMxqM1DkdEZMiPWmZp7dajOaxaNN1qITUbGpGGOahc1DSCMdSN jzUZbilc1CTWckdSirEm6ng1XDVIG4rnkjKcSQmonPFKzioXesuUhQI5Dmq7VMxqNhTsbRREeaQr UmKdtrKTLvYgIqJ6tMlRtHUXKUiqRTdmasFKTbUSK5iDZTSlWMVG1ZDuVmWoWFWnAxVd6C4sgYU0 09qbjNQzVDCM000+kIqGihmKbinmmnrUjIj1ooPWivPe5R7grcU9OTUIIFTJiv0VnJGNkT4BFRsc DAp+4AVETlsVCRzyj7wqsc1YQkc02OLPWpvLIFTJoxqx6CLJzUyyYNVQMHmnA85qHFHHKlc0hNgC pkn96yDMemakWbA61k6RxVKF0bH2rHenrdHHNY6SkuMmp2lxWborYzjQsX2uab9oB71lvP70wXBq lRL9iabSg0zg1TWbNShyelHJYHGxLsBo8sUqnNShc1LdieZohKcVVmXitErxVeSPIpxnqXTlqY0q HNQ7MVpSQ81B5NdkZ6HcpFdE5q5FwKRYsVJtxUSlcxqakm7imsRmmFuKhklwalRuKNIkZgKgebFQ vOBVSSfPet4U7mnsrk8lyQetQfaNzVVkY561GGwetdCpqxtGjGxsRyBhTpCCtZ8U4FWRMGFZSjZm E6LvoRyjmod2KmlINV6noXGJIG4pjkUzfgcVG0hNRK9h+zHEim9TTA2alQZrCUh25RjJUbLirIGa ay8Vk5jUyoy1Ewq0ymoWFHPc0Uio61C6VcZe9QOBipcjVTKpBFNL4FSOKhYVm2ap3EMmaaTRigDN Zt2K0sFLtzTgOKcBxWcmS2R7aNtS4ppGKxYldkZGKjYZqVqiY1NmWkRMKaRTmNNJqXcGMPWmNxUh 5qJ+lZ2KRExqu9TOagY0WNYkZFNIqSkxUM1TIiKaeKkI5pjVLKQw9KaelONNNQyiE8GihutFec9y 0e2A5FSq2Bmq2dtO38V+kONzCUUiZnzT4uWFVt2at245BqJKyMeQ1YlCxinbQRUKy4Wk8/riuPld zmqobKAGwKhcHtQz5agZNapWOWWi1IScUqsaV1wKjyBWm5hPUsI2Dmnl6qqwzTi9S4mLY52OaRWq J5M0I9Vy6DbLsfJqwgAqqjjFTq4rGSMZMtq3rUgkAqopNDMcVi43M+W+haaYZ60Bg9Zzyc9angfn FN07I6o0LRuWTFUbQYNXYxkU9ohjNZe0szCdSzsZTLtqrJKFq/cDaDWLckkmuqkuY1ormYj3OO9V 5JsmoypPWk24rsUUjvSithrMTUZGTzUu2mmrQiIqR1qN6mOcVC4Jq1qawhci3kGp45DUOw1KqkUp JFzgkiYPkVE7cUuSBUTk4NYWMlG4jPUJekZqjNRJI1UNCZXqdGyapL1qdGwa5poxnEvAhhTWApEb NKxrlluczIWAzUD8VM571Wkf1pm0UQyGq7tinSv1qs7UWN4oGbNRmkLUmalmtrCgc08LzTRUiVjI GKF4o6VIBxTSKyJT1GnpTD0p2ajY1DRYxuKhc1I1RP1pXKRCxpN1D1HnmkyrEhPFRP0pc80h5rK1 h2IGFQtVhxULLSNEiPFGKdjik7VLLI2pjCpWFRNUNFoYRxTafTT3qWUiA/eooPJorznuM9kmfDAV GX7Ul0cTVErbmr9JT0Obnui3Hk4q/GdoFUIe1WWbAqJ6hfQlef0pgn9aptKS2KFbin7NWOefcurJ npVmMkis5GxVuN+KznE4KrJpCSKqOSKstyKrupHSpgYMj8zmjzKjdSKFBNbWQWQpkzTkY+lSJbk1 ajtKmU4omUkRpuxVyNWYjipIrX2rQhtsY4rkqVUjnlJFZYT6U2ROK1fIqrPHgVzqpdig9TJk4anx SBTSTjbVbfzXWlzI9WCTgbcVwKmM/wAvWsSOb3qY3HFYSo6nnVaPvFi5fINZUqgk1JNcVRluK6aV No3o03eyHORULNULTZoXLGulRtuegqSitR3UUoWpAlPCYqXOxhKSWxD5eRTTDnmrPAFGR0qPasFV aKhgxR5YFWyR6VC5Ape1bGqvNuVX4FV5OlWJDVZ8mmpG8LEB603GTmnNxTC2KUmW2KBipFbFRbxT TJzXLIxlqXUk5p5k461QEvFL5uRWLRi4FiSSqcr04vmoJDk0jWESKRs1CakIJppQ0mzdWRCaTrUh Skxg1DZVxB1qQNUZFGcVDE9ScNSF6gL4NMLmocQSJmaoy3NRl6burOSLcSTNRnBoBoNYsixGwqFh g1ZIzUbLSuXFkB4pM051xURJFSzRCsc1E1OJph5qbGiGUhFONJUsY01E1SmomqS4jMU0jrTj0pO1 RIsrkfMaKVvvGivOe4Hq87ZmJpYhnmoZG/eGpYm+Wv0NSOKMb6FuJsAZqRnyOKrRvnipC3OK1uma TVhu0k0/GKVQKViAaq5xzd3oOU/NVlDgVTQgtU4YAVEkc1ZXskWsg0EZqBXFSqwIrJqxg42EMeaf FB81OUgmrUW0VEpNIxk2SQ22BVlYgtRiYKKY1wM1zvmZMabe5dTaKsxuB3rKE/HWpFuDWcqbZM6R sbwR1qtORiqy3HvTZJuMVnGm0xQWpTuOTVFh81WZmyar55rugrI9On8I5RTZCQKlXBoZMinfU55b mbK7YqjIxJrVlgJ4qo9sc10wmkbU6kYsrRoW61fhi4pI4doqfcEWs6lVvYyrV3J2QhUAVDI/vSSz gA1TebNTGLe4qdOT3JnkwaQS81ULkmpEyaUlY0krFhparyTc04qagkjY1k2jNSQx5smmGTNNZGqJ gRQpHRFisagd6cWNRsMmnzGiYxpDimGQ05lNREHNTZGi1JBJmnBqhXrUyjIrKRLQ/OaTbmnqtP2V i2Rz2INlIV4qcjFRMcVG4KTZEVxULYqVmqu5osaxTYnegnio93NG7ik0aOINTCSKcTkU0jNRcEMJ NJmg5ptQ3oaJkmaUdajpQeaxkiGiXqaCuaQEYpd1YtEkUkdV2XFXjgioJFHNTcpMouOabU0i8VFi rRvFjDSUp600mokikIajbmnmmHpUFxGUhpaD0pM0KzfeNFDfeNFeY9wPS9/Oamjfiqatmp0PFfdx ncwWhbjOKsJyc1Tjap1fGa2UjObuTFwoxUYlyagaTNNU/NWikZqmkrsurJ3p3mVVVuKerc4qk7nL NalxD3p4aq6N8tLv4otcxki2suD1qZZ/eswye9IJSO9JwTM+VGn9opRKSazlcnvU6PipdNDui+rm plcmqCy1NHKKylAzlqaC5pJDUayAjrTiwNY2szG1mV3BzTNlWgm6gxVfNY0+sJIrrU6DdSeWRRna aG7mM6t9iUxqRUEkajqKUzYFV5Z+OtRZmC5myKTC1RmnIBqWaXJrPnbPSt6cT0cPTT3GyTZqAvk0 mCTT1jJrp0ienyRSBBVyFRUCpirC8GuSrI4K/kWVRStNeIEUzztophua5tWcSpybEeEVVkhHpVkz g00sGp6nRGMkZssXtUO3FaMicVVdOapM3jIrFeKjKDNTkUmzNO5pGViJYzUirUgUCg4rCb1JlK+w qjFOLDFRl+KbuzWVibXBjkcVA5IqaoZBVJG0LEDmq7VO/WoWBzTOqC0IqOaftpCtRJjbGbqXOaCu KbWTJEam4pxoArKQCAc0Gn7aaelZvUm43OKN9MPFN3UuUqxYD8UxzUYakZs1DiFhrdKhc4qRm4qB zSSNEhpppp3akxQ0aIYaYakIqNhWTNIjaTtS0hpM0RWYfMaKU9TRXlN6iPQlYVMrDFUw2DUyv8tf Zwkc7vctI2KUyVX34FMMnzVupEbstK+6pscVUjYAZq0rZFaxZFR9B6njFSoMGoFPNTr61o52Ry1J WJc4FMZ6aWpuQahVDlch5OTSqKRealQCtFIm45RUgyBSACngcVfMIaXxSrMahkyKi3c9apWZSRpp ccVOs2TWXG3vVhHrCcV0MpxNWN6nV81lpLxUwnxXO1Y5J02X2Ix1qrIcd6ia54qrJc570o3IhTYs 02O9UZLnB602ebPes+RyT1rphG53UqNy20+RURbcaqbj61NG1aWUTsUeQsRJmrIiAqCN8VP5grGp U1M51nsMZaZT2fimE56VzyZlzXI3bioGfFSSHnFVpGwaIs0gh4fFSLJVPfUiPzVuOh0cty2zZqFq cpyaUgZrJuxk42ICtJtqRsUw1DYrjGPFQsalcGoWBqdBx1EzSioixFIXxQaqNybdUMjU0tTSc0rG 0YWGsM03bT+aDUtmnNbQj24pCMCnM2KYXFQybMaVqNlqTdSdazdw1RHtp2KdilxWcncTkMPFRsak aoWNQCI3NRj71OY03vQ9jRD8U2nZzxRis2xkLCoiDmrJXNRsvNK5SZDg0hFSEcU3FS5FJjDwKhNT N0qI9ag2ghuKYxpzGozSNSJutFB60V5b3JudrI+2QinLJmorgjfmo1fBr6unPQUoXLwk+WkU81Aj ZFPU810KRg4WuW0erMTVTWrcPWr57HLNtFheoqVjximsuADUbvQ5cxyVLtjt3NKDmoQ3NODYFPbQ wasWEbmrCMMVRD81KsgFdUdi+UvZFKelVllqYEMKTdjKRFKeagBOamlFQY5q4y0KT0J0bipPMqvm jNJ2KirlpZqf5pqkCcVICTUNIHBExlOKheQ0oGRSFeKjQSiiu5PeoSm41Oy5pyRitFJI3i0iv5We 1GzFWyABVeRgKTnctvm2Gg4p3m4qEtimls1nIwlAn82jzar5xSF6hq5PISO/FVZG5pzNUEjUkrM6 KcBGfNPRuarM9PR61vodfJoaUZp5biqsb8U4vxWElqc0qbbFkkqPfmonbNM3YqWtBOmywWyKjbpT A/FBOazaCMbEbGm1JtBp6oMUnKyNOaxCFpdtT7RUb4FTzAp62ITxUbPTnNVnag3jG4rOaiLnNMZq bnHSg15bIk3Uobmoh1py1jJmckTg5FOqNeKfmsWY2GvUDdamfmoytIaIGFMJxUzLVdutJ6miHBqe DmoVqQGs2VYlqN6XdxUbNUsaRG1NNKx5ppNQ2UkMaozxUjVExpG8BjU2ndaCMCg0bK560UN1ory3 uTY62Y/NUOeakmYHnNQBucV9FSndFFqNs1PGRmqKNg1ZjcV1qRElcvpVmNsGqUcmQKsxEGnc4akd TRBDx81Xb0oVjikPWqhI46i1BacTURbFG7Na3uYuNxd/NOEmKiYgUm6umEtDRFxJcmrcb5FZaNzV 2JqJMzmrlhhUTU4uKhZxUJszUbClqVeah3ZqVDVOVjTZEw6U5QaatSA4rPnZHMxwGKGGajZwKZ5m am4MeVpMYpC/FNL8Urk8zQkj8YqlITVl+ahMea0hI6KdTQr80fWrBi4qNo8VUpJmnNchzTGansuK hfIqLlKNxGcVE7A0x2IqMtWkUddOCQvenpTO1SKOamVi5bE6U9ulCLTiBisHM5m9SBuKYWqR+tQt QUkG6ng81EelAfB5qGTKJZWn5xUKsKcXFYtGXKxxbAqGRqC+ajY1JrGFiFyc1Xc1YfpVdhmqudUH Yhxk04LTgtSqtRKRM5EQQU4LUwWggVi2c/NcjApaUikPSpGFIRmjNGahgNcDbVR1q4xzxULilcqJ VPFGaV+DTM0jVD91ITxTQc0E8VmxoaTSGgnNITxU2LI2NR4qRhTDxQaJiAUjU6mMaRSK7daKG60V 5b3GdCZdwpoPNVI5al317dN2G2WQ1Sq9VA/FSK1dkZEl+OWrcMuDWUj4q1HJgiruc9VG0jblpSao RTnHWp/NGKUWcE1ckc8VHuxRuzTCc1tCRKj0JQ2Rim5qINTwc10qVgsTJzVpDgVWjFTA1Mpamcib fUTnNBIqNjQpEocDg1OjZNUi+Kkjem2No0UOafuqsj08txUXMhzNTKaX5phkGatFKI9iRUe6kZ8n FIoyaLA42RMozUgWkQYqSocjPqRsOKgepnaqzGp5jaAxhVaRc1YPNMYUczOmJSePmoGUg1eYc1C0 ea1U7GsaliuvFTRmm+XTwu04pSkU6iZYUilJFRA8Um6sTK12I/JphFOzmjGaVzaNiFlqPpVkrUbJ S5itBgNLuNIVxSUm7k8qFLU0nNNZj0puakEKaZilHNOAqZMdxm2pFWlAz1p1Yt3M5NsaRxTetOJp vSoIGmmGnmmnrSuUhpPFNJxSmmPUssXdTGpuaUHJqRpETioCOatPiqz8Gg0WwwHFDGmk0gOTU2LS HCg8mig9KhjGEUxzink1C3JpIuImeKa3SlzTT0pGhEetFBory3uBcV6lR6pq1TI1etGQFxGqUGqi NU6tXTCZFydWqdHxVRWqRTW17mclcvxyYqdJqzlapkeqOeUC+JOKcHzVNXqRWq4sxcSx2zSocNmo 1apK2UiWrFxOlSAjFVVk4xQZPele5k4lgtzTWfNQeZTS9VEnldx7E5pynmoNwNOV6tltF5Hx1qXf kVQWQ1IJeKlIycCwz1EXNRGTJoVua1i7LUtKyJVyRVhBUS4xUoYCs5SuZydyYHAoZ8VCZARTGfis 2xRgPZqbjNQNLzQJhSNuWw9hULtih5RVd5c00VG48txQOah3Zpyk03IbWhLsFIVxSB+KC+az5mZ6 kbDmkpzc0qLk07m8ZChc0u3FScAVE70m7lXdxrHFRM2aR3zUdI2VrajzzTCOaUA5pdtQ5C5kREcU bam2Um3FQ5k8yItnNOC4qTbQRis3IjmGUUuKMVNxXIyKYTUrCoHODSuUncM5pjUFsDNNJ3Urj6iZ oNJ0pC2aCiNqaCQaewqM8VLGgduKgbmpGNRkUGqIyM8UqrTsUHpUtljTxSFsClaoycioGkIxqM9a cetGKDRaERFIaeaYelSUR/xGikPWivMe4rCqcVKrVDTlNd6ZbRaVqmQ1UVqnjat4yMmi0OlPU1Cr VIprVSM2TK1OBqIHFOzmtoyJLCyVKr1UU4qQNWqZm0XFfFSiTiqKtzT95q0zOUbl3zKXfmqiyE1I G4q0zJqxNu5o3elRbqUGrTFYl3Zp4PFRrUlDmQxc4pN5prHFRF+KpMaiTGTNPR+aq7s1Ip5puQ5J F8S8Uxp8Cq+6opG96hEKCuW/tGO9BnzWfu9zT0JJ605JGvLYstJmo95FIORSYyalWEtRd7HvTlQk 0InNWkTApN2CTsRBAKa/y9KncgVSlcCpTFG7Avg05WzVUvzUsb0MpxLKjNSDgVErihn4qBRix7yY qs7013yaiLVZ0RjYfnJp6jNQg1Ir4NZTZM72LCoKfsqNJOak8yudtnM7ibRSYFBcU0vS1BXHHpUT HFDSCoHl5osWosdupwOag3VMlJodgIqtLVo+tU55ATipTLiiFm5xS7qZSFqZpYVjSZpC2eKTNMLD ye1RmgtTC1QykhaYeDSk8UzrUXLQpPFMalpDQWhh6UwipCKa3SkNMjoNLSGpLGmmmnGmGkykQt1o obrRXlt6sYUClIpK77jHqamQ81XBxT1arjIhl1XqQNmqitipletUyWizkU5WxUKtUg6VtFkMkDcU 8NUNKDitoskn3U8HNQA808GtFKxLRYWpAcVArYp+/NVzGMlcmzSqah3Y604GmpE8pYD0/wAzAqru z0pBJj3FNkezvuStJzUJkwaGOelRNVplxiTq3FSo1U0ap0aiUhSRb3ZGKjcUq08jNSpGSIQvNSqo pKXcBQ5F3HYFOCioi9PVxSuLoWEQYp5YKKhEox1qKSX3qb3ISbY6WaqUsnNJI5JqAnNaRN4RSHA5 qZDioVqVKUmWycNQzcUlIai4k1cYcmm4xUuBTGOKXOXzDDQHpjNUe6lcRZEpFL51Vd1NL1NieQtG ajzc1WB5pwNHKVyokaSoi/NNY803vSsgSJUOTVkNtWqqELQ8pNZSQOJJLccECqpJJoPJoxUtWBKw 0nim5NPK9zTTQmUkNzRzQaBTHYac03NONMPWoY4oUmmmlorNl2EpD1ozSE0hoKYxp2ajbk0DQ2kN KeKaTSLQh9aaaUmmnpUspELck0Up60V5j3KHUhFLRXeITFKpxSZpM0ATK1SqarqcGpVOauMhMnVq mVqrKRmnq1bKRm0WRS9TUQfinq1aRkTYlANOpVIIp1aKYmAalzTAMUua0TuQSbs09WqHvSirTQWR Nupc5qLNKDTuJjyaaeaM5pCaakTYVQKsxrxVdKtIwxxSciJIlUYoLUmaYzVKZnyaiF6jLkGgmmZB q7mihoSBqeGqIA08LU3E1Yk31GxpRTGpXIRG1MpzMKj31fMzWKY4cVKjVDup27FQ5FNFjdijzKrl +KbvpCUSwZKYz1FuoFBaiBJNJT+Ka1K47ERPNJupWFRc9hTuUkiYHFLuqDOOtHNK4miUtSbs1GTx Td2KVxcpPupc1XDVKDmokFiTFKAAKbvFBbNZvcmwjmoGanu3FQE5oLSHDmnimLT6VxyEJ4qM9aea Y1SNISiiipYxppKU0lSAhPFRmnMaZTRSQhNNNKaaTSKEprc0pNNqWXYjPWig9aK8x7jHZpDRRXaJ IKKSlpoYDrUitio6M80xFkGnKarq1SKauMibFgcipFOKgVqkU1opEstI2Kk31VD08PV3IaZZzQMG oRIKcHFapkWJh1pahElO3Zq0wsPzRmmbqcDmq5hD80Zpu6lBzRzCZIpqVTVYH0p4lxRe4rFkSU0k HpxUBkFAfNNXHYewOaaOeadmkzjpTuFx6tUobAqruIpPOJFBDjctFsVC71AZs0wyE0WHGl3JGamU zPNKGpm3KPzS5po6Uh60mJxH5FGeaizRuxSFy2J+tKOlRBuKkDcUrhsOoxmgHNSoBSciZSsReVnr QYeOKsgKKGIFQ5My52U/II60x1CjirDyjpVZz1NCNINvchamGnk5PAo8vuaq50cthgbvR5vFOYCo 9tSFkSK1Sb6hFKelSyGris2aZ3ooBxSGOHFLmm7qN1SKwp5ppFLuppakxhTSc0pNRk81I1EU0hOB TSaQmkUoiUhoJpKCrAaYwp9IRSKRHimmnsKZUvYYyiiivMe4ri0mKWlArtGJRS4oxTASiiimAA4N PDUyihBYsK1PDVXDYp4erTJsThsUu81Du4pQ1axYmidXp4eq4NPBxWiZPKWA1PDVXDU8NzVqRLRO DxTw1QhqcGpXIaJc0uai3Uu6mhOJLuzSZqPdRk007DUR1AYjoaZmjNXcqxMrkU7dmoM0oai4cpYB 9RQVUiohJmgv2ouRysGQVHTy2aTiquaKNhlKKeFHpRgUXLG/jRmlxTDSbJaYpPFNJxRmg80XKumG +nK2eajpc4pE8pOsuOlSLIT15qstToDSbIlFEwc9qaxPrQOKQnisnuZ2QxsevNQkU9zg1Czc1UTW ERWIoBptLmmbWA9aaRR70hNJksWmk0bs8UYpEsTNLQOtKam4hDTcmg+tJU3KSFJ4pKKKQmIaYelP PSmGkUhtITS008g0mUIaSiigpIdnikpKKQ2hp6009acaaalgRHrRQetFeY9yB9FN8wUbxXXzx7lD qQ0m8Um4U+ePcB2KTFG8Um8Cn7SPcB2KQjFAkFLvWlzx7jQAUuab5i0bxRzx7jJM05WqAOM04OKt VY9xOxYDc04HNVw4pwkFX7aHclosg04Gq4lXFOEq4qliILqSWd2aXdVfzlFL5wqliKfclxJ91KrV W80CnrOo60/b0+4uUtpzUuDVVbqMDvUn2yP3o+sU+5aQ89aZmmtdRn1qMzp71SxFPuOyJtwo3VD5 wpPNFV9YpfzBoT7qXdVfzVpfNUUvrNP+YRZyKUHFVvOWl89aPrNP+YVi1uo3VV+0Cj7QtNYil/MN IsZpMgVCblcUnnqaPrFL+YehLmmk1H5y0hmWl9YpfzCJc0oBJqETLT1uUHrR9ZpfzCZZRMDrUmQK rfa4x60hu0PrUvEU31MnFstbqjZsdarm8XtUTThuppe3p9wUHcnd8mo81H5q0eatNV6fc3VkS5pa h85aPPWj29PuCJCeaSo/OXNHnLS9vT7j0JKXNRectIZ1pOvT7iaJqQmovtC0nnpUutT7kWJKKj85 Pegzp70e2p9yh5amk1GZVzR5q0vbQ7k2JKYetIZlxTfNU0e2h3CzH0h6U3zV96TzVpe1h3KihaSk Mi00yCl7WHc1uOJpKb5gpPMFL2sO4rjqD0pvmCkMgqfaR7gMPDGikJyc0VxPcmx//9l= ------=_NextPart_01C8E823.DA10E9A0 Content-Location: file:///C:/8E69C634/Classof2004_files/master04_image004.gif Content-Transfer-Encoding: base64 Content-Type: image/gif R0lGODlhxQAJAHcAMSH+GlNvZnR3YXJlOiBNaWNyb3NvZnQgT2ZmaWNlACH5BAEAAAAALAAAAADD AAcAgAAAAAAAZgI1RIynyesNn4x02oqvznz7Dn5iSI5miZ5qyq5uC79yTM92jd96zu9+D/wJg8Sh sYg8KpPMYQEAOw== ------=_NextPart_01C8E823.DA10E9A0 Content-Location: file:///C:/8E69C634/Classof2004_files/slide0104.htm Content-Transfer-Encoding: quoted-printable Content-Type: text/html; charset="windows-1252" CHSAA Hall of Fame
CHSAA Hall of Fame
nThe Class of 2004 includes Ray Lutz, Jeff Rohlwing, Fran Sixkiller, Sally Stewart, Anita Stites-Rowland, Scott Stocker and Dennis Teeters
------=_NextPart_01C8E823.DA10E9A0 Content-Location: file:///C:/8E69C634/Classof2004_files/slide0107.htm Content-Transfer-Encoding: quoted-printable Content-Type: text/html; charset="windows-1252" CHSAA Hall of Fame
CHSAA Hall of Fame Class of 2004
nRay L= utz (Colorado Springs)
nJeff = Rohlwing (Battle Mountain)
nFran Sixkiller (Lyons, Longmont)
nSally= Stewart (Greeley Central)
nAnita Stites-Rowland (Plateau Valley)
<= span class=3DBB style=3D'position:absolute;left:-4.21%;top:.22em'>nScott= Stocker (Rocky Mountain News)
nDennis Teeters (Grand Junction)
------=_NextPart_01C8E823.DA10E9A0 Content-Location: file:///C:/8E69C634/Classof2004_files/slide0108.htm Content-Transfer-Encoding: quoted-printable Content-Type: text/html; charset="windows-1252" CHSAA Hall of Fame
Ray Lutz
(Colorado Springs)
nA longtime foo= tball, basketball and tr= ack official for over 30 years,= Lutz has officiated over 2= ,400 varsity contests, 1,000 sub-varsity games and nearly = 500 playoff games in football and basketball. He is a life-long official who has served in a number of capacities in various officials’ organizations and he has been a mentor to many younger officials. He has worked six football and 12 basketball championship games and as a state meet official in track 20 times.
<= ![if !vml]>
------=_NextPart_01C8E823.DA10E9A0 Content-Location: file:///C:/8E69C634/Classof2004_files/slide0108_image005.jpg Content-Transfer-Encoding: base64 Content-Type: image/jpeg /9j/4AAQSkZJRgABAgEAyADIAAD/7QE6UGhvdG9zaG9wIDMuMAA4QklNA+0AAAAAABAAyAAAAAEA AQDIAAAAAQABOEJJTQPzAAAAAAAIAAAAAAAAAAE4QklNJxAAAAAAAAoAAQAAAAAAAAACOEJJTQP1 AAAAAABIAC9mZgABAGxmZgAGAAAAAAABAC9mZgABAKGZmgAGAAAAAAABADIAAAABAFoAAAAGAAAA AAABADUAAAABAC0AAAAGAAAAAAABOEJJTQQAAAAAAAACAAA4QklNBAIAAAAAAAIAAFBIVVQINQAA AAAARAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAUEhVVAg0AAAAAAAEAAAAADhCSU0EBgAAAAAABwAHAAAAAQEA//4AJ0Zp bGUgd3JpdHRlbiBieSBBZG9iZSBQaG90b3Nob3CoIDQuMAD/7gAOQWRvYmUAZEAAAAAB/9sAhAAB AQEBAQEBAQEBAgEBAQICAQEBAQICAgICAgICAwIDAwMDAgMDBAQEBAQDBQUFBQUFBwcHBwcICAgI CAgICAgIAQEBAQICAgQDAwQHBQQFBwgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgI CAgICAgICAgICAgICAj/wAARCAJpAaUDAREAAhEBAxEB/90ABAA1/8QBogAAAAYCAwEAAAAAAAAA AAAABwgGBQQJAwoCAQALAQAABgMBAQEAAAAAAAAAAAAGBQQDBwIIAQkACgsQAAIBAgUCAwQGBgUF AQMGbwECAwQRBQYhEgAHMUETCFEiYRRxgTKRCaEj8MFCsRXRFuHxUjMXJGIYQzQlggoZclMmY5JE NaJUshpzNsLSJ0U3RuLyg5Ojs2RVKMPTKTjj80dIVmUqOTpJSldYWVpmdHWEhWd2d2iGh5SVpKW0 tcTF1NXk5fT1lpemp7a3xsfW1+bn9vdpanh5eoiJipiZmqipqri5usjJytjZ2ujp6vj5+hEAAQMC AwQHBgMEAwYHBwFpAQIDEQAEIQUSMQZB8FFhBxMicYGRobHBCDLRFOEj8UIVUgkWM2LSciSCwpKT Qxdzg6KyYyU0U+KzNSZEVGRFVScKhLQYGRooKSo2Nzg5OkZHSElKVldYWVplZmdoaWp0dXZ3eHl6 hYaHiImKlJWWl5iZmqOkpaanqKmqtba3uLm6w8TFxsfIycrT1NXW19jZ2uPk5ebn6Onq8vP09fb3 +Pn6/9oADAMBAAIRAxEAPwDUt/303/7HHJQonplxEYThtBfhvRRTziH8p/5xnb4c9XqZsR/6a3/J FH6+znq9Tzh3+8I56vUPGS/+SB9fBxQfoTcu5b/ltfbnq9Q+/wAs/wBbgxr1PWG9j+vhz1epY4dh v+n/AEePDevUssRw38vDnq9SNxHseer1M2HeH80vz1ep5xH+VYbX89XqR2Jdh+vhwor1BlmL/eD9 fZwpr1AFiOG/6f8As4SV6mrEf+Sgv1fwPK53Wq6/37/ru4QVqnfDex/Xw4IatQyYd/vd/KeHdep5 w7Df+mpw2r1e/wCSbiHhz1epZZdxLxt9A56vV7EcR/mP7eer1exHDcJ+Qtf6+er1A3nPLf8AoF/4 8Ka9SL0/5JPCSvUjcQ/5J6/r489XqDjEe5+ngeqtDDkzEv8AQOCGrUJdf/Rz1epnzF/ziPr56vU8 Zc/e+v8Abz1eoTMu/wC+3h3XqGTLuJf6Bw2r1CXh2JfzL+TezhvXqef6t/yz/nLfRz1ervnq9TJi Pc/Tz1eoNcRxL8vHnq9TN/LR7f4cKK9SNxHDfh8L89Xq9/LP9A/X7uer1e/5Jt/y56vUssO/32nn q9Ttw3r1LXDv97hz1ep5zFhv+ge3nq9SNw7Evh9fPV6hLw7Ev7uer1dYl3H6+PPV6mnnq9X/0NPn kz0EK7H+/I/79MW56vU9/wC+nnq9Xv8AfTz1eoYsu5J/mZwbFsU56vUMH8tHt/hwcUH6WeXcN/6a h4d16h9w7Df9Av4+zhtXqecOw36hw3r1LKg/p56vUssRxL/QPhz1eoG/5j/p/wC3489XqZf5b/p/ w789Xq7zFiXPV6mbDsS/mP8Avo+vhRXqRuI4kfn/APfp48Ka9QZYj/Kbj2+P38JK9QO5jxLCfn8G 1t+p4Q55srVc/wDkm4h/0xuN0IaWH9ZcpYbQf79M2UPt45/PBW6ZsO6tZT5v+3H8upj+R5nQy4bn bCsS/wCSpiv38JP7cddHn8jp4xHMuU/+cXi1+E39t6Of5DQa4hiWa/n/APfXiv8A5Lee/ttmNe/k VMuHZ2zXhv8AzlaHGvr57+22Y17+RU84d1s/0/8A41GE/wAl8ODP+29E38ioS8RzLhWJUH++o/zv 4nh5/OqJP5JQZ4j2P0ctRJXX8ywnDaD/AH6c9XqB7Ef5Tf8A5EeB6q0MOXcN/ltB9OvBDVqduer1 ZMR/35ft56vU84diXw+vh3XqecO7j6eer1DLhvY/r4cNq9QlZc/e+v8Abw3r1LL/AJH/AKuer1PO HYb8L/Hnq9XWJdx+vjz1eoNcR/32256vUx89XqSGI/78eFFepmxHw+vnq9XsM/e56vUsv5j/AKB+ z489XqecO7D6Oer1LXhvXqV/++nEsB56vUjf5cfYeer1PGHdx9PPV6nn/kf+rnq9U/8A5GR/xE/8 rc9Xq//R0+sR/wB9v++nC9OTPQQp5/ln8twH+tmJ4tQ/7/sS/qtz1err+ZH5/wD36duFH8irdd4f /KPkMG/3u/nP8z4b1qhjw7Ev5kMHwnwwHhvQdoYf5d/p/BDVqGXLuW7UHBjXqGT/AJEPr4b16nbn q9T5/wA5D9fZz1er38y/1uer1M2I4b+fhz1epG4j2/lPPV6mbD8N/wCcRiY+FuFFepG5ixL+W89X qJ11l9R2VMOrjhOE4rutqbeHIvz3PaO8kyWKJrmLq1mvEv8Akl5srv8Ax58jTO99po7yPI6ecu9W sX/5ymLafXzX87zKjn+RUJQzHlPEaHGcJxTNld/JvD+sWJcIq9Qa4dlvKeJf89Z/Jeer1DLkzJP8 tr7YX89jeDc9RvRrsOw3FfkL/wAp/wB83hz1FFe/luLDXC/98v8A4MXPUb0z4jnbFst1/wDKcTwm hxr489XqRmYs7ZTxK/8AK8V56vUGn9dsWw3/AH7f6DjXPV6hLy71Iyn8/wA9RRSyznmT/fBjOLYX 93BxkeeUT/yOibYjnb+ZaYpi1dbhznmeV7I6aDiXbCcL/wB/Xt4DKN6GPJmdv5b/ACa+Lfzr/u3d ea/neZVv+RUPuHZkOJUGg57+dV7+RUssRxLF8MoP+m19/Bp/PKJ/5HXLDv8Ae/8AX48Gn87opoR8 O7j6eDSg9QmYdiX93PV6hLy7/vtoP9+nDevUJZxIYlX/ANHPV6mb/km4h4c9XqWX8s/mVB+d+er1 BpmLDbeH9nPV6kbiPY/Rwor1I7Euw/Xw56vVx4b16u/5YPafv4UV6nrDuw+jnq9Tx/yTeG9eoSsO /wCScPp56vVyy73+v9nPV6uv5afb/Hnq9Tzh2G/y2v56vU8/76P5h+ve3PV6on/IyP8AiJ/5W56v V//S0+cS/wCc3yZ6J6Z/5li2G89RRSy/q238h/5K1Dz1ep5y7/vt/hz1eoScmZb/ANP/AJtw5yKg 9Q+4d/vf+vx4Oq3Qx5dw348Nq9Qx/wDIh9fDevVx56vUoOer1Y6D+nnq9Tz/AC4+w89XqDPEf5Tf nq9QC5z6/dJ8lUAGKYrrwHZ5nmW5dWhkVV19ZvUhmzqRiH8qyv8A75cG5C+eb8UNxuSKJzmDDsXB BxM6+HAORQvIpj4U1unvDuw56vU8f8lLnq9QmZNzHiuWTbCun4bGP8WYL2P3gc9WqGT+uvqEw3/k l4Tz1boSsmZJ9QeZKD+bYpmz+S4Nw3r1LLMXRTqH45s/9SLEhz1epG/1bwnLf/JU6hfzrnq9QBZi zJhPz/8Avr4UUIqRuI5k/wBA56g7TN/MsW+f/Lnq9Tz/AF2zZhtB/wBib28N69TNh2dv5bX2xTCf 983CivU84fiX9ZK//kk8N6KKef8Akm1+M/yv/fLz1G9DLkzMmLYb9Hx56vUZXLuZP5jQf768J/kv s56vU9YdiX8tr74p37EDko5HnlA/PMjoZMO/35H/AH19+DTJKKqEnDsN+Fr+PBpQeoT+G9eoR8uf yn5D/kk89Xq9iOGnEeer1ew7Ev5b/Tz1er2Yst4tiR/m33Hnq9Qafy3/AFeer1I3MWG/y3nq9TNh 382uPp4UV6nkYlhGG0F/489XqZsO/wB+X66c9XqEv+ZYSf8Akqfn9/DevU85dzt7f981uer1LLDs S/0+3h7eer1df8iH1c9XqWeXcNv/AMlT6Oer1dYjlvx+vnq9SO/lh9v589Xq/9PTh/mf+n/r9/JQ onp456vU9YjiWE/75v5Xz1ep3y6f5bXD8+C/IqKaNbl3Df8AQPbwQUHqWf8Avp4d16hMy74cNq9Q lYdiX1jhvXqWX/OQ/X2c9XqZsRxL/T/o8Oer1ew7sOer1CViOI4ThtB/Tz1eqor1U+qL+ZfznKeQ +w/5iXkNb8b8UeZJklVqfzL+ZeHx5C388FDOmX+ZD2fw4TUb08/zEe3nq9SM56vU9fzIez+HPV6n n+Yj289XqEvLuJD/ALCyu56t/wAjoy3SrLeLZk/30jCccHPVqjX4d03xbDaD/ke/8F3hvXqBzqJm T+rVffC8J/kvtB4UV6i0YjiX8xr/APkrV1u1+er1I3+W4R/01eer1ew7Lf8A4+e/PV6h+w3pv/oH +/P8+eoRUAP8u/ltfjP389QdpG4jhv5eHPV6nrDv5Thtf/2OfDnq9RlcmZb/AK7UH82GLf10/wDL 7z1epZYj0T/3w4MMLwn+S89XqecmZk/q3/vpz5hXPV6llnPDcJ+f/m2F4t/vm4b16ljh2I/y3+T/ AHfnyacioH53toy2XvD9fDkoZFQIpZfzEe3hvW6WWHYl8NR489XqWfPV6nj/AJKPxvz1ep6w3sf1 8Oer1IzEcN+H189XqDTMH7v18KK9TN/Lf9A/bz1eoNMR8Pr56vV7nq9Szw7sPo56vU84d/vt+HPV 6ljh3cfTw3r1CXh2JYT8he31c9XqecOw34Wv489XqesR7Hnq9Tz/AL6f5Dz1er//1NPv/kQ+vkz0 EKZcOxLx+8cKKN6WWHYdhP189RRQk5Mw3/QPp8eDDIqD1GVy7/vB/Kb8HVbpZYdhv+n9/r56vUJe GfvcNq9Ql4d2HDevUzYhiX8tt489Xq9h18S56vU8/wDJNoPHnq9RBvVV6kP5bQf1Tyv/AMlnHvby NN+N+KPMkySqoswgmvUD/kj4DoBzHzO6GdMv/Ih/yPduE1er2Hf77Tz1erjz1epp/wCRD6+er1LH Eb4lXg/yn+S/+C7z1er2HYbi3/TJ+s89RvQ+5My31C+QOLf5va7+TeJ5s/zOvUa/p3ndcN7/AD2D Yz/3btuarf8AI6Nfh2JfzGg/5Hvq56tUDfUTpvi3hz1eoqOI5b1t7NOFFCKmX+rfb+af75fiOG9e pZZMyTmzEq//AIy+E89XqGT/ADb5s/ql/v0xX/fzz1eoqOcsMxa2Mfx5401ndBniWW8Ww2g056iK mbEf5thv/OJ+s89XqEzJmJYT8h/v0+ewX/u4su89XqNd0p6kYthtB/v1zZ/O/wDwYuer1PX9ZMp5 kx7+UYp/vl8deer1DHh2ScWy1QXwvFv51k3Huer1ew7Df+SNhJ+vg0yLPP5fRRntD9lzDfjzITIq i+hJ/lv+rwX1ullh2G/Weer1PP8AyTeer1LPJn+/LXnq9XWI4l/Lf+cT3789XqRuYsSwn/kq4Zwo r1JDhvXqReI/73/r8Oer1IzMWG/6fwor1M2HYb/p/b4W56vUJeHdh9HPV6lj/VrhvXqesOxL6jz1 epZYdhv+gdvhbnq9Syy7/vt56vUsv+cf+vt56hFSL56g7X//1dMb/kf8O3Jn/kdEv/DKnvL2G/zK hxnFu+DYDwoq1LLDv5T8/g38r4b0UUZXJeWsJ4NskoPUMeHYb/LP48Pa3Swy7/yUPq/Zw2r1LLDP 97j9fPV6hMw7/eEcN69TLmLt+vt56vUz5d/328KK9Ra/Uz19ynkqg/lAxW+NeAHfhLvxnn8uo8yT JIqm7MWZP6yY9/Nu/MYs7zuhnTz/AL6f982LYXi1d/Of+el4TUb0jf8AvacN6KK7/wB9WHUXtJ+/ hRRtXDnqKa5fy0e3+HPUb17DsN+oc9XqH3LuScKxKg1zYcFxn/u4sN57/hXV/wDhlRlv6k9V/wCQ /wDGX6hfzrnqpSy6d4l1CyT/AMlPhvXqMthudsp4bgPau/nPPV6i05z/AJtiVf8A8j2vCihFQa/1 b/0/+VYX/wCo7woo2oZMOyThP++b+tGE/wA6/wC7d56vUa7JmSc2f75v+Mn/ACXBu/CSt089RMt/ 77/5Rhf++Xh3WqrTznkn+W1/+/T/AJLP/PNZi4b0U0jsu9R82ZJoP5T/ACmhxr/u3cxYbz1er2Xe pHT3EsetmjKf8l+PPV6jw5M6S9J87Yf/ADbpfi1D/wCC7z1epl6idE8p5b/37YphP8l9n9XeG9B2 gbxHJPSfMn/PWfyXGf8AnmsxcKK9Tzl3/OFlvAf+Mvmz+dcN69XsudWsJzIf6p5o/wB8ucjz1eoy /Tvq1fHv5Tin18lDcffigfnmR0cbLuJYTiQ/318mmgTSy/lv8t/s4b16usS7j9fHnq9XeTP99uIc 9XqEzEex56vUDeYu/wBf7Oer1MmHf7wfr8eFFepnxHDf9Ptf6+er1M2I9j9HPV6mbDsN+oc9Xqec O7D6Oer1DJh3/Yz4b16vYdhv8y1/Lnq9Syw7Df5b/C3PV6nnDsN+oc9Qip5/5JvPV6vfP/8AIz4j 3fv156g7X//W04eShQQrv+ZYthuH4z/K/wDnPeI56jehI6d4b/p/0duC/IqKaONh3+8I4IKD1LPD u4+ngxr1DLhvY/r4c9Xq9hvY/r4cN69QlYdhv+gWv9fPV6mb+XD2c9XqAT1M51PSXIeM4vhf/JZ4 UZ5nn8urWRVRJmLEsWzJbFcUxX6uYk53nRJgVKGR0x8Ja9T9lvEsUw7Hv+M1i5wTGfDMS4j/ACX9 o5qjauH8y/6an+/rGe+vN0U08/y3Fv8AfN/NMJ/kuDc9RvXsxDCe+F4v9X8s56vUz4d/KR/zia7X vz1eoY8xfynMlAP99Ndgvt/rFwor1M2HYb/p/wDKf5tw3r1GXyZlvCstn/fpmyu56vUPmXck4TiV gc2c9XqGT/NJi3/YWV3/AILvPUIqBzOeWzhv/OW+vhRRtTNh2W/5bQD/AJwvPV6jj9GcNwnLf/JK yp/OsZ4SUcVZX07y3/MqH/jef75fbl3hDRxROPURkn+W/wA5+PiOHmS0UZ5kdVp5zw7Fv+cpw9om otWYst4tri2F4t/yQfZz1FNI3+Zf9NTCeer1PGXcyYTluv8A+R7BfZmHLnDeg7R+uneZMW6kYD/K cL6hfzrnq9SNznkjFsuV980dJ6HGv+7iy7z1eotOHYj0nw2vxnCcUxauwXnq9TNnPLeLYl/v2yvi 39dP5D/z0WXeer1PPRrqRi3z/wDVPNH/AKkR57I69Vo3RnMeK4Z/vpxTx5k5uPnlA/PMjo43/Ij/ ADb8/Hkl0Ca9/wAiXPV6vYdh3fFvr7c9XqeOer1exHLfj9fPV6kdiOG/D6+er1I3EcN/0Dv28eFF epG/8lGv8dOer1e/lv8Ap/7Oer1LLDu4+nnq9Syw7/flX8N69Syw7LeLD+c4rheE/wDJB/5iXnq9 Syw7Ev8AQO31c9XqecOxLCfA/Vz1er38t/1eeoRUzfIf6f8AK+33vu0/bz1er//X0+v5b3/lfJno nr3/ACUueoooe+nWG/zKvH++m/DjIq3RrsO/lNv5T4+PB3QepZf8k3htXqEzDv8AeEc9Xq9h3YfR w3r1CViP++2g56vUjf8Akm0H827/AB56vVSx6qupB6kZ9/lJ/wCSNgPIA7VM8ob5HRUB/KfkMY5C 9C+vYZiDYeVXEcHomwhtFXMOpP3c9RRTN/Mh8/8A8kmhvz1G9O+Hfzb/AJxdueoop6w7EsWw62Ej 6b89Xq9b/sbUPPV6nn+sn+gW/wCcNz1G9GXyZhvT3MlB/v0/3y/H+Zc9XqeMxdJcp/8AOLxb/fNz 1epm/lv8toP5r/Wyhxr/ALtzMXPUIqEzJnUjCfn/APfoKHBR7Oe/nleoy2Hf5vcS/wCSX1C/nXCi vV7+reEjEP8AfXi38556jajKdKugGE4lX/79f+cD4cJaOcjyOjw5dy3hOW/+YXwn+S8D9Dmh9y9h v8twH+bZo/39Yz24U1qib9RP9+VAcJ/5w3e3Deg9RBuquW8Jw3+c/wAr9nBzRRnlE3/q3hOJf8kr /ks/9g7z1BCmb/NvhGG1/wDv00wX/sIuG9er2I9E8W+Q/wB9f+/rBhz1epmy7lv+pFf/ADb/AE7B cG56vUJf/NwsNr/614Xmz+dZN/8ALRz1B2gb6iXzJQfzbFMJofacxHnqEVAFh382y3X/AM2yvi3P UHaWX8y/5xOKf8lkcN69RyOjOdv6yUH/ACVv5LjOA8PcjzuijPatf6MZkxbEqD+U4pzJvI6CNCTi OG/y3+jhxQepm/5Jt/y56vV1hn+9x+vnq9T1/Mv9A56vV7DsS/u56vUjc54b/oF+/wAOer1AFh2I /wCn+08KK9Ttz1ep8w7/AH5X4b16hky7iX8sr/489Xqev5kPZ/Dnq9Sxw7EcJ+Qt4c9Xq4c9XqfK D+nnqEVRP+RgfQeer1f/0NPf+W/y3/kmYt/Dk0UC/wCdUtcmYb/Muap2jWZd/wB9vJToP0MmXP8A e/8A36X4bV6ll/Lf5l4dteer1CX/AC4ezhvXqecOw34/Vz1ep5xHufp56vUAfXbMmE5byHjOLYof 1twoz2tVRJmLMn8yx0e3w5iRnmeVKFBp/Mh7P4cJq9Sy/lv+gYNiw56vUzfy3Fvn74X356jell/M sVxKgwb/AHuxrGe//Gd56iig0/luLfP/AMp8Pbz1G9PP+/bEv+cr93Pfzyiiu/8Akm8KKN6HzJeZ B/vm/mmE/R256rfzyjX4dhv/AEy/nv5Nj3BdVaZsxZbxb5D/AKbXw4UV6gc/luLfP/8AJJ4UUIqG TJn++y380xa3PV6jXZMxLCcO/wCSX/v7xn/sIuElG9Hh6eYji2G0H8p/5LX/AGEuYueoW0sc552/ l1f/ACn+bf8AJe4QUJKGTDv99uQ/hwprVAF1Uw3Fst48OG1EGebKI/mLEr1/+/TvbggomzygDznh uEYl/v2yv/znu/DqiavZMxLCcyf8ZPPn/JZ56imh8w7Lf+bev/7E3/YRZd4b0HaRuc8Swr/krf8A Ja/7uLLvPV6gbw7O2E4aP99f/qO89XqZhmTCfnx/K8W/38+GXcxc9XqecR6A5T6j4D/W3K/++Xxz Ll3nq9RUOofTfNnTf/kqYT/OsG8MxcN69Sy6M5k/0D/fX/yWcB56vVa90IxLF8S/k1/+SzzIXcfP KB+eUeDDsS1/36ckugTTNmLLdqD8uer1Iz/ft8/9fPV6ln/yUqDnq9SM/wCR/wCrnq9XsS7j9fHn q9SO/qQfh+XPV6kbiOG/yzv9N+FFer2G4l/LP4c9XqEvDu/824b16lnhn+8J+k89XqeMO/32/wBH PV6lll3/AH5V/wDHnq9T7z1ep0/q1z1er//R1LMOy3+enJnoIUJOTMN0/wCxNw4yKt0a7LuG/wCg ezg7oPUJeHYd3xb6+3DavUssOw36hz1epbcN69Tt/wAiH1c9Xq6/lv8AoH7Oer1Vqet7O2LGhwbK eF/853kab755/LqO8kqqH+XD2cxjqS69/Lf9A/6bVuer1d4diVv99OKf75b89XqeMRzJ/wA4jC8J 56vV3/LMWxKg56vUy/y4eznq9TN/LR7f4c9XqWWXf5thnPV6hMw7DcJxL/frhf8AyWTz1eofcmdS cJy3/Jv9+3PUIqH3DsSwnMlB/vrzZz1eplxHJPjz1epny5kjCcNr+/08J/5FRvRrsu5k/wB9+C4V b/fNzdeyKjKYdmTFsSoMGwnC8J/kuC+3LvANQvpHYd/xpM+f8Zf/AH9c9XqtFyZlvFsSoMGwn/pg 8KKHFFQ6zYbi2JUGM4T/ANMHhtRTRBsxYbi2Jfzm3/JZ4f0BaBvEsN/lnfnqKKesNy3hOJUA/mn/ ACWeHdar2I5kzZkn/fTin+/rBuG9FNM3+cjKeJV/82/5IuM89XqRmc8t5TzHQD/fT/OvH+sWXeeo O0AWI5byn88P5pi9dgv389/Iq9Tzh3826S/8azIebP8AfNz1epZf5x/5lX/9ibHv+ed56vUGmYsk 4Thg/rZkL/kjf9g7w3r1Hh9Kedv5lXn/AKbOnJR3Gooz6rXMu9v19vJ/oJU9Ziw2/h/bz1eoNMRw 3/T+3wtz1B2nnDv99v8ARz1ern/vp56vVwxH/sWc9XqZv5n/AKvPV6kbiOHYTiX/ACS+er1I3+WY t/i4UV6nnX/kk68N69Sxw3uf18eer1LT/kQ+vnq9Sxw7Dfqt4c9XqWWHYb9d/Dnq9Qrfy3/Rzp4j X7+eoRV//9LUs/mJxKv78meghQx5Mw3/AEDBvHg2ySg9RrMO/wB4cG+ngzrdCZh2Jfy2g56vU9Yd /vCOG9epY4bhowy+Lc9XqecNxL+Zajnq9Xs54l/LKDnq9VEvqZzJ/WTqXjP/AGIeYzdqmef8Mqk/ IqAL/ftiVB/Nv5Tp8eRjRvTLmL/kn/X+3hRXqR38u/0/hvXqWX/JN/5y3+/nnq9Tzh2ZPHnq9Sy/ q3hOJf8AJLwn+S/Twor1d/1b/ltf/Kf5T/vm9vPUIqZv5kf+STz1epZZdyTi2JH/AH2f75eer1PH 8txbLf8Azif51w3r1DL07zLhOJf85b+S4z4c9/PK9RrsvZbzZidB3/nXPV6ll/VvCf8AvS8KK9Tz h2G4TlvhJQuoScu4bmzO3++n/nDduENHFHi6M9FMJw2v/m38p4TxQ5/kVHIH8p+Q/lOF9+FNaom/ UTDf9P8A9+njrw3r1Ee6iZJ/ltf/ADbC/wDkjY9w2oppHfywYlQf79D/AL5uW/ngoPfyOkbh2ScW w2v/AJTin134e0TU9f5t/wCZUHDuiegCzF0lwn5D/fphNd/4MXPUU0DWI9NzhuuV82f7+fDhvXqD T/fvhv8AOcJzRhPxOYhz1epHf96vnqDtCVl3oDm3MmBf1syv8jz1epm/37Zbx7GcJxT/AHy4z7eG 9eoY/TvmTCck9WsI/wCmNj3BvkX/AC0qKc9q9vLuJfy3/kl8yZoI0ssxYl/zlvqHPV6mb+XD2c9Q dpm/q39H389XqZsRw34fXz1epmxH/fbQc9XqRn/JS+jnq9T1/Lf5b/Zz1epmxHDfqPPV6mnnq9Sv yX2+v9vPV6hLw7DfqHPV6nn+Zfy3+PPV6nnLuJfzLnq9Qyc9Xq//09SzDrYlX/yj7+T7QQo8GXcN /wBAHB3kVB6lfh3+9w4cVuhMw7Dfha/jw3r1POHYb9Q56vUtuer1Y8R/320HPV6g0zniP+gcKK9V H3VUfzHq1jI/lP8AOu/MY99v+WlUn5FTNmHMn8t/304XhH8lvpwF0b0keFFerH/Lf5Z/zifh9+vD evV7Df5t737eFFepZYdiWE4bQf8AY556hFTzh2ZMW+fP8r56vUJeHYbhOJf8lT/f19PPV6hky7lv CcN/5JeE8N69SzGW8J/5ymE0PPV6uv5b/wBjX/fNz1B2kb/m3OJH48KKEVCZlz+bZbvhP9bP5Lz1 G1D5lz+bYl/yVMW4SVujK4dknCfkP99WE69uENC+j99Gem5zJX4PhGV8J/3zH/novq4T55Q5yOjw f5t8JyTh+M/9NnhTRtQN/wAt/ltfjP3c9XqDXqJlv+Zfzn/fT/4LXPV6ib4jkn/T+/8Avm9vDaKK f5FTKem/+g41+3m61SOxHLf8toP9+mE/75uG+RUCc8yOmb/jJ/If768W/kv8h4fUS09f12wn/pk/ +DLw7onoG+omWuk+J/79sr/I/wDgu8N6KaDTOeG/8lnFv5R/OsG56g7RaMxZJynhv+/bC/8Aks9+ er1ey71I/q2P5tlf/fLjP/YO/wDTX56vV7OeJYT1aoDi3/OZ/wCelPDevUAOTMNxY/8Ae5yHifhw +yWt1ft0qxL+ZZTwXFu3MmsjqOaGP/ft/IeHFbp4y5+99f7eer1PP8uPsPPUHaZv5b/q89XqRuIY b/Mu2nPV6mb+WD2n7+er1M2YstjDfj7Oer1I3+ZH2fx56vU8/wDJS56vU85d8Oer1CX/AC4eznq9 XsRw3FsN/hbnq9Tzl3Dewt9I56vUIH8x/wBIGutj/Ec9Xq//1Najp3lvCb/zb8uZOZJQRofuH1B6 lhl3w4bV6hLw7sPo4b16ljh2G/6Ba/189Xq9/wA5D9fZz1er2I/7wfr8Oer1AH13zJhOSMiYzi3t 04Ds8/4X5ZR3klU3/wBZP5lX/wA2xQ/DmJOeZ5Ul0jcR/wB7jz1er38t/mVv94fbpwor1exH/pk4 Xp4cN69Tzh2W8Vv/AMknhRQirvEct/8AJZxbFMJ56vUssOw3CcNof+STz1eoS8u5bxbEqA/zT6dO ayKjejX5dy3/AKB/Kcr83RRXsRyTi2G6Yp8jz1epmw7JP8y/5Kn+/rnqNqWX9ST/AMknC8K4Rfzq vU8Yd0lxbDaDGT/Ka7lqOKPD0I6J4tmOgwX+af8AJG4QUdZHkdHhw7pvlPLf++nFD/DhR/PKG/8A I6GToRmP+W14yn/0wf8AmGuFNG1GxzniX+n2/PlaOqBv/kpV+MfHnq9TL1Ew32fdwlrdFOznlvFv n8Gxb7+HlElCZkzJOL/P4x/vp56vUGfVXpv/AC0fzb+U8r/PDRRROMRy1hHyGM/zTC7fRwY/zwUC P5HRaBkrFsMx7/fXmz+S+PDv+dUT55kdM+I5JzZ/ySc0f75fZ/V3h7QQpm/41mW8B/lP82/3zcN6 DtA3iGJfy2//AE2eer1A3mHJOLYlQfzf/nM8N69QaYdiWbMt1/8AySf5LjHPV6hkxH/kn/zbC/8A pmX4e5LRRVrvplzJ/WPppg2n/JBvzILcj/ll0C87o5GHf7wfr8eDGn6fOer1K/LuW/5l+3nqDtI3 MWG4t8/z1CKkb/Lf5b4/DnqDtLL+W4TiX1a89XqRuYsNv4f289XqRgw3+W/zn/fT356vUjv5b/p/ w789XqGTLuW71/PV6hLxDDf5b2156vUzfy3+Zfw56vU8/wDJN+jnq9U3/kaH0H+PPV6v/9XXzyXh uvs5lxkVRfQxYdlvx4cVullh2G/y3+FuG9ep356vU8c9XqfKD+nnq9Xq/wDo56vVXb67sR/4yWDZ Twsf8l7kadqed/8ACyhvkdVqZdw7FsN/nOEjCf51/PRqP5bzGPPKGH8jpmxHDcW7W+vnqENLHLuG /wAy/k2E8KK9XeI4d/La/v8Afz0Uz/JKEvJg/llf/wAkn/fzz1HlLH+W/wBZK84T/Kvr5X+eGt/y Khl/zb4T898f2ctWqHzJnRPKf/OU/wCSz24SVunj+W/1b/305XtzdHH8jp5w7JOK4lX/AO/O2mnP V7+R0P2HdJMIw2g78If54KOP5HQl5L6b/wCgW/lP++bhNR7/ACOjLYd0m/3w/wAq/lX/ACXueijv +RUsOjOGYThuUv5T/wA4bm61XeYsS8P1PCijemfJmJf8bzBrj6uer1H7zniX/JG8OEdHdPWXcN/l v9vPV6njMWW/5lgPPV6ioZiy3i2JUB/Zz1eofcmZb/6anhz1epkznhuEf8kn6+bokoHP8wOE4lQY z7OHdequv1E+nA5br/5thf1cFtA3O8jotWHYbi3bFP8Af1g3B1UZUJmHZJwnEsB/m2Fjt256imkZ 1E6b5T+Q/m2KYTrw3oO0WnMWScJw3/kl/fz1epG4jhuU8yUH8pxTX28N69THl3Df5bgWM4TinfAP bwQ1ajx+iH/fbX4zhP8ANv1vyZNyKBuebasT/lx9h5JdAmvYdhv138OeoRUMv/Ih9fPV6mXEcNxb 2/Vz1epG4j/vt/jz1er2HYb/ADLnqDtI3MWG/wAt/hz1epmxHEvy8eer1M3/AHq+er1LLLf+9/38 9XqGTEfD6+eoRUzfy3+W/wBnPUHa756vUyfIf8i3gfe+7T9vPV6v/9aiTLn2j9XMuqjCh8w7Df5b Qf0cNq9Xv9+2JUPhfhvXqEvJmSTf/foeer1POYsNwnDfp56vUjf5l/rc9XqZsRxL8vHnq9VRHrdz J/Ms24NhNuQB2qcaG+R0WnLv/JQ/X2cgChfXL/km/wA5wm3PUIqWWHYb/LaD/fWeer1dYdh38yr/ AOHCSjeh9w7JOv8Av0/5LPPV6lll3LZt/vr+7nqN6Mt07yT/AKf4ac3W/wCR0ZbDunGE278D9HH8 ioY8O6b4Thv/ACS8J/kvPUIaecO6SYT/AMla/wBfCmjahl/zcYThtB+p5qK3/IqNd076J/y2gwb+ acKaNqWuYsN/3/YN8O/K0dUAWTMt/wAtx7OWU/ZifPV6kbiOG/y3+c4TinPV6usmf78s24Ni3CWt 1aLkzJP8yr8F56vUMmHZJ56vUjcRy3/oF/bz1eotOYsN/luPfynnq9Sw6VYl/Mv99OKaYzgOnN0S UtOovTc/8lbmqO6RmTMT/q2cZwnFD/vmx/8A5hrh3RL/ACKi1eojDcJxKgxj7+G+R0T55VQ5w3Fs t49jGE9/p4NMlqMM8r2Xcyf1br/5T24e0EKZuoeJfzKgwb/fT/v5wHhvQdotOI5k/llB8Tz1epG/ 76fn/jbhvXqexiX+n/yrFOH1E9CT6Q8S/wCbtYzhP/Te5Ju5H/LUonzzbVx+HZb/AJbQX/5zPw5M tFdPOXMtf6f+XPV6ll/LR7f4c9Xq7HbGfp/bz1eoM8R/m38w56g7XsOw3+W/znx56vUjcxYl8eer 1I3EcN/Pw56vUz4d/wAlEc9XqErDcN/lnPV6hLwz97nq9Txz1ervEcN/ltBz1CKkD/yND6D/AB56 vV//16bsu4bhPs7czQqMKEjhvXqyf79uer1CV/yIfVz1eplxH/eD9fhz1epnxHDf+xT9/PV6kbmL /fl4c9XqpX9RH+/Lq1zGftU2VJ+RUGuXcN/0/BsJHIZoc08Yj/yXv+xLz1epZ4dfEv8AkqDhF/Oq NqEr/fRhtsJwzCfr5ajihiyZhmK4l/yVMJ5r+dVujldKukoxL+Te9wj/AJ4KOP5HRyOnfSXCf5gB /KfpPCbPM8o8yPI6Mrh3SXCvkP8AkevwpoZUz/5pf9A/m2GdsB56vUZjJnTfCf5CfbytHVLHLuSc JxHD/wDvQ8Ja3Q+/zIez+HPV6gy/q3/Mv+/D7Obo+pH/ANW/+NbjA+rmqIaBvMWXP9/1/bz1ervp 3hv/ABvMm4Thfb2c9XquQy7hmE98L+nnq9SxzFhv/Yp56vUGn8t/mWA27fz7tz1eoAs55J/mWIEe 3nq9RasRxLFsk5t/m3b/ALCXnq9R+Mu4j/WTAf5vwgrdABmLDf8Af9/ySebo+pH9Q8t/zKgA/lPD +gPntVQ9Vst/y3NgxY68knIqjDO9lA51Ey3hOG49g2bP+eNx7/mJf6u8HNA2i0ZzzJ/MsQxn+q// ACRv+eaHDeimgCxHDf5mNcW56g7SOzDlvFvn/wCa4Xi3DevUscRv8/g+LYpz1FFCZ6Vf9+XXj+bc mrceiXPNtXscmaiynnLv++2vtz1ep356vV7nq9SQxD+U356vU84dh2E/Xz1epl/qVz1B2kdiOW/5 bX/HnqEVew7JP8yr+/PV6vYjhv8Avw7fVz1B2mbEcNxf/nF89XqEvJmGk/8AJU56vUJWYv8Akn/r 7eeoRUHJw3/fiov+6dfrHPV6v//QqHw7/fb/AEczQqMKV/DevUtcu4b/ADLnq9Tz/wAj/wBXPV6m nnq9TH/Mf5b4c9XqRfPV6qivUzkn+W5t+jkAdqnGhvkdA5h3/OZ/lffkAVKNd/y3/nE4p/vlxnnq 9Svw7Df9P7fVwDUL6H3Dst/y2v8A+m1fnq9Rysl4b/v+bx8ObzzZRxkdHgyZiX+gfynC+E9Dejkd KsN/0D/kkn6uFFG9DPiOG4tiV/8AnC/Rwjo7r2Hf77bYThfjz1eoSsO/3g/lOF+HPV6hky7hv8to MZ8eer1O+I5b/wB8P0ac3R9TN/McJw3AcZ56vUDv8ywnEq/+bc1RDQB5z/325t56vUMHQj+qf9bc G/6bPjfm6JKtiyZhtv5z/wA4X281R3SxxH+bfIf9NrBuer1I3EcN/wCcSO3PV6gz/qR/45vy4QVu gx6idJf5lQfzb+PN0fUz9Gct4tlug+H6nnq9Ql4jhv8AWT/ft/zmeer1BrnPDP5lQ8PMk2UBaqK6 8Yb/AC2u/wCR7g0yKgbndADiOG/zLAf5TimLd+Daozoj+I5a/wBPxnCeHdFFBvw3oO0icRw3FsSr /wDsTcN69TNmIfzLAf5Rz1FFLP0Z4l/LetGD4rimv/PLflyUNxv+WlWs9rZWy9hv8yoP5t9XMgKC dM2Yv99vj8eer1dZd7fr7eer1LPEcN/0C1/r56vUjsR7Hnq9Xv8Akm0H828Pjz1erhz1ernmL/kn /r7eeoO0jP8Akm0H0c9XqZsRzJ4c9Xqecu+HPV6hkoP6eeoRV7Ef9+VBz1epm/lw9nPV6v/RrS/l v+rzNCglXsOw3/T7X+vhvQdpZYdhv1nnq9TN/Lj7Dz1erv8A5EPq56vUjP5cPZz1epm/lv8AMrfd wor1VQ+qrDf+N5yF+1TjUn5FQa/1b/ltD/yVr4zyF6HNI3DcSxbEq84twmzzbRvkVDHl3Df+xtwE UcUMmXf+S9g2E89RvR48uYb/AC2uxofdwnz2j3JKOR0ry3/La8+zhRQzyKjkdOz/AC2vt/zhuElH VD7h2G4tiX+/Yc9XqeMOyT/yRsW/XTm6PqWf8yH8+/31/l9/NUQ0ssuYj/Mq/wDlPPV6h7xHDR/I f283R9RN+omJfy2guOer1A5/MsWGA40MLwn/AH889XqR2Yst/wAy/wB+2Kduaohoe/TNhuE4lnzG ThfN0fVaLkz/ALGl+B+iKhNxHEsW+gcP61TNiN8SoP5Rz1ep5OG/yyh1/Lnq9SN/l38t8e3PV6u/ 5d/LaDnq9QX4jhv8t/o4Q0f004jlr/QCPr5qiGquvUz03GmLYXwc5FQMzyq086Yb/LcQvyTMlqMM 8oA8xZb/ANP/AJt24e0EKAHEcN/6ZeLd+G9B2vYdhv138OG9epG5ixIYlgOM/wA0/wB8vPV6u/TM MJ/z0YMf+m9iQ4ONyP8AlpUT57Wyrl7/AJIJ/Xx5kDQTrvEcN/Pw4b16mfDv+SiOer1LH/nH/r7e er1M2IYaMS0+7nq9TN/Mf9A/Z8eer1ey7/vx8fjz1ep5xHDfz8Oer1BpiP8Avyr+er1I3+Xf6fz1 ep5w7/e7+U89XqGTDsS+Gh8eer1LHDv94P1+PPV6on/IwPoPPV6v/9Ktbmc9RhWPDv8Ae/8AX489 XqEznq9TLiOJfzGv/p56vUzYjiX+gfT4c9Xqauer1In+ZD2fw56vVWp6qst2x/BcW5Dfaptob5HQ OYdiX8toD8fbzHypRpG/y3+W0H8p/wBBwXnq9Qx5c/5IGDfXyL6kahjyZhv8tx7vQ89XqP5kz/ko H6v4cJ88oc5HR4OneG/zKgwb/sfa8KaNqOVkzLf/AE1OEdHdGTw7+U4bQc3R9Qz/AO+nDcB5qiGg Y/lv+n3wvm6Pq6y7lv8AluPf9jn48IK3Q+/y3FsSr9eer1BnmLJOE/P89XqDX+pP/JZ/lf389XqD T/NLmv8AX+/h/WqPF6Zukv8AUnKX+/TCv9/I/wCYl56vUcrLuG/y3mqIa9iOdv5b48If55Wv5EaR P9ZP5lX/APJJtbnqEFPWI4l+fjz1err+ZfzL+PPV6vf8k3nq9Qa4jiX1Dnq9TLh2JfzL+nnq9RbP URlv+ZYCP28PMk2UBa18uqv82y1XYzhOJ/fyTMiqMs8yOgDw/Ev5l/vp4OaBtBnnP/fbX/t4b0U0 zYdiOL/IW/PhvQdpmP8AKfn8Z/mnCivUzdGct4t/nawbCsrZT/nX+/L+tPDo78fy6j3+w+Z5hWyx kzDerGJUGDf8ZL6OEuefVRUnZH9OdPP8y/0/+U4phP8AJeSduP24ZZmFArfjsPzPL6ecx5b/AJbz JmoFpGYd2/lPPV6nnEf94P1+HPV6g0/5KXPV6lll3Dfh9PPV6nn+W/6vPV6g0xHDf9P/AN9ffnq9 XeYv94P5T/HnqDtMuXf99vPUIqWWXcN/mXPV6hKw7/eD9fjz1epqOI/8aBf+InX6xz1er//TrSxH Ev5lr35nPUYUssOw36zz1erlz1epk/lv/OV56vVz56vUx4jiOE4j/Tz1epm/lv8AoH7eer1Ef9TG W/5llLGb9uRpvvR3ktE3y7hv8yr8m4Thf0cxjzyptpm6h/77cfP6+PPZ7TWS0MfSr/fl/JuRfUl0 eH+reE/75uFFCGjMZdy5/oPCejjI6ORkzDf5b48JKGNHGy7iX+n83R9Rlcmf7xDhBW6GXDsN/wB8 Pfh/Wqecu5awn7uer1M2HYbfHv5t9/PV6hKw7/kofzbhBW6BvOf/AGK7c9Xq6y7lrS3t56vUP2HY ZhOG0Hw56vUssOxL+W/8wvhWnPV6nn+W4tiX/JU789XqeP5bhPt/hz1er2I2v/Keer1M+I9z9PPV 6kZ/MR7eer1d4jiX8uoO/PV6g0/mX+n/AMpvz1G9exHEvHC+eoooNMxYl/zicU7eznq9VOHrM6b/ AMtx7+bH7+DfI88oD55kdVdfy3+W14xbC+3JNyWoXzyuWcx/MT/Nvy4NKCFA1iOG/wAt/wB+uF/8 kb4c9XqWXTvJJztm3Bv5ZhNv59wmzzPKNcjyP+YVssemb0c5T6b4CcWxTCeY+Z5nn8wrJzI8j/l9 DH1U6kdbst/yb+oeVMD/AJN48I6O/wCR0AeHZ2/ztV/8ozRlP+S5ywHx4eZH/wAL6Ov5FSyH+/Kg OEd+dONx88/mGW1zg34yP+XZnTLiOW/5byS6CVM/+/b5D4X56vUjMRw3/T/p8eer1LLLv/JQ/X2c 9XqGT+rf8y56vUjcxZJ/q3/yS+er1AHmL+U3+Phz1epGYd/01vq56vUJmXcR/lv1c9XqWX++n5D4 356vVE/lv+kjXwOn189Xq//Ursy7huE8znoJU84d/vcPp4f0HK44j3P08IK3T1/Mv9A56vUjcR7n 6eer1exHDf8AQO/bx56vUjcxf77aDhRXqLV1Dw04llLOQ/7Fn7Oez2tUR3pV/KcNzbg3/et5iRnm R1M9Br1Vw3/jW4zrwG55toRUJfSrEv5Z8NNOE9C/I6sSy7iX+gcD9DmjY9PP9+QPAjQuyKjX4dhv 138OElHVGVyb/wA4bm6PqNbkz/fb/Rwgo4ofMN/5Jx56iinrnq9Tzl3Lnj7Oer1IzqJ/xm/+SX+X PUb0z/y238m/mnPV6llhn73PUUUJX8uHs56vUtMO/wB9v/JL4f1qlrzVENew3/nCc9Xq9iOG/D6+ er1MeI4bhOJUH9PN0fUGeI/77fhwgrdM3/JS4U0b0GmI4d/La88Nq9XfPUUUjMxYl/p/++rhTXqA Pqp03/rtlP8AlP38NsirVUGdRMk/1Jx7GcJ/6YPs5NGRVCmd5HQBZixLg5qMqBvEf5thvDeimrE/ QDlv+smfMH/mmE/75u3Ix32qSuyrbW0Pkz/fl/vo/wCcNgPIVrIWg06rf7389RvRbcRwz+rXVrJu Lf8AOGx7+zns8o6oY/6t/wDJZ/mnhzoN9Oeef8LawU7b8j/4ZV1/Lh7BzIKoEpmzFlu1Bw3r1A3i OGj5D+U89Xq9kzLd+er1DJh3++089XqZsxYl/MqDGf289XqLTiOG/n4c9XqALMWJDLev3c9XqWWT Mx/0c9XqGT+Z/wCgfr93PV6oHz/+jGp9hCfeD/Rz1er/1SCaYZ/vp5nPUYV7/km0Phfnq9WTh/Wq x4dhv1nhBW69iOG/Ueer1BpiP++34c9XqZ8RxL/nE+HCivUy5iy3hOJYDjP8rxb7uFFCKqiv9+2G 9TB7cB5j1nX/AC0qkXI6ZuquG4t8/jOLduAuhDTx0p/5lHAdQvyOrK8m/wC8OC/T/RwP0Ncjo5XT zDcW18BwI0Msio42TP5t8h/ySeEtDih+yZiX9W/+cTf6P7Oer1GUy7iXw4QUcUPuXf8Akg/76+eo op5w7Mn+/C/t56jehMw7/kojnq9TN1Vy3/LaD8teeolyOgyPfBv18Oeo6oS8OxL/AEC3j7eeoop6 w3Mn+gflz1epZYdmT+W1/tHPV6nv+svD6iCnrDs7YT8h/wAlbnq9QaZz6tYThtAf5Xi3w56vUVDE fVp/Lce/lP8Azhv+wi56vUMOTOrWUsyf85ah4Q0f08fzH+Zf8kvnq9Xf/JSoOer1BniP/JOP089X qR2I4l/p97fVz1er2I/7wfr8Oer1Vq+ojpKcSoP61/ym+M+B4N8jzygPnmR1UR1EyT/Lsfxnkm5L UL55QB5iy3i3/ek4NKCFW6/he4di3yGMnFMKt/2DWYuQvvxnlT52VbK2WehOG4T/AM5X8uArI6k/ O696mst/74f5rhf0fx57O69uPVamI4l/McBwbFr/APJBxLx4T/8ANtoa0ZXEcS/mWPfRhnMtfpXz ysSPqMyOmXEf99tvDmc9Yz0jcRxLFu3fnqKKZv8AfTiXPV6usvf73n9fbz1eoUOer1F+znht+er1 Bp/LP9A/X7+er1A3mLDf5lX+32c9Xq9h+Gdv5X9HPV6hkw7Df9Atf6+er1M3yH+/75bxPv8A3ac9 Xq//1iDDDRiVePbzM/I6CNPH8t/lv9nBtQdpl/mR9n8eENbpnw3Ev5lXnCfAc9XqWP8ALf5b/Zz1 eoGsx/ZH189XqZeer1BtmD/eH7uFFeqqLMed8Ww3PmM/+tLzGPOv+WlUn0zZyxL/AEDGcJxPgLo3 p56U4l/vv7278BedUOcjq17pT/vyGDfT4/RwkzzZUm5JR+uneG/y3gQoY0bDL3+8H6/HhHR3Q+4d hpxKgH7Oer1CRl3/AH28IaP6GbJmJf6B/Kfy4f1qmT+Zfy3HuEFHFDJh2JYthtefz56vU85yzJ/x ksa+7nq9QBZMzIcSHw56vUMn/JSoPA89RRTz/M/9Xnq9SPzD1IwnDf8AkqYtzVENE26zesfCMt/8 kvFeHn8jol/nlEG/4cOxb544TimKj+Tf9hDfh7/IqJv55SNzF6ouoXz4xb+tYOD/AFcOP5HXv55X eHdfxiX85/mg+PPfyKiT+d0MfSrr9hOG14/leL/H+rvCbPMjoaZHnlH76d9Wf+ctiZ4B/wCR0c/z yjX4dnbCfu4f16uH/JS/nP8A0xuENH9Bp/LP9P8A1+/nq9Tz/Lf9A/Zwpo3oA+qmW/5lgWMez28N sionqj7rtlv+W9+TRkVQpneR0Tf+Zf8AJGwnFPH/AJhrg5qM/wCRVssenfLeE9AfTxg3++n+dYz/ AMxT/wAZzmPWef8ADCsmcjyOjK4b618p5koP5Thf++XGf1+HCKhv/IhQyZd6tYTnWg/lJ156vfyI UVHMWG/y2vzlhH/Tew3nqOqEw/8APG/963mUP0sf8tOsfPqM/wCWXTJmP7I+vmdFYZUjv5l/oHPV 6mX+Zf6f/Kb8N6KKecO/4zXPV6nnEcyfy3nqN6ZsOxLCcyfDnqKKAPMX/JQ/X2c9XqDPEcS/ltf/ ANibw56vU85dw3/T/bz1eoY8O7jnq9Sd/lv+/gC/gdfrHPV6v//XJx/yTb/lzoNUX0z5i8eer1Bn /Mv9bmq9TJh2JH5/+bePCGt0M2I/ynEqC/18Pq1QZV/9HCGt0jcR/wB9tB4c9XqBvEcS/mVBphP3 8KK9VanXbLf9Sc3fzX/nM9vz5j7vt/y0alDIv+WbQBf1k/mOA4z/ANiHkY0bUJfSrEv994wn7+FF DnIqtF6dZk/lv8nwgcIs6oYZHso/PTvMmE/IfRwGUN6PDkzMmE/yHhRRvQ+5MzJhPCSvU9YjnXCf n/8AfXi3fnqt/PaWeXcyHDa881RzXHrNiX8t/k2bObo+oY8mYl/Mv5Nbw0PCCjihk/ln8yoPzvz1 eojuTP8AjN5txnCcU/5wOvPV6jL4diX9W/8Aftin/JF56iige6q9WsJw3AcZxbC+H1EFUd9ZvUh1 BzJX41hOF/PcGdA2iP5z/wA4Xz/+/P6uaol/kdey9knNn8vxjNmKYTXfyYacOMiojzvZQZ5izH/L eDn+RGgb/PK7w7q1hP8AzlMJrzjPPfyI17+eUMmTc7Zsy3Xn+V8AtDHIqtd6EdbP6yYDg2E4pwIZ 5tqUMio/uTMSwn5//krcJaOaOJh2JD+Q/s4Q0f11/wAk3nq9Xf8ALf5lf79eFNG9A3mIf9invz1e qrv1EZb/ANPxn4e34ckzceow34yOib4bknCf5/g3JRqF8i/5adbOnRnDMJ/kPe/++zkLVkDQA+qr 035TNAc2YX/vlxnh3R1kdFo9O+dsWw3Hf5TinANnlDajjZzw0jNv++v/AKZt+eolrnmL/kvfyn/p g+Pbmaf0r5HWMX1GZ5TLiOG/n4cy1rGekZiOG/y3+jhvXq9/Lf5b4c9Xqecu4b/MueoopHZy/wCS h938Oer1IzLv++2vP8r56vUzYjhv/JZxbw56vUDeYsS/0/nq9Txl3t+vt56vUM2S+31/t56vU4n+ Xf1oTt8r5bX+m689Xq//0CPYb3P6+POg1RfT1mLDf9A5qvUDP8s/0/8AX7+ENbrv/fThvD6tU8f1 iwn9b8Ia3QaYjiX1Dnq9TNmL/eE/T/Rz1eoG8xf77b8KK9RUfUQDiX8m/mnx/ZzH3tU2VNPZXtok V/jyGoo5/klK7p3/AL7aDlc820e5FRyOnedsJw2vwb+acJqN6NdiPVvCsNoP99mK8r/Ja3/PKWWH df8AF8t0FsUxb7ue/kte/nlD9079SJxKg/5K38m57+S17+eUzZi624thuuF4rXfDhH/IqOf52KGT JnrYxfLdDgxzRi308J88yOjvI87oZM5+sXKfUjAcGynheK6cKP5EaGn89o/Hp36s4TiVBg2E/wA1 4BqGv88qxPJmY8J+Q56r0GeI9JcJxLHv5t/03uer1M2c+m+LYbQX/wCS1z1eohPUPpvmzMn85wn+ bf75uH1EFFny703/AJbX/wApwvCuENHn8jpZ4j6b/wCWjBs2Zowr/fNj3/MNDh9Vf5HQyZi6A4Ti XRXGcJwvCeSZuPnlQxvxkdUG9ROkubMt9S8m5syHi1DguM5DxL/nouZB1iXQ94dknqF1+6tYNmzq hhNDjWc8e1/4zuGfyTm6OMiyKrE8w+jnKedv5N/K8J/kv8h5iR/PDWdWR7j17LvpvxbLeO/76/8A 1Isu8J6r/IjR4cmdOP8AsbcD9Wo1uXMt4ThvCqj6nnEcN/0Dt8Lc9Xq9/wAk2g+jnqN6AHOX82/l +n6689XqIR6qv99lAcW8f7eDLcegVvvtop/SrLf+cfNuTQP+mnYkck3PM8qMckyStg3DsN/qT/J8 J/5w3IWqacjpn679R/8AjB/yrh3/ADyjv+R1V1l3E/8AjW4Npwjo6qyrEP8Ae/Jn/es/bzdElI84 l/v+xnw+POkHYfkf/LtVhb24/wDLSp5/mP8ALfDtyaKhykbnPEv9A/3189XqDPDsSxb7/HhvXqWW HYl/dz1FFBpnPEv6eer1Bph2ZP5Z9PPV6vHMf/JZPPV6g0w7Df8AT+3wtz1eoS/+Sbz1eoS8uYl/ LaDTnq9WQ/bX/iB/iOer1f/RLT/Vv+W9+dBqi+kbnL/kn/d/Hnq9QZ4d/vtoP5rinbhBW6ZsR/3g /X4c9XqDXDex/Xw56vU7c9Xq55i/lN/j4c9XqAHEf97j9PCivUAfXbDMJxK/Mfe3DZU1dlm2ib/y 7CfkP+98eQ1kW2hpnleyX/vtoD8OVzzbW8ipZYjmT/Tz/wBiHhNXqZv85GLYZjv/AGJuHdFFDL/M v5lj38pyv/v6wbnqNqH3Dst5tw3/AH64oeayLbVc8/4XVxy71IzZhufMGOaMp12dMm/89Ll3LuJ8 OP5HQL/ngoZcu9N8W6tZ7xn+q+E12C5O/wCea/rFz2eZHR3ked0DfVXpxmzptXnWu+HIuqTP5FXu hHq06hdN8+YNhOKYvXfyfhRnmR0eZFnn8vra89O/Wz+u2H4N8eRhnlZB5FVoeTB/Mv8Aftig5qii mbqJ/wAk7Geer1E3y9hv8yzbjOE89Xq6zl03wnLdAMWwvCP9/PPV6gDzF1HzXnWgwfCc+Yr/ADrB 8h65by7l3vw/mjUJApaZczt/LaD/AH14r/JQe3G8komzzI8tzCgb6idAunvVrHv5tijfyW3/AGDv JP8A7b5nUZf7FWWUZboz6b+k2W/+SXhNccZ4S55nmZ5hRzke4+WZfRlf6k/6B/Kf5T/JeA6hvSwy 7lvCcN/k3++n6eEFbrniPTfCPn/99f8AvlvzVENO2HYb/LaD+jm6PqesRH8xoO3PV6g0zD/vBjPC mjegCzF/vB/yVvhz1eonPqZy3i2dso4x/K/+Sz20+jhrkVEmeUy+kTpKMt49g39aPHXg4zzPKBf8 iq6nOeGfzLImD/8AYh4CKGuR1VF1Vzti2J/znCcL/PmqGtPPpm6JYtiWIfzbNH++XBuer1HHxHEv 5nm3+bf9MHDOCCiOgD/mWn828P7edNey3/lmiuffar/y06esO7Dg0oH17MX/ACT/ANfbz1eoGf5j /p/7Phw3r1LLLuJeNvoHPUUUGmI4aPn+/wBfPV6gbzFhv8t+vnq9XsRGLYbQac9XqZsmf77b38Oe r1CZh3+9/wCvx56vU8fzH+ZeHfnq9S056vV//9IAsRxL8vHnQaovoNc54l/RzVeoAsRxL/T/AKPD nq9Xsxf8k/8AX283XqDLhBW6eMO/320HPV6kdmLEv9P9nPV6gcxH/e/9fhwor1BpmLDf5lQYz8Ne Rjvxkf8AMcso73Gzz+XZnRN8Rw3+Wg8xnrIPPK907/3gOE/xPKZ5treRUPuHdJcWzJQfzb+UjhPR x/I6ecO6S5TNB/v0xYfzn289Xv5HRx/Tvknp7/If6p4phP8AJcZ4Q55soaZJklWKZd6J5TxLAP5T /oONeB57I88o6zzcemfLvonxXEq//mLKHBcG4Nf9lMVGX+wlR4MmdJek/TbKX8p/m3+/rv7OAvPN +P5hQzyTcf8Al1Ed9RGSenuJV/8Avs+7hNQyqm71EZJwnJObcG/ln++W2nDeowrYo9AGY7ZEwb46 acjLO9lTVuN/yzavZ6d5j/0D6OElH9M2c8S/o56jei0HDcWw3Hv5thfPUUVlzFmT+smA8PqIKKbi OW/9P/5K38l5uhrQl5dy3i2G0GC4TimE/wA6/wC7i56vUa/JmI4Thv8AzieeoooZcOzqP+coeN/z yqfySnb+Y/8ATL78JKcp5w7sOer1d4d/vy/Zz1ep956vVjr+er1FpzFiV6/2cKaN6BzEf+Sieer1 BtmLx5WtZ3TFkz/fbj3Diimjx9VerX9SemmC/r4c9kVaoAehGW8JzJ/v2xTnqOKMt/Lf98OM4Thf PV6g1xHDf6t4DjP8r+7h/WqKjl3Mn+nn+af0c6n7j/8AC7La5wb8/wDLSoY8Ow36hw6oqrvEf94f 5Tw3r1BnhuG/y3+jnq9XfPUUUzZi7/X+znq9QZ4j2PPV6vYj/vCfo56vV7+W/wCgft56vU9Ydhv8 toP489XqZf8Akm89Xqfeer1f/9MAOdBaCNBvmL/fbQc9Qdov/N16mrEex56vUiuEFbr3/JNoPo56 vUGmYsS+PCivUGeI/wA2/l3CmvUz4dhv8t/5Kn089XqKj1Ew3/f9jOnMRc8yL+X5nWTmRn+YZbSN 6d/77c2DnqvkVXU+lTLeE4lgH38jDPNlSbklBp1VyThOW82/zXCz9Y5WvZ5QyZdyT/La/BsWwvnq 9kdHg6d/5vcS1xTgSoY0ZnEcNwnLZ+nvytHVI3EcTxbDf5z4YN8Obo7/AJHRZ8xYb/pwOK+HDfI6 Bme1UN6mcS/rJ1L/AOxNgPDiouq9v0A/8wlgn6+HIzzvZWQ2Sf8ALMNXJZMxL/QOAuhrTzmLEvD9 Tz1epG/8lL/fTfhvXqZMRyT+WnN0SVy/zS4TiVAMWwvh/RPXX9ScWw3gfo4/nlCVl3Sg/wCSTzde oS8Ow3Ftf94cF9vPUUUJmHYb8fq4f1qmPnq9T1h2JfyzhBRxXf8AMf8AsU/lz1FFdYjiX+gXt9XP V6icdRP97/8AfZwpo3oNP+Slz1eoqXXf+tvz2Dfyv/kj/wBnDXIqJM8oScu/77a/Bvv5unKMr1E6 J5s6tf1Nxb/nDc9XqGXpVkjCck/76f8AkteHPUb0P39W/wCW0H++v6eH9E9FR6zDFst0GNYRftw3 3HyP+Y5l+RqmeZ5/wsogn/I/9fOqVc5aNf07zJ/oH0c9Xq9iP+/Kv4b16kdmL/fbX89Xq6wz97nq 9TznPDf9A/Zz1eoAsRw34/Vz1FFe/lv8y8eer1er/wCjnq9XsRxL/QP5T+XPV6mb+XD2c9Xqev6v /wCgfLe33/u0/bz1er//1C04d/NvnudBaCNI7OX9PN0HaBrMWG4thv8AHTmq9SMxHDfrHCGt0jMM /wB7j9fPV6vYh/yT1+n9vPV6gcxH/e/9fhwJV6kbiP8Avy56vUjcRxL4/G3PV6gDzl4fV/DmPPap kdTT2V55Qaf8k2v/AJtoPHtyGqk7+R1bx6VMyYT8hfhDnmyhrklGUzn03/rHQfzbDP8Aks/2cJ6v Ql9O8NxbDaH+U4p/yWse56jejAYccW+ev/KaHhNQxoSMu5k/mNB/KcU/3y8JqP69mLEsJw2g56vU QXqrnbFsSw8YThf668GOR0CM9quzMWG/6f8Azb7+G9BCrqvRFiX++LBcJ8eQznmypj3Hq8Dp3hv8 twH+bfzbTmqO6R+I/wC/K3NUd0z4d/vf+vx56janj/nO/r/h4UUU0PmTP5T8h/KeG9EmeUssOy3h Pt/nVvbwQUT13h2G4T/zi8J56vUxcIKOK5f79/n/APsTc9Xqd+H9ap/4QVuseI4l/LOer1AFnPEf 9P4U16g0xHEv5lr356vUGmHYb/Lf4W56vUjMxZb/AKyV2DYtin/OA56iimf+Wn2/x4bV6rLOlWds J/qng2E4pz1eoS8OxLCcO0/Pnq9XeI4kcS/o4f1qiP8AqqzJhPz9vEcn/wCnPI/+XlqLu1TPf5fl tFPy7hvw+nmdVYZ0ssu4l/p/t4b16hJ56vU0Ziw3489XqesO7Dnq9SyxHDf5lQfnpz1eoAcxZb/l tf8At56iimb+Xf6Bz1epG/1a56vUzYj/ALwn6Oer1POXcN7C30jnq9Qlf8iH1c9Xq//VLRhuJaD/ AJwvM56jCmjMH+931jh/WqBnOeJcIK3QaYdhn8y/5KnPV6mb+WD2/nz1epHZi8eer1Bn/wA5D9fZ wJV6kd/yUuer1IzMWG+F/pPPV6gdxDw/Xx5Ce/H/ACzKG243/LSoMf5YPafv5jDWQNGX6EZ2/q3j 1/q/jw/o4yOrxPTviRxH+TYt+vbgIzyhxkdGwxHDcJxKv/7HPx4T0MK4YjkrFvn78JqP6Zv6t/y3 /nLX/kPPV6gezFiWLYlphfDmiCindRP99uH41w4onz2iO4j2PDeghV1Pohw3/fBg3IzzypjySr2s u5kwn+qRwn+U8JKO6Db+Y/y6v5qjunnDsS/0C2F/Seer1d/79vn/AI34UV6hKy7huLYbw3r1O2HY li2G/wBHN0SVz/rEP1vzVHdO/wDMh7P4c3RJTzl0/wAtoOer1PP8zwn/AA89XqZcRxL8vHnq9SOx HEv9A/5K3bhTXqBvEe556vUzn/e7Gvp4bUUUjMR/32/w4U16mb+WD2/nw2r1I3MH+8P1Dnq9Rl8u 5bxb+qWDZswv6eao4yLZQlZdzt/Mv99PN1qhMxG2G0H82v8ARw/onqrvqrnX+smbedAew/cf+X5b WI3bfnf8wzP8jXWXcNPf9Tyf6hullh2Hfy2v/hz1epZ4dhv+gfzbx4UV6u8R7Hnq9XWXf9+Pj8eG 9eoS/wDkQ+rnq9QZ5iw3+Zc9XqDTDsN/0/8AlP189RRXeYvHnq9SMxHDfy8Oer1ew7Dfrv4c9XqW WwfIfNez3fv1/Zz1er//1izcznoJU04l2H6+HPV6gzzFhuE89QdpG4dhv+n3/lPPUIq9iP8Avttz 1B2gbxHDv5jr9/CivUjcQw3+W9teFNeoAOElepnxHEvj8bc9XqLZiP8AyUOAijvJa6xHDf5b8OY+ Z3kn8vrJzI69h3++2v8A99ffhRRrV4XpW6kf74cG/b9Hw4Cc8od5HR+smZksDwooX5FtoY/67YVh 1AOEtCCgbzFmTFsS/wB9OF+HPV6g0xHDf5ZgOvPV6icdd8S/loH18GOR0CM9oqHTz/jSY9+3hvQM yOrwvTtlv/ffg3/OF78jPPKyDyOrRsu4l/LaDBsJ4R0dU84j/KcSoOFFepF4d2HLUSUJn8xGI0HK 0d0JOSuHFElLLEf9+XPV6uWHZbt9fNUd11iOXL2/s5v+RUR1x/lo/wCSTz1bpq/5EPr5qjukX/yP /Vwor1ccS7j9fHlqJKR2I9zz1epG4jiX8tr+G1epm/5KX08Ka9Tz/Lf9A/bw2oooG86dvr/bz1eo 8HSrqPlPpxkP+U5oNEPH/jRW/bzdaImu8RxLKf8AyVsL5qjiipdd+v1qD+U5X/39cy47D+w//mOv qx87U+1P+X/5DY0VHDuw5mhWJtD3kvt9f7eG9eoS/wCWj2/w56vUssO/3238Oer1BriXYfr4c9Xq ecO/32nnq9S156vVjxHDf9Ptf6+er1I3+Xf6fz1epG4jhvw+F+eoopG/zI+z+PPUb13h2G/Weer1 Lz/nEn/iQ/hz1er/1y14j/yUTzoLQRoMf5l/Lb8Ia3TPiP8AKcR0/Lnq9TLh2ZMJ+f8A5Twor1I3 MX+9/wDNv5tz1B2mbEct/wAy/wB+w4UUIqDbEcN/0C+F/wDOB4RfzutUDOYst/zHXl63QZ5z/lOG 0Fuer1FUxH/e4/73d+AejWlf/wAiH18jLtUyPGpM3HzymfEcS+ocjOpJo5HplzsMN3YSfy4RZ5sq +R0frDurX+n/AMpv93Cf+R1J1GXy7iOLYl/yVPqvwnoa5HQxYdhv1nhLR3TNmLDf5lQdrX56vVV5 6u8S/ltsI/XtwY5HUMZ5QZ+nj/kvf79OG4reRVeF087YN9A5G9ZAZFVieTMN/wBA/Lgfq1POI/77 f99Pbnq9SOxHEv8Apl8KK9TL/M/9Xnq9QxdO8yf6B+v0cOKJKWn9d/8AT+ao7oY8mZjtX8EFEdDJ h38oxKg/hz1epmzFhtvD+znq9QOYj/vtr+B+jygzxH/e48KK9TL/ADL+Zfx5aiSvZi/320H8OG1e oG8RxL/T++p8eer1LHLuHfzL/ftfnqKK7xHDv5bQf76/p56vUD+YsN/0/wBvD6iCgx675bwnqR/J spYp/wBNPuObo+pGXxbLdBjOE/zau/k3bhBW6Db+ZDDcP+vx51U7LP8AlmisEt9/+WpQx5e/5IJ/ Xx4NKB1GXyZ/vyoOG9eoY/5cfYeer1I3MWJfHnq9SO/5H/r56vUscu4l8eer1LbhRWqYv5Z/p/6/ fw3rdI3ESMNr+er1MvPV6g1zFhp+s/lz1FFPGTP97Rz1G9DUftL/AMRP/Kw56vV//9AtWYsS/lv+ +n6+dBaCNAziOG/UeENB6kbiOJYt7fq56vUzf8k2v/36d+eoRUjsS/5KI56g7QZ5hxL+W0Ht4UV6 g0xLEv5lqeFNeoNMxfzbEv8Akl/Vwkr1I/OeJf74cGwn8uB2hBQOfy3/AKZffhTXqEnDst/6B/Kf zPN55kf8wo1yPPP5fmdBnmLDf5bX/wAp/hzH/PNtZMUs+neJfy2v/m3CWtUfvpTiX8yrz4HhFnmy h3kdWu9O8N/lv7eRpUl5HQx4dh38x1+7m6O6Ruc8S/lv8556vVSv13zt/WTPYt/zgfbySciqGM7p 66MYaf62ezW1tebzzZRLklXtdCMt2uORrWTeRVaJlzpti2GUH82v9fPUTfzykdmLDe4t9A4H6O6Z sOy3+enPV6vYjhuE4b/Rz1ep36d4di2JY+P5XzdElPWdMt4tri3NUc5FTPl3MmLYZz1WoyeXcyf6 B/Nv5tzdElPmI4j/ANNTh/WqRuI/yjEuB+jykdiOG4T7fjwor1I3lqJKY8RxL/QL2+rnq9QN/wDI 9/Kfy8OG1FFCXh3++2g4U16nnMH7v18Nq9QB4j/vyzb9HD+tUjsRxL+ZZtwa3f281TeR0GWYv+Sf jP6+HCDIq3nlBtl2+JUH/ehHfnSLcffj+Xf5DXPrPf8AlpUMmTMt4tyZ6KqMp06/X8uG9eoTcRxL +WcKK9SNxHseG9erhz1erlh+G/y3vrz1eoZMO/5Jw+nhRXqDX+Zfy3+PDevUy4diX1jnq9XsRw36 xz1epm/q3/oH5c9XqecPw3+W99eer1Ph/wCSiv8AxA/8rDnq9X//0S15i/3v/X286C0EaRmI4d/M dfv56vUGXh/vz4Q1ukbnP+UfP/76+eoO0GmI4l/p/f6Dwor1I7MX++2gtz1eoM/5l/p/8o4U16gz xHw+vhJXqB7MX/JfX6OEOebKENdYjiX8y/k3++miP8h/4yx/q7b/AH78JqY/4WUJnTrsP19nDfIq fp46idNv6yH+bYX/AMlrv93AbvxuP/MaF24+/H8uoAv5biuW68fzTCbf9+3kMfyPM8uqaP8AhZR4 vTp2wfgKzzZQ1ySrj8l/7wNyNKmbI6GTDP8AeE/XzdHdAF1ExIYbgOM/HvzVEmeVQX1UxLFsNzbj HJJqGc8oy3p2xL/jWW/Pls82V7JK2P8AoT/vBhHIVrJ2rE8u9WcVw2gOE9vo4efzyiX+R0i8xYl/ zlr8JK1SNxHMn8t/5JeE/wA656vUz4dhvULMlf8A8kn+S+zh/WqOR07y3/UnAeeoor2Yv9+VBz1G 9FR/luLZbx7/ALE3A/R5Q+5dH/Y2+H7eer1O3N0SVyxLsP18Oer1I/hPR3SKxHueWokoNMxf77fH 489XqRv/ACPfzb8/DhtRRQlYd/vB/wBMY89XqZ8R/wB9n+/b+HPV6mbDsN/0DGcW56vUVLD/APfl nz6OH1NZHSyy70lzX1Zx7OWU8sf75f8Afb/WjldyMj/4Z0DO1TPP5fllBpl3Lf8ALa/Gf99NsZ5l nWF9CZ06xL/ks4RinJq3HzyiijXZdw34fTyT63SxxHDfy8OG9epnxHDfj9XCivUyf8j/ANfDevVx 56vUtcOw3/fD3ueFFepG/wAuHsHDevV7+XD2Dnq9Tz/Lf5l489Xq9X/0c9Xqef5cfYeer1Jz+rf+ /cH4Ec9Xq//SKj/Vv+Zc6C0EaWWI4Z/LaDX8uer1ABiPbGcW/hwhoPUAWYsS/wBP56vUjP8Akf8A q4UV6mfOeJf8kbCeer1A3hv+92Mfr4cKa9SNxHEsJ+Qvb6uEleoBcRw3/T/p8eAehBSxxHLeE/P/ AO+v/f14cNq9Ql9Ov+mT+vhw/wAkrdDD/LfHC+XoPU0Zzy1/MsBxnCfbymeZH/wsoa5Hnn8vzOve mbEv7uYX771k5uRVyPTzEf5jQad/jyNKyByOhixHDf8AkjePw4S0d0AXVa2G4D/KfbxvI6Jc7qlf rPknFfnv5tyTMiqF87oGsmdSMWy3j3N0RVe56VPWNhIwHBsJxTFuA7PMjqa8i34qyzLvWzCsSoMG /wB+3LfyKjr+eUMeTMyf1kr/APkrf75vbwlq9GWy7knCdfv56vUJeHYb8P8AfNz1ep6/mQw22E/z bnq9Tx/vp+Q/319/HnqN6DXEct/zKg7/AE689XqR2HfzfDf48D9HlO38y7/yvm6JKeeFNepmxHEv 7uer1JDnq9QZZi/5J/1/t4bUUUGWG/72nnq9QmYd/vtPPV6njEe38p56vUzZz/lOGZRxnnq9RU8u Yb/Mcevw7zym8kqxP0RZb/luUuvnULFNP5Dhn9VeSf2V5HjWPvbhnmNV2YdhuE/z7+bf+tFlzky1 j7Xv6t4thtf/ADX/AEHGcGH/AGDvD3Is8/l1eo2GTP8AeIcycyPPKKKeP5j/AC2v56t08YjiWE/I d+3jw3r1I7Ef+Sieer1LHDsN+P1c9XqfOer1cMRw38vDnq9TN/LP9P8A1+/nq9Ql/wAt/luAf0c9 XqDTEcN+P1c9Xq9/Mv8AW56vVL+f/wBGNV7CF+/+7nq9X//TAP8AmX+n/nzoLQRpmzFiXh+o56vU AGc8S/llBwhoPUWn/kpcKK9XD/fTw3r1BB1FzJ/LT/TwH55VaDLJXL1akf1V/wB9vCLO61Qa5dw3 +Y1/bvwP0IaWWH4li2G49/NsrYt/JcZwHnq9Sx6U4Ziwr+9+H+SVujkYdkjCcNoP+St9HDz+RV6k XiP/ADhv5XzdboNeneG/1I6l4zhPs+/mI3apkf8AwyrJXsrzyrd+lXb/AH2cgCp/yLbRx8Ow3/QP 9+nCWhvROeomZP67V2M4Thf/ADgeHVArPKKh1ny5hPz+C4Te3BfkVA3O6BrDvTfhGJV/bm882US/ ySjk9KvSXlP/AHza/Xpwm/nlHf8AI6PzkvoDlPLVB/vrPCijf+RUP/Rn+U/P/wAp5qjmrEcmYjhP yH+/T6eWolpafzLCv+STytHVIzDsS/0/GeEtbrj/ADP/AFebo+r2HZk/0/8AlV+er1MuI/78eEFH FBpiOJf1b56vU94diX+gf8lbv4c1R3TzwqokpF5i/wB9t+er1BnmL/kgnhtRRTT/ACz+W0H7eaoh pX4dhv8AoHx5uj6hMy7hv+geznq9QadZsSHyHt+7nq9RaMmYb/v+xnnq9VvWHZb/AM0v4f8AjOLf 85rPfMn9x8j/AOFlYi9qed/zDM6puzFhuLYbX4NhOKYtQ2/55rL38t/nnBhUY0s8RxL+W0GDfzT5 7/fD/wB21z1ep66d9SMIy3j2DYRin/JGx7k1bj55RRRlf6t/zHW9+SfW6ZcR/lOGf76eG9er2HYb /MqDTnq9Syw7DsJw2gHCivUzf85D9fZw3r1LE98G+j9nPV6lph2HfzHX7uFFerrMWJfyygP5cN69 QN/zL/W56vUzYjiX5ePPV6pf8z/0Y6eI1+rnq9X/1CcfzL/T7YXzoLQRpF4jmT/QOENboAs54j/M dDz1B2kZhv8AyTjz1epHYj/vt4UV6gd6iYj/ADL+B4DM7rVM2TMN9nDvIq9QZ9VsS/mWPa4t/JeA jPNlCKkfh3YfRxutUJeXf97x/wA5rGeer1DHkzDRlug/jw/ySt0JOHYl/oH0eHD6g9XPmqEVIvqL how2vybm3kKdqf8AyzKkfcjbVlfQjEv5l/KOYY55trLbIqPF1FxLFst9JcYxbhFkdDTO6Jt07w3C cNoP5tinD+gTROfU1mTCcNz3g3BbkVA3O6Erp5iOLfPnFvv4UCjzIqsu6M/78uE9DCjkYjlv/fD9 OvPV6gCy7/NsNzb7Pbz1eo8OXcyYt8hrhPPV6lkMyfy3hLW64YjnbCcNoObo+oM/6yfzKv8A4W4Q VukdiPUjCcNr9MW4f1qljh3VrCeEFboZMOOE5koP9+nPUb0jcOy1/La/tz1epY4j3PCmvUGmY/sj 6+er1M+IYb/Mu2nDaiikbiP/ACXv5T9fPV6h9y7hun++vnq9Ql/yz/QP1+7nq9RUOomJf6f/AA56 vV36eOkw6s5swfKeGEDGMcxK5J04eZHkn8wzKgPnmefy7LKss/ExxLCMldJOmnSj/ki4N/MtDzLO sR87M1Svb+ZUGM4sMW/nWDf9hFl3/ku4Tz1E9LLDsN/mVfg380wn/wBR3Euer1M2I5bGJY7g+E3/ AN83N5FXqNfkzEv5iDhPf+Q8yE3Hzv8AmFFFM38t/wBP/ZwaUb17DsN/0Dv9fPUU08Yd/vtrzw3r 1d1/9HCivUscO/5Jw+nnq9Szw7/fb8eer1dYjhv+gdvhbnq9Qafy4YbQHhvXqRuYsNv4f289Xq6/ 5EPr56vV/9UgeYv94Pq/ZzOeowpHf8kyg9t/r56hFQN4j/vyr+eoO17+Z/6B+v389XqBvEcS/mWv fhRXqBvEcN+Hwvwpr1PGHf77aDhJXqAbMP8Avyr/AGcDtCCnnDcN/lnPV6nn+Y/6f+z4c9XqMn/y TMpe3g9oP0jMu4l/oFu3CSvUJn/JS4d16nrOeW/5lkPGf+mz8eN55kf8wy2hrkmd/wAuo1/ozzsM S/ktxznDvxkdZobj55Vrucsk/wCcjIf9U8L0PAdUo0VHOfTfFskZCFsJ7cOsi20CM9qjzrvhvULE se/5K3/iO8F9RdT10p62ZsyTXjCM0ZT178J/5HR9kdWi9GfVFlPDe4/k1+E/8iqTcj/llWJ5d9UX TzMlB/yVqDhNQ2/kVM2HdR+nmG1//JV+jnq9/IqGPLvq06eYb7NfZz1e/kVLLDutmE5k0yvhP865 6q0zYjmXNf8A2Cf18p/I69Fe/wCbhYlX/wAp/wCSLy9ep6w7onhGJUNsUwr+de3+sVuEP88rf8io G8xem8YacZxbC8WrsF4dfzugTnlCT6eMR/mX++rFMW/388JKP6P3iX+8Q56vUDWI4l/LaDnq9Qaf 8lKu8bc9XqWn9W/5bQfza/1c1RDSKyZlv+ZV+M4t29vx5uj6hkw7/faOer1PWI4l/oHfQePPV6id dRMS/wCSz4fHh9RBV0n4X3pxXLmU/wDPVmnCwMax8Xy2L67ddeTBuXkqT/lfE1j92qZ4R/kVFT/F CzH/AFj604NhAxWutkPDf+ed+nkoCoXqqLDsyYt4f+s7hv8AO+br1D7/ADLCf5CDhfz3/dtc9XqD T+rf8tP+/T/f1jOA/wDPO89XqWWXcRxbDce/m38ptjOA8Pcizz+XV6hLw7O2U87D/fXi3+/nmQeR 55RRQmf8iH1cOa3QZZi/32+Px4b16u8O/wB4Rz1eofcmYb/oF/y4UUbUssRxL+7nq9XsO/35frpz 1eplzFhvhf6Tw3opoNMxYbag9vw56vUiuer1f//WINiP+/L286C1F9BlmLEh/wAknhDW6DTDv99t Bz1epG4jiX1nhRXqDTEcS/0D6PDnq9QacB1CKlpiOJYThtB/v0+77+UzutUGY/lNv99fCLIq9TR/ yUsQ8OVrVPGG9z+vjz1eoYsRxL/QPo8OD2g/TPh3+8I5qhFQzZL/AGjmsirVDDl3DP5b/wAlT8uH FboA8u5j/wAyfVr+U/8AOGx7/jU5a5iT24bj1PfZXnlbB3pm6kf1k0tzEjO6ybyPPKGP1mYbhOG9 JcZxb+U+znskr2d1rtdVcN7fmODXI6BueUy9Kv5TiVecJ9ngPo57PK3kdHIy7knCfbwn/nhqaP5E KGPJfSXCsS/5xX3c1/PKOP5FQy4b0lwnDD/ySue/nhrdDJkzpLhPz/fnv54a9Rrcu5IwrDaD/fXh PN/zw0STT5/VvFvn+3w/XTgH/nlHdLLDst3w8/zTx5qt084dlu/1cKK9WPEcN/5xPj9XLUSUTfDv +MT1axnCf+cNw2ooo2GHYl/oH0eHPV6g2zniX9PNUQ17JmG4t9PPV6hJzlhv8twHm6PqZsmYb/vh /Pnq9Q+4d/Kf5EOer1BpnPEv9A9nPV6g16N9JsU6+daMn9PsNNsEX3szk9gBqeDXI8j/AJhQHz3P f5dllbV2E4ZheTcrYfheHgYXguBUQjjUWsiqo9vxvzIWsPtp9a1UvUznbCs7daepebMUxb/fMMT4 aUgoAsu5axbXCcL/AJ5jWC/8xT/xnf8AfJwpr1LLDv5t8h/Kf5Tjn/jy4b16g0zFmXFv62nCf+SL jOA689RRXsOxLFvn/wCbZo/39ewc9XqDbqJhuLZbr8GzZlf/AMSXh9Wqd8mdfs25br/+NR/xtMG4 M8j34rdGww7EcIzJQfzfCtPHkz5Hnn8xr1LHLuG/yz/nE83W6EvDsS/u56vUs/5kPZ/DnqNq44dh v+n9vq56vUz5h/3vH6+znqKaZ8xePPV6gk/mX6Ym3iNPqPDevV//1668RxL+W0HM56jCgzxHEhiV f/Rz1epHZzxL+W+PCivUGmI4l/oH0+HPV6g0xHDv5kP99enCmvV1h38py3Qf9jnhJXqDfOeJYtiW Pa68pndCGmX/AH08IK1T3/yP/wDJJ/1eer1K7DsN/wBP7fVwRValniP++34c9Xq9h3+/Kv56vUPu TMN/ltf/ACnv9HBjXqH3LuW8W+Q/LhvXqDX1EdE8WzJkMZswv/ks4DwHb8ZF/MctozyTPP5dTz6E etn8trv5Tzn3vxkdZbbj55VyHqIzti2Y+hGMn+bd+RjkmyhlVBX8y/mXj8NODWiimfDv+M3j382/ t781RJ/yz6sS6VZkwnEv5MfvPAdU0ZJndHhw7EsKw2gwa2E9uB+jv+eU9Yd1ayl8/wD79MI7/Rzf 8irX88oZMmZ2wn/nFjt35qjyh7w7Mn8y5uiSlj/Mv5lb79Oer1PfPV6uQxIYZX8J6O6RX/JSr/Dl qJKALqrkn+W5twbFsL4bUUUJWHfzb+XH8789Xq7/AJb/ADLHuer1CXl3Lf8ALeFNepm6q3+QwbCc M4bV6njDv+ScPp4U16nnEf8Afb/Rw2r1A/nTEif5zp+tuayKiCrzfQL6dY+inTlszYnh4TOOdAJq r2hfAH2XtrzIjIsh/l4rF3fneH+YLgcNtD16suosnTfovmvFKDTHcaQZdwEDuZZL/wANeDGo4rU6 w7MmE/IZxxb+U/yX/sJcu5i4b16vfzL+ZYD/ACjC/wDxGv8AsbYBz1epZYdlvKeW6/Bv+MnQ/wDJ N/rTz1epG5iyTlPEq/BsWxTFsDt7f5Zz1FFM39W/+mX/AL+sGPa+Wueo3poyZ/yQc5YTin18PqJ6 AHDsN/q3m3/ps/8AdxZd56vUJWXc7HJOPDx4c5HnmZ5fW6PFh3UjCcyUH++vTGRyZ8jzz+YV6lhl 3/flX/79PHh3W6GTDsN/0/t9XPUbU94d2HPV6kZnPDf6eer1BniP++34cN6Ka6/q1z1er//QrSzF /NsS/wCcTzOeowoNMO7fzb7+er1A5nLEv5lXfx+7hRntapm/5EP9+nPVumb+Zf74Ma/5w38i4U16 gz56vUkMxYl/Mq/Gf5XwBUIKZsu4bhOG89XqGHDsN/0C/j7OCKrU9ZL/AN9v85xbFByuSUHKRmYs SxbEsd/5JPLVuhLy7h3+n4Npfh3XqPDkzDcJw09uC2hFRlsu4lhOG/8AOJ56vV7Ef9+XPV6qous2 ScW6BdS/62YX/wAkfHu/MZu1TcepH3HzyrRsu9fsJzt0l7f8423MMf5FWTv88qrgZk/q3nz+U/8A OG4L6KaH3Dct/wAyoNeFNG1D908w3+Wg+066cJ6OMio/OTMyf6B/KMU/LhLQ4r38s/1uer1CZkzL f8t56jejWZM/6ZPCCt0MuHf77Rz1ep5w7Ef5jpwpr1dYl3H6+PPV6u8uYbhOG0H09uer1IzOeWxi VB8eG1FFM+Hf77aD+U2+nnq9TxkvDf5b/v24U16hkw7Ev5bQc9XqBzMWJfzLNv8Avr/5wPDavUy4 diX8y/5JfPV6lliP/JOP089XqHv0LenNetGej1CzPhYXptkMX1IH81x4EAtr4C/JR3GyKoR7Vt9z YYDbWxFyZ6xlrX2/FO6z/wBYMcwfpRhgAwrBT5kxXsXsAT+XNk0aITAqnTEcx/1kr/5TheE12M/y DtmHhtRXSy/qThJ/30/yquH/AD1OWv8Afn/yScf4UV6vYdiOLYbQ/wDJJ/8ABZ/rF/5ZOG9epG4d bO1Bg38rxauyX/vy/wCM1/V3/nEf9iTnqKKH3DsS7YtimE138m/7uLE/+SRz1G9A3iOG4T8hjGE5 o/keDYzgP/YyzNz1FFI3Ect4thuA/wDJW/3zdv8AjRc9RvSPGG/9/rh9RPQk4dhuLfPf768W/wB/ PNf8s+t0PvTvrZhPz4wnNGg/7CLk0ZHvxXqORl3+U4lwaUb09Yj2PPV6usRw3/QPjz1epG/1c+P6 /dz1FNcz/wAlJf8AiJ/iOG9er//RrTzF/wAk/wCv9vOgtRfQaf8AIh9fCGt0DWYv99t+FFeoNMxY l/LaDX6Oer1I3Ln+/L+cW/PhTXq9iOJYThtB+XPV6gFw7EvhofHgCoQUJOXctj/fN+vflv5FW6Mr /Lf98P2eDug9QafzIez+HCSvU94dhv8AzlvDlf5JWqGLDvD+V24e1ujLZb/3g+/gtr1GWy7hv+ge 3nqEVO3PV6g4zn0lwnq1gONYTinCjPMj/mNMZLVXf8yzZ0Br8Z6fYp2+PbmF+++5H8uzOsg8jzyg xxHMgxL+TZs+r9vAZ/JaOaPH0ZxI4l/v2/XtwFZ5UoZHRysOw34Wv48J6GFDDkzEvq4TUf0ZbLuW 8JxLnq9Q+4dlv+W/w56jehjy7hvYW+kcIK3Syw7DfrPPV6ll/wAk2/5c9Xq9z1epmGJDDK/nq9TP iOJW/wCSpi3PUUUjMR/32/8AJL1v+3nq9Syy9hv8toPbwpr1POI4l/oHfQePPV6gExHEv+ct4fXw 1ohpYZd/320A5uj6ll0r6c5s6+dSsH6fZY7L/wAxLmLv/KeHuRZF/MKA2e57/LssrZK6b9N8r9LM o4RkbKtB5eCYOmynWw08bn48yJJjCsRc5zdV+sqVUnqlnfDOnOR8YzdiWsGCIGB8bnt+XDKiqtTH qHmTFupGfM5ZsxXNlDguM/zP/nouG9G9d4j0lxb5D+U/1Trs6YN/Lf8AjS5i/mf8j4UUUUAOIjFs Nr/5Thf9Vcl/yHUf78/53w3r1POI5k6e5kocZyniuLV2NYz/AOA7y1z1FFPH8txX5DGcJxTCf98u Pf8AMTf1i/3yc9XqWeYsS/lmA4N/K8W/nWM/+Xfnq9QBZzxIYb/OcW/5Iv8A5fcI56vV0M7fzLEP 99f/AKd+er1d4jhv/JG/mmE0Px56vV1/xk8N/wB+382rv5z356vU9/zLKeJV/wDv1/3y4zgOp4fV qnjp31IzZluv/wB9WLf75v8AsHcx8OMkzv8Al9bo12XfUhlPEa/+UYp89guM8k/I87o3oy+Hf78c B+ng0r1ceer1NZ/5KS/8RP8AEc9RTX//0qucRw3/AJy2K8znqMKRvUTMn8swH+UYXz1eotOHf78q /hRXqRuYv+mTwpr1M2XP5ThtBjPPV6gzxH/fl+3hJQirJh3cfTwO1WhHy9/vef19vBFQfpZ5ixLF sMoOeoRVxy72+r9vPUHafMO/35fs4d16hlyXhv8Avw/ZyuRUIaMpl3Df5lwX1uh9GGnDaD4c9XqA XqJ6ouk/Teg0xb+dYz/3bvw4UZ7nmWZfVaI5nP11Zs/55fCaHBcGHIxzzfijf+R0R7OfWzNmZMf/ AJtmjFv51yMd+P8AhhRxkeeUzYdmQf8AJJGL/wC+Xtfka1J/88o/PpVzt/oBwn6uAbPNlSbuPVou TMS/3w+3ka1NdDJkzDfr56vUbDJmG/y2h56jehJw7Mn+/C/t4QVuh9y7nb/T/wDfoeer1DJh2JYT 7Pr56vU8c9RRQa4jmT+W/wBvPV6kZiOJfzL/AH7c9XqB7Eeo5w3x++/NUQfzyvZdzJ/WOv8A5tz1 boymHZk/0DhVR9Qb5yzJ/Mv99OF8Ncjogzygz1xGv/7E2A89W6GPL2HYr1Gx3Bun2RMK/nOMY7ck n2ccyLIv5jWs8zwZcK2KvTZ6d8K6BZM/lZmGK5pxYb8x49+9M9j2v4D+PMmsgyRNiMKxF3230XmS 54CjR8O6CFUhfiodf8Kw/Ly9KWWvTCHAbM2PYBa6kjtpwzbECtmqWuneG9Pc7D+U4p/zGWA/8wzm LMX/ADluOVqhky7/AOPrJuO/8xLl3MX/ADiMwc9XqZcw/wC+2g/m2F4TgeS8GwHEv6rf8aLDOer1 M+I4l/Mv5zfFs1Y0f/Ad4Z/I+eoopG4dhuU8M/5JeE0OC/z3/nouomJfzznq9TNnP+b5k/k1/nsa yb/2EWYv98eBc9XqRuYsNxb5/BsW/m386wb/AMcnPV6mfEcyYtiX8mxbIeE/75v5l/VXLWXcxcPq 1TLiOI4tiX85xbFP9/WDfH/nL8Ia3TxhuJZU+fGLYpi3/Gy/8tPPV6u8O/35f88n/vmwH/mGsu89 Xq7xHDf6tV/82/mv+/ntw+rVM38t/mX+/b/kic9XqWPTv1IdWOkn/JLxb+ueD/8AYOnvwZ5HvxW6 PDkz1Z9Pc7aYp/vlxn/u4uSfkeeV6hx/rjkIwjEv5tQ/KKDCfpOo/hw5rdf/06oMQxLFsS/703M5 6jCgD6iYlp7T7eFGe1qkZh2Jfy2gP7eerdA3mL/fn/yS/r4U16mb+XH+Q/389Xq9h3++yg/m3CSv V7Dst4T/AM5Tnq9Ql5d/lOG+PDuvU0ZjxL+Z14wnhFndapYf1bt/yS9OHtboS8u5b0GE4XzVCKhL y7hv8sr+/wBPDevU9Zi6/dPOktBjP/Oaxk/886eEue78Zbl1M5JkdEe6zerTqHnbAf8AkrfyXBv+ wdy7yMc834o7/kdE5/mWLf4uE9epFfzJcSt9+nCP+dVumrDv5TY+3x+7m6NqdsOxLCMNr/2HhHnm R0dZHnlGW6EdR8Jw3HgML/5IvAbnmR1J+R55V4PSnMn8yOD/AJ8hjPKyAyKjk5L7fX+3hNQ2o5GX e/1/s56vUGeYsS/q3j3+/TnqKKWOXcyf9MvFuEFHFGWy7nbCfu56vU84jnb+ZV/PV6vf76eeoooH uomZP5bQYz9VuHeSUQZ3RTsRxI98U45RJS0yZmP+ZD4cD/8AI6O/55Qk/wBd8V9nN/yKib+e084d iXx/388P6rT1kzDc15kzd/VTLGE/zrGMe5T+R/zCjz+efy6tkL0c+lWg6C5YGKZiIxTqJjYSXME5 KEURIJ2Jr955NeRZEMuFYu7778LzJcbAKPdwY1G9Bp1OzphfTbIuPZtxQ+7gdCz/AEi1v4jnq9Wo 11VxLqx1a6tYzi2F/wC/o49/zEp/5wXDevUzfy0ZboP83mKfI41jI1y1mL/pk89XqErJmJYT3xT5 7+TY7/xlsy/9ijnq9TPmK2JfznCf+S1/If8AjLdSsu/9iDnqKKRuI/1sw2g/qnhfzwzlgP8A5Nsv 89XqRmHYbhOW/wDnE/8AGNx7tmH/AKZHPV6nnDv6p4biH82zRmyh/nP/ADzWYsxYn/O/5tz1G9I7 /jJ4lm3qXi3+nfzjAMN/5h3MX/OW56iiio/79sNoP5theLf+DNmLh9Wq9huY8W+Q/lH82rh/vs/4 zWXeer1PGXcyf6fg38rxb+S/z7/sZ8IaOKEvLuZBiNeMW/mvbtz1erlh2Jf6B/KcLwn/ALun+rvD 6tVx/q3mzEv9+38p/nWDfDhDW6aP82+U8t0H8pwrFvp4fUT0GeTMt4TiWPc9XqFX+QyinMn83/0V iJj/AMSGn7eHX88Nbr//1KiMN/3iPM56jCi0ZzxL+ZV/CivUGmI/9MnhTXqZsSw3FsM8eer1PX/J NwHnq9Qa/wAtPyH/ACVqHBf7OAKhBSvw7/fl+uvBFQfrJiOZP+cTwPVWvZdxL+ZY9zVCKh6/5yH6 +zg9oP0s8RzthGSaD/fppxr+e/y6tUTfqJ1+zZmT/fThX++XBvHgLzzPKPP5JQB/79v9/P1cB1Hl M2I4li2G4D/Kf+cN/wAxTwkr1BniPc/Twho4rnz1FFMWHYl/LOeo3rLz1ep1w7Ev5bX/AM24UUb1 a96VfUhhOJ0H8pxTTGOAvO8jqa8j34q3fp3nY4lQX8O+nI0/kVSdkeeUeHJmZP8AQLcJaG9LPqrh uE4jlL/fXzVENFPy7iOLfP8AbnqOv55RlsOzIcMoOer388oSsOzL/MvD6+U/kdb/AJ3T1iOdv5bQ f8lbv2789/JKJP53RUMxdSP6yV/8q4f0SUi8N7n9fHhJXqE3LuWh7e3G/wCeVb+R0MmXsN/ltB7e EdHVLHJuSs1dWM94PlTImEjGMYAuTe1reOvD0ZHRIVDLRJ2VsYekj0V5Y9OmDHFcQH856h4wC02Y GQN8hdD7qXPh4/dya8iyIZcKx43334XmS8NgqwHgxqN69z1eqkD8Tvr06RL09y5YzYJ785HbeRrz 1eqlzpVmT+sdB/NsUwmuxr/ySYFz1eoZMRzH/Lf+Spmyhwb/ALBrLuXcM/nfDevV7Dst4tiVBjP/ ABk8c/k2Pf8APRdRMT56iilll3Ev6k/79s0YtQ4KcB/7B3/nL8KKN6DT+W4Rnav/AJR/p3/YU5az FmL/AHx/ynhvRRXWHf77a/Gf+mz/AM9Llz/nBc9XqLT1DyTlPDaDGf8AjJ12N9NPbl3/AJxHPV6g 2w7DRlvAcGwnFP8Af1g2PYl/xmv+m7w+rVAB1ExL+W48cJ/5Io/7B3Lv/OI4Q1ullnPJP8tGDfyz NlD/ADnAcN/rTlrLvPV6mjJuW8J+fxj/AH0/93Vlrh9WqGP+Y/y04N/K+ENHFI3/AI1mG/zj+q/P V6nnJmJYtiVeMJ/0H/kmf8Zrnq9Tz/WP+ZUGD/zTF/8Akvf9i3nq9Tz/AFbwnDaD+bYX89/v+/5h rLv/AE1+er1Tvk8qCpGV1H+ksDLPmL/peFgn/Jpbnq9X/9WlXMWJcznqMKLViX/JeH6+HAlXq6/5 JvPV6kbiOG/zKv8A5tz1ernnPEv5bgXflM8qtBn/AL9sRx7/AL0PALQioScRxL+W8EVB+gexHEhh v9HA7QgoSuneGn5/+bezvw/ySt0scx9SThtf/vr4SfzsUz/JKBvEcSxbE6//AH6f8lngN/nho9rn iOW/5bX+0ezm6NaRhw3/AEDGfD9nCSt0jf5Z/LqD/kk89XqReJYb/p5/5wt+ENbpG/79/kf1tfnq 9Xu/f/fL7Oer1e/lv+rz1er2I4b8fq5bPNlepmy7iWLZbr/5thfz3s4TUb1ZX0q9WebMt/yb79OA 6hxkeeVYp079bGLf8lb+U1x4H/5EKGX9t6Hz/b8OZKD+U/yeu4UfyOjv+3FNGHdbc14nX/zbC8J+ jhv/ACKvfzuhKw7qR1CxIdv5Lz1b/nlDHh2dsWw0f8lbXhTV6RuI52xbMnj/ACUfHhRRvQnZdy3h P1DhHQyoYcOy3b6+EFboZcO/32/8kvvz1eoY+hXRTqv19zacqZYwnaBc5mzGdAPv4OMjyOgXnm/H 8vrZH9NPpRyD6dcDCYUVxXNU6f7/ALMb33yNa+gPYcmXI8jFimsd8/31XmJ6qNxw8oI17nq9QEdd OrWE9FOmuM5wxJrrgYBF/vvz1erT76q9Ws2dR+peM4tiuLf75s+f8w1mL/pkcN69Ql4dhuE/yH+U 5o+e/rlgP/MNf9jbnq9Ql4jnb+ZYDk3/AH7UOC4N/wB27hv+/wB56vV1/wAj/wDvrynjmdP+wl/z iYlz1FFM/wDWTCctjGcJ/m1Dgv8APtP+M7hn88x3nqN6BrEcx/y3AcZxbFMJrvhmLqJz1FFBr/Mv +cthfz2M/wDdxZi56vUjcRzthOXKDGf99H8l/n3PUb0G2c8yYtluvwb/AH0/ybBsBw3/AI0uYsu8 PqJ6ZP6tHO38mzZlfCf+SDwhrdLLEcNxbLf++nC8J/nWcsB/41OWj/3b/PUb0zZM/lPyH/JJ/ktv +NTpz1er2I4b/Mv9+2Kc9Xq9/XbFsSx7/fphP/JB/wCwd/5y+Ac9RRSNxD/jE0GDf1Xxb+S4N/zF OWsxc9RvTzmLO2LZkoP+mLz1ervLuY/5liBwnC8WrsFOA65l4fUT0Jf8lxY498m2LUPyqf77oMvD /eb+qLe89/juVbc9RvX/1qJMx/aH18znqMKDP+Wj2/w4UV6mXhTXq7xHEv5l/wB6bhtXqATOmJfz I9uAzO61XHJmG/y2v/Zy1bp5/mX8yx7/AH6ac9Xq9/LP+cR4eznqEVd4jmX+W/76cK8f+Yl4Q/zw VqueHZb/AJbQf768J4DqNqeMNy3/AKDbhJXqeMxYbhOJf76eer1BrmLDf5bX4NhP3X56vUjP5ZhP /TJHPV6kbiOG4Thmn1356jekZ/VsD/kqac1/JaKaZf5b/Lf4cIq9XLDvZ/Ke3D6jamX+W/8AJZN/ hbhDW6ZsRw38/DhRXqNhiGSf5bgOTcW56hzR+fTtiWE4lQnCf5TrwF51QvyOrFMN6AYTiX/JL/3y 8Bf89oafySh9y76bsVw3+HCb+eGvfySll/mkHyFv2+PPfzw17+SUWfqJiX8tx7+U4X+fDqnK7y7m T+ZfDhRRvRscmf8ATW4R0MqGHDr2H0cr/JBRJVlHpa9Dmf8ArxW4RmzFP+Mf04CtImNIRvfaOygk cGuR7jUC8937GXGONbF/SnpPkXozlWiyjkXCkwfBIQFjhj7kkX1J5NZIGyses4zpeYKlVCvxuiqv c9Xq9z1erXG/FQ9UIxDG16TYViYj/kOuwW/36/DhqlMCvVTlkz+U/P8A+/T/AJI2Pf8AMS/9ijlq 9RlsOyThOG/ybCcr4t/xssB/41PTTMXPV6uv99OG/wDMeD/kvf8AYO/84nMHPUUUJYzJ/LcB/m2a P9/WM/8AMLZly7z1G9BriOI4Thlf/VPImLfyX+e/8anLWYueoooM8O/3vxn+V4t/Os5f89Ll3MX+ /wA56vUz5ixL+Wf8azC8J/rpg2Ac9XqLX/MsWzJjuTP5X/znsS14fVqmXqH/AMx5/v0/39fyH2f8 4nnqKKecmZ2/q3QfynC8J/3zYD/zzvPUb08YjiWU8S/nOE/zb/fzgP8AxqctcIa3TNh2JHEv9+2F jt/xqf8AvUc9RvXWHYl/Lf5z/WjCf51z1ervDv8AeD/kk/7+ch+P/dv89RRXhbDaC/8AKaE5N/5i nLXPUb0jv99OJfzn/wA+XD6ievZdxLFvn8G/7EP/ADEuXP8Au3+er1Z1xPE2zFLA+LV3+aqKqjxG mrD/AL0DCJEeSUD4b0Tnq9X/16I85dvqH8eZoVGFA3h3+/Kv4U16vYj/AL7aD/fXz1epGYl/yThz 1eoBsRxL6hwBUIKGHDsNwn+Q/wDJJ4IqD9JDJmG/6fjOv08DtCCnjEcS/q3Qf76/+SzxzPM8rdd4 dhvx/wB/PfgOo2oSsu4b/p/CSvUsxhv8tvz1ep5/lv8AMv4c9XqRmYsk/wCn4zi2Kc9XqBz+WfzK v/lOF4T/AL+eer1LL/MnhOG/85b+dYzz1epHZiyT/LcBxn/1KeHdeotH9W/5lj38owrhJRvQ+4f0 TxbEqD+bYXw7oooM+onSX+WUB/308JKN6ADDsNxbDa/+U/8ATe7cBVbqy3MWScWxLAcH57PKOcjp m6M4li2Sce/lJ0vwmzzbQ3yKtg708Z2wrEqHBvu5C+ebamjIqPxl3+U4j48J6NqZs54b/LaD/fXp fnq9VH3UTMn8y6tYzhPj3twY/wDNsoG/83OjK9O8N/5I3j8OFNHdH86d9Jc2Z3r8GwnK/wDv5xnH vHmqOP8AlnVsDekr8NTBsq4fhGbes7fzfGAC38hce6PpPJHyfcxKBJqFM+38AMWVXD0GGU2BUeG4 ZhUa4fhlOCnl2BI0vbX28HFQ3T/z1er3PV6vc9XqI/61fU7hXp96Y4xi7f8AJecA4CQdC1tTz1er Uy6iZ2xbO2fMZ/mn+/o/927/AMl3hvXq9/UnCct/8lT/AIxf8+/7/mO89RRQyZdw3+W4Fg2E/wBU sc/5Kf8AxmsxZi/3yc9Xq6zFiWE4lm3+U4pmyhxr+ff88707wznq9SzxH+bYlQ/zbFP+SzgP/MND MX/OW56vUDg/5gPGMWxP/fzg2Pf+Snh9WqRf9W/9A/m3/MF9S/8Anmsw/wDTX4Q1ug0zF/Wz+ff8 Zf8A4xfUvv8A9iLFuer1NGTcyYt/Pv62YXhX8lzlgOG2zLw+rVA5iP8ANv624zi2Kf75cG/55rLv PV6ngZk/ltfg2Lf84bAf+Ylv/wBg/wA9Xq6/q3hPz+M4TheLf75sh/8AGpy0T/0wOENHFdYjiX9X KD+bf9MHX+rnPUUU85dzscSODYt/Kf5Lg2Pf8xLz1G9PX9dc2f8AOLwmh/nOA4l/xpf+xtgHPV6m bEcNzZhtecJwvFv982O/8w1lznq9SMw3EsWw3/kqYT/yX+2Yuer1DLh2G4thtB/Nv+czgGJ/8aX/ ALG+X+eoop2HTrAfnZKY/PDp8alM2JQ+2lCtuP1Ejnq9X//Q18cxf78v4czQqMKZsOw3+rdBr+XP V6mb/fT8h/v0/t4U16gd6iZj/lv/ACS+EOd0IaDPLmG4tiWO/r7eEWRV6jKnDf5bgPb48HdB6gew 3Ev5b/Of5p93AFQgp5ybhv8AMj/NeBKjehK/37/zD9e1uElepZZdw3CMSr/o56vU9fy7+W1456vV 1/WTCf8AnKf8lnvz1ep5w7onmzO1D/Ns0YtXYL/3bvPV6h9y7knCcNw/+U/6D/vh/wCxZz1epm/q 3/Lf5zi2F/PX+GGc9XqIL1nzthOJUH5c9XqRvSrJJ/8AH9z1eo8OXcN/mVBjP8r7fy3nq9SN6qdN 8J/qkMW/0Hnq9VaWXct/8bzBvhifAVRxW1H0q9N+VM7ZDwb/AH099eG9eotHqq/Dx6hdN6HBuoWV 8J/nWDfDhRRzkeeUDnQjqRi2Sa//AH5/lwF53kdSfkee1dR076s4TiVB35Gn8iqT6EvMWZP5jgOM +3hLRvVBuI4l/wA35xn+HJM/5tlRp/zcquo6D5J/zkY9g2U8r4V/v6x728JKGmeZ5W2l6NvSblLo lgIxVsJH9cGuGzAfEfRyTsiyEWGFY8bwZ/8AnqP7w6oH04c9Xq9z1er3PV6kfnDH0y5g7T/vEbB9 A56vVp//AIkPq0xbqR1Lxn+V/wDMG5D/APL/AMNq9RUMu4l/WOvwb/eHBf8Afbb/AIzvN16jK5dx LCcM/wCNZ/NqHJf8h/7B3/f3jvPUUUMuI4bhOZMBwbCf9O6nYN/zFP8Axof98fPV6gzxHLmLZbw+ /wDWzKvTH/wXf+S7z1epG/1bxbLdfgv80FdnTBv+wi6iYlz1epnzFnbCcNwHGcJ/lP8AyXv+edy7 /wAkLnq9QNjrZhPyGDYT/Kf51/If+Ya/7FHPV6vZixL+sdfg380wj+S/z7w/5zvPV6kbmLMmE3xk 4XitDgtsN/bz1Vzygcw7DcW+Qwb+af75f+epy1/WLh9W66w3DcIw2v8A5tmjFrf88tmXLvCGt09Z iyT/AFbwH/fpi3+/nAf+Mtw+rVdYdhuLfIYNhOKfRpwho4pZf1a/lv8Axk8U/wCYNx7/AIy3PV6m XDv62Yb/AL9sLP8AyQf+MtmbnqKKDX+u2Lfz7+U4X/6kWYeeo3oS/wDmJKDBv5pi3++b/mFuer1L LLudv+Mlg2Lfyn/kg/8ANrcyc9XqZf8Af18//VNsW/31/wC4/wDeF+//AMnbeeoor//Rok/5EPq5 mhUYUjMRxL/QPo8OFNeoNcxYl/p/twbx56vUWnOmI/zHH/19vANneyjvJKEvJeG/y0crkVPUJP8A WT/QO3x4IKD1A7/Lf5ljxwn6uAjPKHFCZh2G/wAtoO/AZWqecO/3219v+cxz1epZYd/NsN/p56vU zZyxL+W0GM/x56vUAPQjMn9ZPUP00wn/ALGXCGjir3Mu5b/mWbcGwkfI4L/zEGVuH1BCmbMX82+Q wbCP9OwXGP8AsIueo3otOcs7Yt8hjP8ANfnvjmLMWJc9Xqq7/wCdkdS/99f/ACRu9+eo3qxPpV0T xbDf5Ni3+g/yb+Z3156iih9y7kn+W0P8p/5LX8hxP/mIuer1A16mcNwnJGQ8a/qv9HPV6qh+jP8A vy6tZN+OJ8BVHFb53oiyT/M8BwbhvRRV+uHdAMp516afynFMJ4UUb1rtfiZ/gxYrkmvxnrd0Gwr/ AHzd8ydOxzwoZ5JVQ/TvMmLZb/305oP08jDPMjqTsjzyjXf52spnAcawj+bW8eBChtVUOHZJzZ1a 9Q+DYT0v/wB/WM/89LyTajDPM8rfQ/DO9E+E9Eco4Nm3NH+/vOWO/wDPRD7+G+S5JAmgXnue/wAw q77DqIYbSeWNSBc8OqBdOnPV6vc9Xq9z1epsxDEVoQCRe+vPV6qcPxL/AFZYR01yFjGUcJxTbnHP f/GXy0B2114aoTAivVqu5i/m2G49g2E/8lrGf+el5avUZbJmG4T/AN+b/nmsxf8ATI56iih+y5/v tr8ZzZheE0ONZy/56XL3/TX56vU84d/vt/30/wCnY1g2Pf8AMM/1i/5IWEc9XqZsRxLCf5DjOLfy mhwXGcB/4y2Zf99vPV6g0w3Esp/1tybhOaMWrup3b/jRZi/5IXCijfPa91V/lOZMetlfFv51g2A/ 9+TAuG9FFA5kzDf5lgP82/5LWM8Pq1TLh2ZMJxLD8Zxb+U/zr+Q8Ia3QOYjiX8yyl1KxbC/+c9ie X/6tfRw+rVI3+W/9jb/kvc3RRSyy7/KfkMGxXFf+c9/xlcy81RvTLiWZMWw3/fTimLf7+cB8eENH FLL+ZYthtfg2LZX/AOSz/LP60c9Xq9h2JYtmSvxnCcU/57z/AI1OWuer1M2I4bi2JXxbC8W/384/ hv8Axpf+mFz1eoNMOy1i2G5twb/fT/Ouer1GWGScJzJX4NlL+bf93TlrMWXeer1POHYbhOJY9g2L YX/zBv8AzC3UrLvPV6kx/V3D/ljl/wDmt6YkMa32MAQB9d+H1E9f/9KiPEcS/wBA+nw5mhUYUGuI /wC8J4U16g0zF489XqLZiX/JeH6+HIsob0ZHDsN/ltB34OKBFc85/wAow2g/m38p+GvG88/4X0Ia R2XcO/mNf/NvZyNKNqGP+W/6B8e/CSvUz5d/35f85b489XqWOHYbi3z/ALRz1ervEct/zKgxnT+d YNz1eos+TMN/q31pybmzC/8Aks/zL/jNcIaOKv1w7/fbjw/mmE/85LL+af8AjRcP6CFBp13xLFsN oMGwnC8W/wCcn/xmuar1V2dZsyfy2g/lH/TewznqN6ZvSr0l/rJmz/fp/vl/n3PV6reP6t5TxLAc GxUYtXYL/PsN/rTz1epGdRP99v8AU3/fT/Jf+7dPPV6q7fV3mT/fD/vz1xnHuer1ED9M2GjEetOT fjifCGjivoZ+hHDcKw3AcG56vVeFl3qRlPLeUsZ/rRi1DguDf93Fwor1EF6qfjp/hw5IzZ/m9zP1 X/nOMdsyf1cw3+ec9RtVEn4oeZPRzmTD8F9Qnpz6hYHjWDY9/wAxL/V3EuFFDrIqpv6NdN+rPqi6 l4N0n6N/85//AJiXMWYv+SFhHNfyKtZ5nlbg/wCHf+G/086A0GD/AMqwn+df9hLmLMVv9+/DigT/ ADytiXJmXBhlDqe+g56iahD56vV7nq9Xuer1e56vUW7rj1IwvJOXcXxaS2/AgC308MmhCa2a0l/U R1+xbrZ1pzjmz+bf75sB/wCMtlrjtapHYdlv/nLfymu/rl/3bvPUUUcjLuG4Tlug/wCNT8jguDY9 /wAxLl3nq9SxyZhv/JZ/3uxrGsB/5hrMX/TW56vU9ZMxL+ZY9jOLZo+ewXJuPd8u/wDTJx/nq9TN /v2y3m3XFqHBcZwH/wAm2X+er1Mv9ZOnuG5DxnFv5TXfybHcS/5hz/pkY/z1eotOYsNxb5/BsJxT Fq4f9g1mLLvPV6kdmLDeoWJYh/KcL/4xeM/9hFz1epnxDDcWxKvxnCcU/wB8ucv+wj4fVqg0/wB9 OI9Nc5fzT/fLjH9Zf+YdHPV6kd/Un+smA/ynC8W/nWMnXnq9Qk4d/wA4bCcL/wB/WDZ8/wCYlt/z icwcIa3SPxD+bYlX64T/ACX/ALuLh9WqGH+W4vhuA/1sxTFv51jOA/8APO8IaOKR2G4li2JYD/Kf +czgP/Gpy1z1FFLLDsSwnEv+crQ4KMe/553nqN6eMNw3Cf59/Wz+bfzrBvDnq9XeHYl/oGcsp/8A JaxnAf8AjU5azFz1FFey7/vt/rli381/4xufP+ei56jekb/Wfp78/wDK/wDOFPvf1e+jnqKK/9Oi PEf97j9PM0KjCg0xH/fb/DhTXqATqLiX1n28Is7rVIzJmW/5kB4n4fTwhyKhFQ+Ydhv+gdvhbg7o PUz5iw3CcRoL+zv93ItzzPKO8koTMvZb/q3gP+/TTgMo8pG/zP8A0D9fv56vU85Mw3FsN/37fynn q9QyHDf9A/6YvPV6kdiOW8W7/Xz1eomuYR/VvqXg1v8AnA8IaOKvDy5nbCP+mTQ4L4a4nw+oIUzZ zxLFsSr7/wDOG/mXPUb1V11ExL+smbf5T3/kHPV6rLfTvkn+W5S/m2Fj/fzgP8gzTz1eo4+I5bwn LVfjOE4XhOmPf8anpr/2KOer1Fp6iZk/lmPYzi2KYvp/2EXPV6qbvWbnXFsSx7B8J+HCPPNleyOk b6M8N/5vTk3/AH08JqOK3tujPUjCOkvRb+tmaMW/kuDYDhnDeiitVz8RD8Vbrd6os2YzhOV8WrsF 6N/881l3/prc9RvVN+I5kxbEv7eer1LTDsyYt2/07h9RPWwZ+Dx6tM2Yb6pemfTzPmbP+baY9/xl v6u8I882UcV9GTp3lv8AltBg1+Vr1GUw77L8KK9Tlz1er3PV6vc9XqS2YsS/ltB256vVrs/iy+qL +pOUv83uV8W/3849w3r1a+WHfynJP8m/mnPV6jkZM/4zeUf5T/KKH/mJcv8A/GdHPV6nnEct9Qst 9WupebML+R/k38y/56L/AJxHPUUUJmXct/zLKWM/73dTv59/z0XD6tUjMOzJ/Vug/lOaMWof513/ AM3nTvDOENbp5zn/ACn+Q4NhOF4TXYL/ANg1mLMWJ89Xq6xHDcJ/3zYtlbFv51/If+Yl/rFz1eoN cOy3hPyGM4r/AKdjWTf+wcPPV6g0w7DcXw2gxn/nNYN/3cX/ADieer1BnnPMmE4bf9nPV6gdGJfz LorjOLYp89jX+/L/AIzX++3h9Wq9huG5sw3Af5ThZ/38YDhv9aeer1d4jmTFv9/P8rwn/kvf8anL XPV6nfDsSzZmOv8A5VieE8Ia3T1/Mv5af+xNgP8Axlsy89RvTLl3Lf8ALK//AH14t/v5yH/5YOeo opZYjhv9W8AwbCcLwn/kvf8Ak256jennDv8Afbh/+/TCb4Lj3/GWPPV6llh2G/1bwHBv60YTQ/zn If8AzEp/7EHPUUUjMRyScN/nOE5Xwmh/kx/41OWv+xTz1eqMcq9PTAmJfyPbtp2i3/47sp+Z/wCB tt+vh9Wq/9TXazHiX8sr7/zb/fzzLfPKi6mTEcS/u5erUWs4lhOJV+vAFQgp6yZ+9+vs56vUPWJf 8kEfQf4cHtB+gew7/e4chWhvQyZi/wB9uA/76/Hw4SV6kZh3+/Kv/wCxMO3PV6jYZdy3hP8Avm/X tz1ep5zFhv8ALbYT/wAlrnq9QZ/79sM/nOE89XqI/wBZ/wDmPcF/3h789RvVomXcyfzL/kl4tQ4L /wCC7z1FFM3WbO38toMZwnC8Wrvb/wAaLnq9ROMmZa/mWbf5t356vVdR0Zw3Cck5S/36YTXf74cT /wDWf56vUJeI4bhOGUH+/TFv6l5NwHEv+M1/2N+er1Ee6q52OG/8lT5HBcZ8Oer1UFdZcyf1kz7j OLfXfhDRxR+fw3um/wDXbrxg38r+vnq9R4vxQ/WNi2ZLenvIeLfyXJuQ/wDmJf8Asbc9Xq188RzJ i2JUAwnE8W/3y4D/AMw1z1epl/mI9vPV6lplz7R+rh9RPRr+lWZMWyRj2DZswvFf9/OA/wDGqy1z 1G9fUn/CO9auVvWR6ZcoZrTF1Gd8AByv1Ey+4uFexAPAVW6uL56vV7nq9Xuer1e56vUW7qhnIYRh mLYiv2UAQfQBbhqhMCK9Wkx6qurP+ez1D4zi3fBsB7ctXqRuHZJ/rGcGxX+bfyT+Q/8Aj956iijk Yjls/wAizl/K/kf5zgOJZfzTz1ep56iYl/Mq7rJ/WgfyXBsey1/WnLXPV6kb07zJ/LaD+qeKYTXf yf8A55rLv/TX56vUsj/vtx3/AI1HyOS/Zl3LuGf7/eer1M39W8Wy3/zcLC8J/kvicw9ROer1MuHY li2JYDjOK4p/yRv+wh/lnPUb0DmYv5tlvKX++sV385x7/noueoopH4dhuLYblL+U4pi1d8OH1aom 2csR/mVfjP8Av2tfnq9Qk5jw3+pPRfpphP8AoP8AOce/41PNZLWs7pow7EsWw3+TYQMJ/wB/OA6/ 1d/7t/m63Syw7DcJxKv/AOxN/wA81/V3nq9Xv+Sb/wB6bnq9SNy7mTFsTzd/nC/m3++bHv8AjLZl 56vUscu4bi2ZKDBcWwvTGcB/4y2Zcu8Ia3Ql5dy3i2G48MWxTFv66fyH/wAm/PUb0ssO/lOJZ8xj CcT+Rxr+vmG89XqecRxH+ZV+DZs/5IuDf8wt1K56vU0f1bxbLn8mwn/Qca/kP/PO8PqJ6Tq4Piwj lxn+a28yrjxL+a377I3W/wBW7hDW6//V0x8O6tZsw2v7fzrknf24om/kdD5h3VrCcS/5Kn++Xwvw a/zz+YUSfySmjDv5T8//ANNrjNO0JWS8t3vw/wAkrdLLOeI/6Bg2v081nf8Ayza9XsmYb7OQzRtX s54l/wA5Y89XqWfRnJOE/wDOV0+nnq9Q+YdmPCTz1epmxHMmE/P9/r56vUjcRxL/AED+U/lz1eos +c+iebM7Y9gv8rwn+S4N/wBhFmLhDRxR48u4liuSaD+U9uH1E9A11m741+vjz1eoTfSr03/mVf8A 79P+SNj3/GW56vVaL/LcW+QwY4oP982A/wDNrepV+er1IzOQzZhuA4L/ALw41jOA/wDjiwnnq9VU Pq7zt/VvKeM/73f7/v8Anof+mvz1eqqDLuG/6BjP/TZ4Q0cVe36Ect/5pfTT1k63f85nHf8AjLZa PPV6q7Ou2G/y3AcZxbFP+Sz4c9XqIJ/yP/Xz1ep+56vUrsvYb/p3s4e5LRRRgMO/328PK1Vun4TX 4h2bPQr6h8GzZip/5tpnz/jK9Ssu8BGebKOK+oJ006jZW6q5Dy51Ayjii41l/MdAMwYHjZUbSjgi /wBXCavUKXPV6vc9XqS2YsS/ltB256vVR7+KH6kP82/TXGcJwvFv9/OO6cNq9Wq3l3/prfzb+S/8 9T/xoebr1HJy5huE4bQZyxbC/wDf3/xmv60/1iP/ACXcX56iihLxH+bf88v/AMlnPmWr/wBXeer1 M+I/1sxKvyb/ACv/AKZn9Vv6xZi4fVqnnDf5TmSg/wCR7/fD/wBdEzFz1ep46d5k/ltBjOUv9B/n J/5hr/sb8Ia3TNmLEsJFf/NsLH9dP5D/AMxLl3MX/OI56vU89RMSwnJNBg2K4p/v6wbHv+ei/wCm Rz1eoAv67H5/+qeKf7+sG/55rMXPV6gE6zdWRhtB/wAajT/sGsxcPq1RTsu/zbMmPYNhOaP98uDY 9p/WLhDRxQy5z619Pc7dWsGwnK+LUONZNwHDf6rf1i4fUT0zYj/Nv59/Nv8AsA8S/qtmX/vQc9Xq WWG2w3Af5RhZof8AfD/z0XPV6kZiOJYthtDjOE/yn+dcIa3XeTMNwnEse/6Yv9fMN/8AHRj/AA+r VD7l3MmE4l/JsW/lP8l/n3/MS8Ia3Sxw7Ev5bj2M4T/oOCn/AJ6X/sUc9Xq9h382xOvxnKeF4T/J c5YD/wAanprmLnq9Sx/luLfyH/fp/wAkbPn/ADEv/gwc9XqR2HYb/Mv5LlLFP9/X8+/56L/pr89X qHL+reXv5wMJGN7sesd2D/8AFb3FqT/g9W/4Hnq9X//W0lMRw3/sU9/bw3oor38txb/nKd+er1PO HZkxXLdf/vr4e/zrMq9Q+5d62YT8h/KcUwn+S8GmR78URfySln/yUsQwb/ft/Ov2c1nue09Ql5dx L+WUHb6eA2jag1/mf9ZM2nCf5T/vm56vUZXJn8py3gODYT/yWsZx7nq9RlsO9N/ULMn8mxXFMVoc F/nun/Gi56vU85d9Lv8AvhwbNmKZsrv9/wB/zEuXcu89XqWeTOkuU8Mr8Z/qvhP/ACXsN/4zXPV6 nnqJlv8Aq5X/AMpwv/f1/IcS/wDYt56iii0ZixLCfkMG/wB+3+/nnqN6JvmLEjiWPfyrnq9VovRn JOLH/jJ/zb+S/wA9wz/jNf8Agwc9XqPDkz+bYbQYzmzFMX/3zZ8w3+q2Zf8AsU5g56vUAfVXEsJw 3/fThmLf75u39XP+mvz1erXw9RGdsW6kdS8Fyn/Nv51/Iv8AjLcIa3S06q9N/wDm/H9U8Lwih/5w GuXeH1aq/TMXTf8Azb+njpp0nwv/AJwOG/1pzNz1eqlX1M4b/vhxnwHhz1eqrnDuw4Q0cU84cdAP 5T8OHuS0UUMuXcN1tf6Dw8yKiiln/Mh7P4c9WqNf6ZfS71Y9UWPHKfS/Cf51/If+YkzF/wBMjhJR vW45+BL618X6BY6PQd6i8XI2+901zDmC2vw14CqOK3Geer1e56vUBfUTMn8tw88NgIr1aYv4mXWz /OR1p/qnheLf75sB5uvUAXTzJP8AoGM4sMJ/nP8Avt/8dPPUUUbDJmScJxHT/pvZH56vUzYf/Nv+ baZsOLUOCj+rX9Vv6xc9XqWX8t/rHQfzbDMW/wA53/PLf8aL/khYRz1epn6d4ZhOJV+M4tmjFq7O uNYD/wCOLCOH1aoHP+MniOH5N6hYXi3+/nHsS/40vPV6lll7MmE4lj2M4theLUOC5ywH/nnf+mtz 1eoMs5Zk/mWA/wBbMr/+JLl3hDW6R/Tv+U5aoMZzZheLfzrx/q7mLh9WqAHMWG4T1Ix7+bYXhP8A 4jvPV6mXrzhv+bfAf80+V8J/5uXj3/MS8rklFIoNelXSX+W/76cUH++b/npf/Bg4e1qjL/1b/wCS Ni2KaYN/zC3UrhJRvSMzF/xia/8AlOKc9Xq9iOJYt/PsGzZljCf+SD489XqeMu5kxb+fYzhPf/nq ctcIa3Qx5ixLCcN/nGLWobY9/wAanLX/AGKeer1PWXBlPDcB/m2J4T/v5/55rnq9Xsxf1s+Q/wCM HhP8lzlkPE/60/8Ae3wDnq9SyzniOLfIYzhX/OGx7/jU89XqZsOzJ/xrcHwnC8J/qXjP/lowDnq9 QlfNyOP5Y2TtmF0+sNX/AMWUU36Z6z/gGiVf+C56vV//19Jf/kf+rg1rVdfzE+089Xqd/wCY/wCn /s+HCGt0zYl/3qa7Be9+er2RU9ZdxL+rf/JLxb+S/Dh9WqGXDurX+gfynFOeoopmw7O39W/+NYfD nqN6Hv0iZk/rH6h8GxbFP+SNgP8AxqeENbq9zLv9U/8Aprfzr+QZl/rTlrMX/Yg4fUT0JWYv+czh OV8JocawYYn/AMxFl3/pgc9XqDbMOZB8/wD8ZfFv5Lg3/MLZl/q7z1eoqGJfzb/fNhP/ACWsZ/5h bnq9Raeon++6vxn+aa/Tz1epG9CMkYTmTHji2Kf+pFz1eq5Dp3lvCcSoP5Thfz2NYyP+bpdNeer1 GuxHEsp4b2wn+dZNz5hv9actZd/7H/PV6qovWZ1HwnLeA4zmz/ktYz4Zi56vVUL6Zsk5T6kY91Lz ZmjKddjX8iw3+tPCGjirFvRF0TwnO3WkZsxT/mDch/8AGpzLw+onq17MX/G1ylnLqxz1erXx9TI/ luUsZ/iOeo3qrbhDW6WuXcN07fTw9yWiih//AOSb9PDyieh+9Kvpc6serTqXg3T3pflOuxnGce/8 lPPUb19DL0Z/h45T9E/QfBsp4X/v6zl/10rMXCSvVVv+IB6XDmTPmDdQel5/kucsB/7B3lq9/PK2 BPwxfWtN1tyJD0o6vxLhfXzIdAgzSJCB/M11u6/EezgIo4q0/MWJfy2g7c9Xqq59d3W3CukvSXGc W4b16tMfEP5t1IzbjGK/8lr+fWHPV7PaPD0Z/wB+P9TcJxTFv+S9huP5Wy1z1FFLP+u38toOjeE5 X/6ZuYMrZl4fVqhL/q3lPO2UsGwn+qf9dMYyHhv/AH4uer1Mv9XP5b/Jsp5oxb+un/du9O/+SFwh rdezFiWLYb/Jv94f5NgOJf1WJy7z1eoNMu5byn/Iemn++n/fN/XjTnq9QaZi/qn/AD7GcJwvFrYN /wA83mL+Zf8AJI56vUj8u5bxbEc2j/fTXfzj/u4uH1aoScu5Jwk/znFsUxb+S4PgP/MS8Ia3SN6i fynpJlLBsWOE/wDGyx7/AJ1rl3/pk89XqKliOJZsy3/v2xT/AH9Zy/56XMQ/5xPD6ieusmZk/mWb MY/rRhNd/v8Av/JRz1eoTMOzJi3++bFcU/5I2Pf8ZbMv9Yv+cRz1G9I3MWG/zL+c4Tin+/rGeer1 dZc/m3Tf/nLfzr+Q/wDMS5d56vU8Zdy3i2JV/wDvr/5LOA/8anLX/eg4Q1ulp/MjiVB/KP6p/wC+ bHsSt/3t+H1apZYdiWL4lj4wnNGLfzrBse/4y2Zcxc9Xqd8RxL+pFB/yPY1jOQsT/qtb/sQcIa3T PiP/ABia/Bsp5X/39YzgP/MNf78+H1ar2TMN/wBAxnNmaP8AkjfzP/x7Y/z1epS/5y6xpzja649F igyBLW+yskBdR9ao3PV6v//Q0lMR/wB9v/JL4b16mrnq9Tp/yUq/+bdvjz1FFZNPhz1V/wCFtcMO 7j6eeo5p5zFhv/OW9nPUUU089RvRxPRp/VPDc9/zbNGLf7+TzeRV7Pa2D8l52wnJNdg2E5oynQ41 g2Q/+MtmX/vQZt4e0EKGT/fThtB/KcL/AN8uDYD/AOSnnq9RN/5lhOG4fjP9V8J/5L2Gc9XqKjmL Mn+n4zit67Bfo56jei0Zi/6ZPPV6jkdCOm/9W8BwbNmKf8kbAcT/AOYd56vVYl0Zw3Fsk1/++vF/ 51jPSTE/605a/wC9BwhrdDN1V/5IOcjlj/kjY9/xqf6xf9Mjh9Wq1jPXdnb+ZZtwfp7hf++XBsBH /MO8I882V7I6GboR0l/lvSXpr/VfNn86xnqz/wAxLl3LvDyvVa7mLLeE9AekuDdEcr/8xlj3/Oyr c9Xqss6h9Jf82/pLybhP/OZ/lnPV6tSj1U/8kLGuENHFVdf8j/189XqGXJmG68PclomzuhNw3Df5 lX/ynC/v4eVuvomfg8ehXKfpd9PGTc2YphP/ADcvPmGf1pzLwkr1WvdRM7fy2g/lP5c9XqI7h2Sf 67Z8wbCe98S/rRz1eoNMR9N2a8O6lZz9QfRwDBs45ExIjLYPiDzxE16rROhHq0wnr9kP+bf8kXOW A/8AMS5c4Q0cVrs/i7epD+ZZt/ze4Xi3PV6qoejOG/zKvwb/AJwuDfzL+q/PUUUcroRhv8yoOmmL fzb/AJIOJ4/lY8Pq1Ql4d03xb5DJv++n+c/1DxPH7256vUscRxPKeGV/8pzRmzHMawb/ALd307/5 IXPUUUzZzw7Cf+cXmz+S4N/vg/4zp56jegz/AJl/WSvxnCf5t/Jf5Dnjx4Q1uvYdfDcC/lOFf8lr AcSx/wD4zvPV6gdw7/fbgOM5TxQ/zr/fn/Wn+rvTvDP+SRw+rVCX07y1m3Esexn+tH++X/sJcxc9 XqeOoeG4ThlBg2LZozZ/Jf8At2uXcu89XqALLuZP5lX4zi2aMJ/42WA/89Dz1FFI3LuG4TiWUsZz Zin/AIrW3/l756vUs8u5J/084Tin++XBsew3/jN5i5uvV1nP/eDBv5Xi3++bPeGf1WzKMxf9N/mq N6DTDv5thp/36f8AiNf+fvnq9TPiOG/zKvwbFjpg3/MLZl56vV1l3DsWy3m3Gf5ni3/MB/8AGW/7 2+Ac9XqEz/fthv8AJv5X/wAln/mFdf8AnE5f56vU7f8AJSx7/N7/AKdgn8+/5hrXhDW65f79sNr8 m/1owj/fz/zC3Urh9WqWWI4b/UnHv5T/AKDjX8h/56L/ALEHPV6nrLuZMJw3/nE/7+f+eay7/wBM nnq9T2arBEwKPOyj/fDU0zmb/wAG2BlhT/k2Zuer1f/R0l+G9FFe56vVwxHDfy8Oer1e/lv+n4z4 89XqesOtiXD6tV1iPc/Tz1epnw7DcJ9nPV6nrXDR/vr56vVYn0I9Y2LZKx7/AI3mLfzrBsewz+q3 9Yuer1XH/wCcjKeZMh/1syvmz+dZNx7/AJhrm6KKBvOeJYT/ACHvb/mH+ar1FQzmMJ/3zYR/Nv8A kg89RvQB5dy3/Mse+rx56vVa70py3/LcBybi38p/4xuPf8ZbMvPV6j9ZMw3+W/yb+aYT/Jc5dJf+ Mt1K/wCxtgHPV6gb9XfUjKfRPIeM/wArxexwH/mGv+xR/wBjvnq9Wq3kzDcW6/dacFwnC/8Af1jO fMS4Q1utnL0Z9AcJyTlHOWbM0YTQ4L/ml/5hr+rvD6iekb6ZstYt1+9UuTcJxT/f1/vy/rTmXnqN 6vC/EQ/lOG9Jf5T3+nnq9Wj16mcS/wBAxm+vCGjiq7MOw3/T7X+vnqKKGXLv8pw3/kqf75eH1E9L LDsyfyzHsGxbCzz1G9fQY/C8/Eg/2tPTTbNHyOC5yyH/AMZbMv8AV3hDW6P7/v2xL+c4tin5cPq1 Tz6eP9+OPdS+oX/TBw3+q2W+er1GU6VYb/LekuM4tin/ADneENbqlb1d52xb0358/wA7HS/Fv5J/ 2EuXf+mvz1erXZ6idWv89mfMZzXimLc9RvQ+5Mw3CcNoP5t/zhsBzLl86c9RRRyMu/yn5/BsWyv/ AL5f6h53/wCed56vUMf8y/5xOKfPY1/z1X9Xcu89XqZ8xYlhOJUH8pzRi1Dkv/wHfTvnq9QbZiw3 Fst0GM4ScJ/3y/zPL/8AVrh9WqAH+sgyTj2M4R/Nv+e48eeoop5xDEv9P/31/wC/rGv5l/zrvLnP Ub0MXTvLZxKg/wCNRm2uxr/u3enf/JC4Q1ukfmLMnUHDa84tkP8A384zj2Gf8w7mLh9RPSNw7Lf+ nnNmKf8APeYb/VbM3/Ypx/nq9Xv6t4tmSg/41GLf8kH/AIy2Zf8Asbc9XqRv9W8Ww2vxn/sQ/wDM S83XqWWI/wC+3/kqf853/jU5a5qjekbnPMmE5joP+7Nx7/yU4/z1epkzF/VPDa+//Ys/5h3hDW6B 3Ef5tiWPYNmz+U/yXBse/wCMtmbh9WqecmfzbDa/+bYphP8AOsZwH/jLac9XqGPJn/Gbx7+bYphP 86wb+Z/+PbMHCGt0Zb+pP9dsfxj+aYTQ4JjP/MU/1i/7uDnq9XWHYlhGJY7g2LZo+RwXBse/4y2Z eer1JDMWG4Tif/OW/wB82A/8w1l3/prcPq1SMxHJH8y/nOE4Xi3+/n/rpWYuer1CCYMJSBKP/nja nBWzVf8A7uCBlh/6i89Xq//S0lP5bi3/ADlO/DevUzf84/8AX289XqfOeoop2w7uPp4fVquWI4bi 3/TJ/p56vU8/y3/T/wDfp/yRvZz1epm/304Z/Of99OntHDuvV1/yTfo4SV6u/wDkf+rnqN6GPpV1 axbpvj2DYv8Azb+dYN/Mv+Yd56iirRcO6kYTnbAf5thf/JG/55rnq9QOZzxL/T/5t/Keer1DH6d8 k/8AYp/3zc9Xqte6d5JOJUGDYT/zhurP/GW/71GYMo89XqMvh3UjFst1+DYtmjKf+/n/AJ1b1K56 vVRJ+Jl1s/3wf5vcLxa//dxf9Nbnq9RA/Qj03ynnbNuc/wCtObK7BcZwHDf605a/7G/CLI6OK2QP 5lhPTb0Pf76/+e8xLw4e0EKMt+Ct02/mWPdS+q/8p/5IOGf1Wy1z1G9GW/EyzthOGZDxkjtz1erR 69RGJf8AOJ/6b2Jdvo4Q0cUTrEf5t/Pv19nD6iehK/5EuHder2I/77dcLwmw56vVsr/8Jzv9+XVn qXlPFMW/3zfy3+tP9XeElerbu6iYl/Vvnq9SzyZhv9W+g2Df9NnPmJ89XqHvqJiX9SekmDYT/wBi zhDRxWpT+Ij1sGZK85Tvfvz1eyKq1Mu/77MP/m38o/5IPPV6rFcmfyn/AJuXi3/Yyy/mnh9RPQyY dhv+n5y/mmbP5L/vy/5h3Ln/ACXeer1DJh2dv5bQfynNGE/1Lwf/ALt3/ku4tz1eoGsxf89lhOV8 p/1L/kP/AI/cW56vV7MWZMW+Q6lYTimE/wAl/kOJYB/xouer1A3mLDf6t49nLFs0f857E/8Annee r1AFiOG/y2v/AJTheE12CDHv+ud/9Nbnq9RrcxYli2W8BxnCf5rQ4L/xmv8AmHcu8Ia3TTl3Df8A QP62YXiv8l/qHhmAZW/723D6tUy5i/lOG/1ywn+bf75s+c9RRXeTMS/rJgNv+cz2/wC9Rz1err+Z ZUw3/fthf/iNf9jfnqN6ZsO/lOJHJ2E4p/yWf+Ypy1mLnq9Tv1VxLKf+/kYXhP8Avmx7/jU5ay7/ AN3BwhrdA9/WTKeZP+cT/OsZwL/y/wDD6tUjcRzti3/JJwr5H+TY/wD+xBz1epZZMw3NmJUGDYt/ 6kvPV6hky7/WzEv+9z/zzV/+cRgHPV6hJw7EsXxKh/qnheE/7+cB/wCNTlrMX/TW4Q1unnEct4Tm TNv82xTCP5Lg2fMN/rT/AOJBz1eoHMxYli3z+DYtmj57+uWfP+MtlnLv/TI4fVqlnh3++2vxnCcL /wB/WDYD/wAxL/2Nswc9XqlCDAxnR8gH5H+q8lQue48xf9KiKyt+bDnq9X//09JT/kpV/wDyVv51 43HDevV3/wAiH1c9XqWWHZaxXEq/+U4Vw+onp5/q3/p4/mmLc9XqaOHder3PV6uP8y/0/hJXq9h3 82xH+cfyv/nA4Z/Wnnq9TL/yUv5NhPs4Q0cV7Dv99v8AOeeooof+lXVrFum9f/2JuH1aofP6x4t1 Ix7nq9VinSrDf6t5D/7HP8z56vVbv0qy3hPz+Mf79rZN6tYZ/Wnpr/3v+er1ddZs7YThtBjObMU/ 5I2fMM/qtmXL3/Y/ylz1erT39TPVr+u3VrGtf+7W4Q1ujw+gDpvmzDch4z1Yyxi1Dgv8gxP+q3/G i5vIq9Vlvqqzt/Lch9NOnvh/LLZl4e1qtiT0AZJ/zJ+jzJuLYp/yWce/41PCGt1Qd+Jl6osJxGvx n/ft/vm4fVqtXTMWZP6yZt/rbin589XqDL+ZfzKvxn2HhDW6WmG/8k48HNE9LTDf+Sieeo3q6f8A A06kf1J9eGTf5pi3/Jey1j+VuElercHzFiWLZ2zbg2Ff9N7E+er1HgzF/wAx5kzKV/8Akg9uENbo AvX/ANWjknKXs56jetN/rNnb+u2bcZxbnq9QmdKum+LYbgOM4tin/TMwDNPD6iejw/zHKeW6/qXi 2KD/AHzY9/V+/PV6hjxH+U4b/JsWyvhND0xybnz/AJ6LMX/Jd4Q1unn+pOLYbQYNi2V/+SNgP/PR Zi/5LvPV6mXqJiX9ZP65YtlfFqH/AHw/1f789Xq7zF/KcS/zlYt/oONYzgP8g56vUDmc8SxbMmPY zmzC8J/kv/dxZi4fVqmbDst4TiX/ACS/+MV/Pv8Ax+4tz1epG5z/AN+WUsG/36/881z1eoScw4lh OScBxnp7/Nv50ce/553hDW6LZ1Ew3FsN/wB+2V8qf75sB8Mu/wDJC4fVqh6yZhuU/wCqWM/zT/fL /wA9T1K/q7whrdc8Rw3+WjBsW/lND/56OH1apmw7LeE4lj38pyvi1v5D/wAanLXPV6vdRMk4thuP f768Wvg2PYn/AMZr/sUc9XqBvMWG5Ty3/Of5X/v556vUDX9ZP5lXjCcL0xnHsN/9aDnq9Qy5MzH/ ADL+Tf8AOF/8/wDz1eoY8mZb/q3/ADjFv5t/Ov8At5XPV6h8w7EsJw3+TYT/AMkXOeQ/+NTlr/sb 5f4Q1umbEf5T/v5xbFcW/wB82Pf8anprz1ep6w7LeE4lj3+/TFv51nLHv+Yl/wCxTw+rVdYdhuE4 bQYzmz+U3wbAf+Ya/wCxvwhrdBmMOyYytAcKrvkIWXEkovbSyAux+ooOH1ar/9TSX4b0UUsMu4bl PEsBxnFv5tbGcB7/APY24fVqn3/xu56vUxeHNZLW64f76ebrVZP+Sbw7r1cf+SkOEedVukjzdapX Yl3H6+PPV6mbDsS/0/GeENbrnw+rVHf9Kv8Avyx7+U89XqvC6VZb/ltBg2K4Wf51jOA/8an+rnPV 6j9Yd/vt/nOU/wDsWf50uh/PV6q7PX/1s/qT00xn+V/857/jU/8Aepx/nqKK1W8RxL+slfwFUL6u p9KuSenuGdFsnZrwv57Gcaz5idszX/5IXDjI6KKH7Dr9bPUtk3Kf/Yy/qsOHtarYO9d3q0yn0B6S /wCb3C8W/wCcbz1erRg9RHX7Futebf8AfXi1dguDcIaOKB3/AJJuA/r7ODmiegZw7Ev9P+nw4BqO KGXLuJfDh9RPSzw7EsJ+f+Hs4d0UUfn8N7Ev6t+tLo3rf/fnfhJRvW/N0Zy3/MupeTT/ANMEa/fz deyOjL4diX8y6tYzi3/TB4QVuqCvxMutv8yx7GcJwvFvu56jeqPcNw3+suPYz/vd4c9Xs9qyzpVh mLZk/rlhOF/7+sZ/q1l/+rXPUUUPv9Sc2f1tOE4X8jguDeOYsxc9Xq59RMt4t8/jOLYX/v6/kP8A z0WYuH1ap4y7nbFsNyHjGE5oxb+d4z/Vr/mIueoopG/1b/3w5y/leE/8l7LX9aRz1epG5dxLFv8A fx/Wj/1Isxf8kLnqN6eMu4b/ADLHs5YvkP8A39Yz/wBvEzFwhrdPOXcSwnDR/wB/P/jS5izHz1eo A8xf77aD+U5X+e/k38s7cPq1QaYjmT+u1fg2E4plOu/8FzLvPV6ljh2JYthn85wnFM2fzr+fYb2y 7/yQsJ4Q1uh9w7JP/YL/APJGz5lrnq9Qa/zLFsSr+38lwbAf+Yl/7G/D6ielnh3/ABia/wD5ER/U LEv/AFn+eo3pG5i/m2JY9/Kcr4t/vnwH/jU/1i/7EHPV6gbznhuLYlX/APTE/n3/ABqf6u89XqAL EcN/3/Yzi3/Te8P+mTj/AD1eoymHf7wf5wsr/wDJZ/7uL/nEcIa3Qy9KsyD+qX9bML+e/k38y/qr /V3/AKa/D6tUJmHZkxbMmPYN/wBhlkL/AJiX+sX/AEwOer1eznknthOF/I41g3/MU9Neer1dYjkk YZQYzhP/AIlPUrMXPV6nj+u39W6D+bfyn+df926P+wf4Q1uoXy+NPkk5AbCf9/1OQYf/AAUpgZX/ AOTol4fVqv/V0xsRy3/La/8AlP8A0weG9FFPWXfDh9Wq9/McWw2v56iimf8A5KXDujennDsN+Hwv z1FFMuI4l/LT/v04SUb0i8OxLFsSr/p4Q1ulpiBwjDf5L/K/r4fVqvYf/vef5p/yR+er1M3/ACP/ AFc9Xqe+Hdeoe/TNnb+pHVrJuLfyn/fPj3/GW4SV6trzpVhv8twHBs2YX/vl/kP/AGEX/OXwDnq9 Tz1E/m2W+mgylkT/AJLOQ8S/rTlrMX/Yg56vVrf/AIkPVr+ZZr/qnhf/AE0v60nms6rdVQ4d/vf+ vx4C6N62DsuYbmzpLkPJmEfzbA/5N/LcAzT/AFdy7wa0T136ROpGFZb6tYz1BxT/AJwWGf8AGa56 vURz13eqLFutmbcZwn+bf75uENHFEEy7hptf9Tw9yWiinvOXb7/489ndFBoM8O/3v/X48IqN6WWH dx9PD6tUtMOxLx+8cO6KKON6IcS/lvqk6Nf+DLwjzqjivozemb/nM5s/6YOG83WqDLOfVr+pOUup ebPZ24Q1utV31M9R8WzJm3GcW56jekd0Zw3Fv+St/Nv5L/Pv5/8A1l4fUT1Yjh2W8Wy3gP8AWzK/ yOC3y1l//jRZi4Q1uh+w7/fllLBc2/8AMZ4z/wBhF1E/5IXPV6nnDj/WT+c4tin/ABtMZwHDP+Yi /wCcFz1eoNcxZkxbMePYzhGJ5T/kuDf1a4fUT0y5ixL+ZUGDYTkP57GsZ/q1who4pZ/8lKg/36f8 bTGcB/8AHFhA4fVqgz/mWE4lQfzbC8W/rpjGA9v+mFwhrdI/MWZP5jm3/fphOn9Ze/D6tUi8xZ3/ AM2+A5MwnC8J/wDEi4Q1ukdl3/fbj3+/TCa7+Ta/8Z3Lv/Jd4fVqjK9O8Nwn5Dppi2KYTQ4Lg38y x/hHnmyt085d/wCMTgP81/m1d/Jv5byteoA+wxjqFimE/wC/n/sHf+xBw+rVO+TM7YtiVBjOLW/4 2WQ//JtgHCGt0tcS/lOG/wA5xbIeuDf8xTw+rVA1h2W82/P/AM2/rZ9BP/OX56vUAWHf8l7OX8r/ AN8uM49/zDf/AHv+er1CZ07/AN+VB/KcUxb+S4Nj3/MS89XqO/0Z/wB9tBg380/5z3/MNf8AYo4Q 1unvDv5t/Xz+tmKYT/JcZyH/AMZbMg/6a+AcPq1XWXf5T/W3+U/85nAf+NT0156iimfOf82w3/fT heLf75sB0zLmL/pr89RvSNw7DeoWG4hjP9aMWof5x/5oOer1Cx/VnOLYuMhtiO2WAGaHM3+PKUpE j1X/AALRqv189Xq//9bTGGJYtiWPYzi3/Te4b0UU9/8Al34Oa1TNiOIj5+3h7eer1e/5KXPV6mbE cS/ltB8Phz1epF/8lKv9lvq4Bq3Szy7iP8t/nP8Avp4fVqnnTmv51W67/lvf+V83Wqx/76eer1Pn PV6nnDsS/lmPYN7eer1bg/p3zJ/nI6adG+tpxb+c/wBfP+Mv1K56iivdd/5t0lyl/Nsz4tQj+of8 /wAq/wDiP89Xq03us2dhnbPmMYtwjzzZRxQadO/5T/WzBf60W/k38z/40nCajerkes39U8t4hg2U 8h4TXYLk3+Wf8Zr+sX/YP8GtE9ADmLqT/m3yHjOLYX/yWce/4y2WuENHFVp4d/vf/NueoooZsu4b /vh7/Xwc1qmXMPZuEedVugz/AOxP+XAXRvSzy724NMloop5w3/e08PKJ6Nh6Q/8Aq5bo3/4MmAfs 4SUb19H3DcS/qT6eMZxbnq9VK3qq6/fzLAf6p4Vi3/JB56vVSpiGJfzLNuC5T4Q0cUeTp3knKeJf ybCf/Bg4fUT0ZTL2G4tiWuF4TXZ0wbAcM/qt/wBiLhDW6EvLv82zJX4NhOKf8bT/AMsWEc9XqesO xLFst1+DYt/Nv51g39WswX4fVqkbl3O39ZP5N/Vf/sGswc9RRSNy7huLYlgODYTmj/f1jH8t/qt/ V3p3z1epG9Zv62fz7JuE4p/v6yb/ANu7y5z1G9LPqr/KcNwHGTf+S/yH+Qf8Z3LvPV6kZ/WT+Za/ yn/kg5l/rT/WHnqKKDT+W/zLHhmzFMWof5NgPbMfPV6hKy7knF/kMGzZlfCf5L/vz8OENHFNGTMt 5sy1m3BsJxTCf982A53vmXMXD6tUJXVX+U52H82wvFv51k3Af+MtlrLv/TX56iikb/MsJw3KX/MW f7+f5l/zcrMQ56vV7JmW82YbplfFf51/UP8A5iX/ALG2X+eo3rvDv94MG/lY/wCS9/zDWXjz1epl xHLeFYb/ACbFsLxb/fNgOJf8Zr/wYOer1FQzFiWE4Zj3sxnHeer1LLLuJZTw2v8A+R7+Tf8AMU89 XqsR6VZJyniVBjP9fMW1x7/mJf8AsUcIa3T1iOW747/Nv+S1jOA/8ZXMuXf+7f56vV1kzpt/p/8A KcL/AN8uM4D/AManLWYv+7f56vVyy7lvCcyf79v5t/vmwH/mGsu/9Nbh9WqZ+on82w3HsG/leLfz r/t5XPV6pHzGd3wg0pwTZm2mI6VrVf8AFmXZwZjWf8AYgv8AwXCGt1//19OHD/5T9Xw5KFE9eP8A KfkMa9vPV6mb+W4ThvCSvV7+ZYThtB/ySeHdepF4j/vy/wB+3ANRxTx/Lf5bb7uer1PmHYb8L28e H1E9PWIf8lBfo/Zw7r1O+Hfyn+X89XqZ8Ow3CD/Of5p/vl4SV6vf8k2g+jh3Xq9/yTa//fphP1cJ K9W1F+F5nb/p2jBsVxT/AJI38z/qtmXnq9QBfiy9WsWy3kP+qX82/wB/OPf8ZXMt+er1axuYv5Tr wjzzZRxQl+mbDcJzJ14ybhOKf75cG/mXCavUcnqrmT+refMZynimbP50cB/5hng1onom3WbMn9ZM 2fyn/pg8IaOKRuXf5T89/vr4e5LRRQzfzIez+HDytUGWYsR/mX/Y64CM82Vug0xHDf5YeE1G9LLL uG/77/ZwaZLRRT1h3++y+K/ynm61RyPRFh39ZPVL0CwjC/8AsJdOer1b23qq614T036LYPlL/nM4 9z1erXx6q4kcNvhOKf8AJZ/5inMvCGjigC6U4acSzb/Nv5TXY1/vy04IKJ88qxTJv++zKWDf8ZP+ dYz/AMaDla9Qx5M/421f/v0xb+un/gO8u/8AJCwjhDW6H3DsSwn5/Bv9+9DjWDf927/yQuer1Br/ ADL+sn9Tf6r/ACOCn+WY/fh9RPTNiGG4thtf00xfC/8Af1/vs/5h3Lv/ADlueo3pY/1bzZknAR/W j/fL/Pv+ud9O+ENboNs54bhOG0GNYT/Kv5L/AL7NMu5d4fVqga6iZk/mVfjH++n/AHzYDhmAc9RR SN6q4bagxnCcMxbTHsT/AK0/1d56vU85My3/AC3Dx/vp/wDFiZi/5IWE89RvQ+ZMxLNmSce6l4T/ ADb/AHzYDiWAZp4Q1uln1E/lGSaDOX80/wCe8/41P9YuH1aotWHf7wYz/Vc/7+f/AC089RRTLiOd v5b/ACb/AH0/zrJv/ML5ltz1eofeneJf1boP5thfyP8AOchf885/01sv89Xq6zFhuE4l/Of6rd/+ elzF/wBMjnq9QCZzxLCf63YNhP8A2LP+M1z1G9EEzFhubMyZt/m38p/kv+/Pnq9Qy5MOE4bX/wAp v/Of/cg56iirQ+lP+/LAcG6e/wDOG/56XMPCGjihky7huLD+c5swvCf9/OQ/+Mt1K/8ABf56vUtM Ny3egxnKWKfI4Lg2A/8APRf92/w+rVFPzFhuE/18ybmzK/8Azgv+MtlrLo56iihL/luU/wCQ/wAp xTFq7/u5Tz1G9I+TJ+cRQ0vStsQ248xqMtw56/x0SzQq9X/wDFV/4LnqKK//0NOD/fThvBrRPXWn yH/Yl5r+S1umbEcSGJV+M4sMWuee/ktepG4jiX8xr/y4RV6mbDv9+V9b83/IqN6EvDsNGG0HDz+S 0UU9f1kwn5/+VYX9PN1qnjDcNXMmPYz/ADT5Hmv5LW65YhiX8t/jfh5WqRuHYlhPs0PbhJXqd/5m P8PNfyWt084diS4dQYzhP+g/7/vHnv5LXqvE/C86kYthvSXrJlI/8wbjuJ83WqrS9d3Wz/O11a/l P82/3z4D4c9XqIKcM/mVcL/I/wDYU6cI882UcUZb0aYblPE8+j+tGEV2NYP/ACzH+3N5Jkk0UUGf UTO1sexnFu/KUb0DeHYl/p/82+u3PV6hNy74cPqJ6ef5n/q8O69SMxH+U/zHgGo4pIc9XqEnDsS/ q3gOM2Gv/dw8PqJ6ReHYl/45vZwhrdXIfg8Zb/rt6w8m4tih/wB82Q8Mx/NPN/yKvVcl1E62f57O rfUvqFin/JG6S8Pa1RG+quI4t8h/2Oce4Q0cUZjoz03/AKt0H+/T/ks/zPL4PD6iejLYj/Kct/8A JUxb/wAV3l3nqKKIJ1W9SGLZk/nOE5X/AOMXk3h3/IqIM7zv+X0AWHda8Ww3/fT/AFsrv98Pa/Bl /Yisfv8AZUNCXkz1IZsy3/yS8X+rMXCX+wtDP/ZVqxP0zepDKeZKDB8p5oxb+S/yDXT/AJy3AXnm Rfy+pOyPO/5hRl/5bi38+xnX/Njg3/k9xfm6G1M2Yv8AflfCcLwn/fN/Vrnq9RUcxZ2wnEv5zhOK /wC+X+fYbl/nq9TN/Vv+Z5t0/wCcB/zzvPV6hkw7+qedv99OF4t/OsZ/lt/6u/8AOC56vUPuHZby niWPf8kr/kvZa56vUDXUT+a5k/k2LYphP/JB/wCMt0156iigD6d5bxbLdf1kwj+bf75v+el/7G+P 89XqEv8AluE/8lbNHyP/AGC3Uo/9Mjnq9SxyZhuLfz62Kf8AJZyH/wAZb/xH+er1ey7lvp7lugxn Ce+Tf+wi/mX/ACVueo3rvMWW8JxL/fTinyP85x7/AJiXMX/TI56vVXXnM/zLHv5Thf8A00+er1LL p3fEse/m38p/5yX9Vuer1WV5MxLFsyV/8p/lNDgvTT/mFctcIa3QlZMzHi2W6D+tn/OZGJ/83Ky7 /wBiDnq9XL+u3TzLf9csJxPFq7+pv/MU5azFw+onpG5dy3hPz/8AWzC/nv65Y9/zDVuer1M2HYl/ Mq//AKbWDYD/AMZbMnPV6gMfE+oLeoynwJs2f6LDQzdPoK72UMksUjj62Reeo3r/0dOHEfD6+ShR PTL4cI86rdBniP8Avyr+EmeZ5RvXsOw3+ZV/f6ea/kVeoTcO/wCM3Qfs4OKJ6ZP5l/Mv+SX+fCP/ AJaFbp8/luE4bw8rVe56vVxxLuP18eer1PWHYb/Lf4cJK9TL/wB6vh3Xq9/LD7fz4SV6rkPRn1Ix bpL6S+smLf8ATexL+tXPV6qVcxZkxbEsexnFsU/6ael+ENHFI3EPD6uWzzZXqP16ZzhWHdF+smFY ri9Dkz/nqMtZiN/Dmsioooj2YsSP/JJ5qjembDsN/ltf/v0HPV6hN/5Jv/OW4fUT17+Y/wAtwHGc JwvFuer1IzLtsSx7Bv5pi9Dgv/gxcIv5FRxXWHYb/p/+/Tx735qvUs8xYb/vh/5K3D6iekZh3ca+ PCL+RUcVft+E1lv/ADb9JevvqExT/pm/1Vy1w9onoZMmYj/VvpLg3/TZz5if9acy89XqReXf+NHn zGcW/wCmBwho4qxT+smFYb/OcJxTFv8Afz434fUT0DfqKzJi2W+mmM4Thf8Axi//AC+4tyuSUUiq uR/Nb6/lzIPJMjrnvnWeZjxoS+nfRPqF1IP/ABlsp131cJd+O1PLN3v+LqGW4/ZXme8P/ENCX1E6 BdWOktB/xqMp12C/93FwF5H2qZZmH/ENSdnnZZmWX5bQaZdzIcNrz/Dg1/khoF5Hnn8vzOrqehHX 7+slBg2U8U/39ZywIf8AMRchismsirvMWJdQsSoMG/lf++X/AH24+eaoQ0DeI5kwnDf5N/vpocFx n+W2/rFz1G9PWXct4TiWPa4TXf7/ALX+rv8A5/eer1GT6VZcwn5/pp/xk7jHv6wZW5rO87oj/klP eIYl/UnIeDYT/Kf5L/vy/qtmXm6dpG4dkn+rdAMJ/m3+/nAf+Ya/8F/nq9QaZdy3/Lce/m2F/Pfy b/nmsu89XqZsOw3CcNzbg3/OaybnzDf6rZl/8GDnq9SyxHDcWy3m3Gc2f8kX+Q/8ZbMuXf8Apr89 XqWfTvDcp/P4N/NMJv8A9g1l3nq9TL1myThPz+M4TheLf75v+elzHz1eog3VXDcKxH/fthn++X+f f8ZbMvPUb089O8NwnDf+Spi33c9XqP10Zw3CcSoMZwnFM1/yTJmPf8ZXLQ56vUZXLv8Avsylg2LY XhP/ABssB/4yuZf+xvz1FFM2I9Jcp/1Dxn+s/wDzgf8AjU5a56jekbl3+tmW6/Bv5X/zGePYZb/v Uc9RRTyc7YTkjAcZxb+qf/GNwHDf+NLz1eqnBcaxFMBmz/8A1xrnqqjG4s0Cl/4rWFJITR/8H5u7 /geeo3r/0tKwYl/LV4NM6oopHfzL+Zf76Pb48BdG9PP8sGJV/wDNsUN/G3Dj+RV6ln/Mv6t/8kvh 7RPTL/v1xL6ea/ktbp7xEYThtBg1v9/Xs5utUiv5l/Mh+fNZLW6WuHfyn5Ec3Wq6xHEh/wAkn8ue r1PP9Zf9A/lPf+Q89XqZf+RD6uer1djvg30c9XqPB12xLFum/p46adJ/5t/v5x7/AI1PCGt1Wvwo o3rHiOJYT8/3+vnq9R4sSxLCMuej7B8KxPp2MDzicTuOoWYb2xX4C5PDeimiQ8KKNqePbw4yKiin fDftYx/vdw9rVIzEcS/mNB+XAVRxXtv/AGKeer1CXh2G/wAy/wCSXhNd/wB3Lw3oorvMXbBOHudV 6kZh2G/6f3+vhFXq2csxZb/zJ+jzo30Rws/yXGM+f8anMvD6tUAOYsyfy3w/5IP/ABlstcIaOKGX 075Jxb+Q4z/NNP8Afbw+ono/eTMt9sWxQ0OS/wCff9hF/wAl3Fuer1MvWbop/wA2lzli2V8p/wAl /wB9n/PRf8l3nqKKpvy7lsYlj+DYSf8App8mf+dmsKv7Df8ADP8AI1s4Zd6S4R/VLJvSfphmz+pe M4D4Zd5x53333/4Zfnr6uwu4+4/8vyymbrvh2LYl0V6l9EesmbP66f1Dw3+tOWcxcGnZXnn8u3ly 38jRL2p5H/y7Vax3/I/9XOw1cSKsU9GmJD/OXgvh35j7vvWZ25FHiznmTFu1/wDfz/xoOE1TVQA4 d/xpKDBs2YphP8lxn/sIv/PFz1eo13TvLeLfyHBv+cL/AMaXhDW6ErDsNzZhuA4zlPC8J/51LmWx 56vUWvqr1IxbMubf62Ypi38lwb/mFsy5d/6ZPD+iekaP84P9Q85fzT/kjZD/AOMt/WL/AKa/NV6l nl3+tmJHBsJwvFf9/P8ALf8AjSf9ijnq9Ql4dknCcyV+C/8AOF/n3/GW/wC9Rj/PUb0jcxZcxb+f fzbPmLf7+ch/8ZbqV/2N+er1e/lvULLQxn+V/wDJZx7/AJhrMX/TJy/z1epZf1b/AJblLBv5oP8A jG/9hEf+m/z1FFEE6iZbxbDf+Sp/4k3PUb0jsNxL+Zf76P8AnNHDOer1H66d5bwjDMBwb/ftXYLg 2fP+Ya56vUd/oziX9ZP5Nmz/AJzOQv8AjK9Ssu8Ia3Xs54lhOG/8kvCv5zgxxP8A4zXPV6kb/UnF st1/82wv/ks494af76OHv86oi/ktBr6mcyYt/mWxn+V/8wbgOGf1VzKObp2q/hl3bk6TKP8ALsDb z5U6h/NDNV6aPylaP5Q1PgX8zcF8dvw56jev/9PR7/mWLYl/vpsNOHP88Fep5y7lzCcO7m58b8O/ 5LRSSTXLEcS/Px5uq084dhv1nh3Xq9mLMn589XqRn/JS4SV6lnh2G/y064tw7r1e/wCSl9HDevV7 /km/Rwor1POIfym3PV6uv99PyH189XqeuneW8JxLPeTcp/8AOGx7Euw4SV6nn1EZ2/rt1Lxn+V/8 wbgP/GWy1z1eoAP5l/LcPxn/AKY2PcIaOK8f+cNhPPV6j9epnEv5b6eegXT3FMV/385D/wCed56i iq6/+RD6+eo3paYdhv138OH1E9O+YsN/ltd/KRi1+ENbpHf76cS+PPUb17+W/wCrz1epZ5d7cPcl ooplzF/vfz2dV6jYejPpJ/nI679NMp/8lrBsB/41OZRzdaq5Drvnb+u2fP5t/wA4bIf/ABlstc9X qADDsN/rJm3Bsp+2/LV7PKsuyZknFsk4CM2YZ/vm/kOG65i5WiijL9KsyYthv8mxbC8J/kv/AIET qJz1G9CXnPDf5jQZy/5zX++z+tP9Yv5nz1eqtD1E9AcX6cZuxjNmV8J/4xv/ADFPNZJQIzvZRl+n frY6T4lkPBsJ6yZTrv65YD/z0XTr6OYx78dh+Z5hmf8AkNZB7j9uGW5dln+XUWn1detgdWqH+qWQ 8J/kuTfj9PMguw/6c/7Pf5dfVjJ23/UZ/Mct/I2VV2Ydh3/TUHMtv55WFlXU+jPpvhOG5S/zhYp/ vlxn/sHuYx51/wAtKs69x8j/AOFtNGc8t/7/APGf6r/7+cZOJ/8APRc3Q3p5y7hv8tr/APfX/v6x nAP+ei56vUa/Dsyf1b/rlhP8p/5yeX8089XqWPUTEcWyTm3OX8rxb+pf+dnDbc9RRRN/5b/XbNuM 4tmj/wAFbqTz1ep5/lv8twHBsJxT/f1b/mG8u89Xqecu/wApzJXnCch/75f5Dp/3t8wc9Xqeenf8 2y3X4z/Wgf8AGNz5/wAxL/2KMf56jenrOWJfy3+TYt/Kf51nL/mFcy5d56vV1kz+tmZMB/qn/NtM e/52VmL/AKZPPUUUJedM7f1b/wCMnmfCv+baY9hn9VstH/pk89RvVdvVXMn+n4NhOKdv+YWPPV6g 0yZ/vyx7+U4XhP8Av58eer1H5w7EsIxLAcGwnNH++XBse0y1/V3nq9Ql9KupH9W6/wDzhYphP/MB /wDGWzLl3/prZf56iilnh2I5Tw3HsZzZ/wA8b/zFHTbnqN6GEYbi3yA/mmbK7Gs458/8lPCGt0Qj 1d52wnJOQ8G6T5Xxb+df78v+NLw+rVEsXDMO/lU2Ea/K+fHf/wAGHY/PV6v/1NMjLuHYT38OShRP XuEler38sPt/Ph3XqZMRzIMN/t4R/wA6rdI3/kpcIqN6WeG4b/LO3D6ienrDv9+X668O69XsR/32 /wBHPV6mjnq9XH+Wn2/x56vV7/kQ+rnq9Q+dGcSwnJNBnLqFf/fzgOG/1Wy0f+7g4SV6i1Yj/Nrf zbnq9TJX/wBHCGjivZdw3+ZY9g2E/wCnf7/uer1Hh9budsJxKv6N5TwvKX9S8ayFlr+q2Zeeoooj 3/JNoP5ta/x56jenj+Zfy3/v+89RRXZ7Yz/vd356jembDsNH8h/m3h/M+er1POI9z9PPV6hMy7/v BbC8Wrv5zw+onpGYj/vyx3Gf5pzWdVurd/Qjkn/Nv0Wzl1Ywv/ks58/4y2WuEVepZZzxL+ZY9/Kc L56jejL+nfJOLYbbNmKYTQ41/wAxB/zEXD6iejw5LxLFvn8GzZheU/654NgP/PRZi/5IXPV6hly7 hmE5kwLGeoX/ADGmcv8Anmv+mFz1FFCVh2G/74c5f9NnHstW56jembMQwn+fZywn+U12Nfz7LWX/ AOrXPV6iz9VfS708xKvxn+V4r/xsv+wd6ectRJ/JaKjiPo5xbDdMz9Q/9/P/AGDvDcb8fy6owzzs r/mFDJ089JeU+m9f/Ns+/wC/r+Q/yC/PZ5nmZ5hR3kfZZluX0Zbqrh2E4b/Of6h/75cG/mV+AipQ oqOHfzbEq/BsI/lP86/kOJa/1d/5IXD6tUd/p3h2E4b/ADnKYxb+umcv6tf887/yQuENbofsvZ2/ luPYzi2KYT/OsG/q1z1eoA8xdWsJ62Y9/v0/5I2P/wDGWy0OH1E9I3Ef5TlrHv8AOF/Kf98+Pf8A GWzNl3nq9SOxHEsJy5X4zi382/42WPf+Snm69Qx5d/lOG5SwbFsL/wB8vUvHsM/5trl3mq9XeTMR /mVBg2LYphP/ABjc+/8AGWzL/wBinH+er1CXmLEsJ/kP82yv09/42X/MLZl56jekZiOJZTyT/JcJ wv8A3y5NwH/mJcxc9XqZuomJYTiX/GsxT/f1g2Pf8Zb+rvPV6ioZ0w3CcMx3GcJ/5LQ/5hbMp56v UjsmZkwn5/nq9Rrsu4bhGdv+Yo/3y5Nx7/jLf96nnq9RlelWW/6uUFv5T/O85ZD/AOMtmXLv/TWy /wAIa3Qm5dxLKeWycJxTCf51g2A/8arprw+rVMuYsSxbLeA4z/Vf57+uWfP+Yl/7FHPUUVTh6qsR wnLfVrBsJyt/zwf/AGEXPUb0uPJw49KDiTYT/vsVBFDRe2iNy5/5CC89Xq//1dODEP5t9fx4NaJ6 7w7x/mf134d16kZnPE/9P/5JP8l+PCPO87rdIz/fvhtf/wBjnAOEVG9POHYbp7b+HD3JaKKE3Dv9 9un8p+vh5WqZsO/m2G89Xq9wkr1d8O6KK4Yb3P6+PCSjemf/AJEP+R7vz1ep5xHMn++HBspj/kjf zL+tHPV6kZiP+9x+nhDW6Zv5d/LfHtwoo3padO8UxcZ7ycFY4wMDxLbl0A6YUL356vUZX1/Zjypm X1EYzmvK2Lfzv+e4ZgBzLb/pvgX4b0UiibYd/vyoP+R7nqNq9/LP9A/X7+FFep5xHDcK+Q/31/Pa cN69XsO/5IQ+nnqKKWWI5kxbEqDBsJv/AL5v5l/Wjnq9XeXf97h+vt4fVqkZ/wAlKv8A5R/2M+EN bq/Xp3/vt6S4Ni3/ADhsh4b/AFW6a8Pq1QA4b/xo8e/lPs7cIaOKtf6M5bwn5DBcp4XhP86xjAf/ ABxcPqJ6Mqct4TiVf/v0+ezp/If+edy7/wAkLCeENbp6w7+tmI49/vrwn+df8Zr/AJ53h9RPQ+/1 k/rJlLBsJ/5IuM/1a56jembEf5Thv8l/mmLV18ewy39Xcu89RRTziGG/y3Af9+mE/wBS8Gx7/mGs u5c/5LuLc9XqDXMWG5T/AJDjOE/1T/kv8gwznqN6RmI5k/lv9csp4p/3b/PUUUjc54ji3z+cv5Xi 38lwbHv+ed/5zvPV6kb07y1m35/+U4p/vl/7t3LvPV6jX5dw3Fv+baYtlc/7+c+Yb/VX+sXPUb08 9Vc7YthuQ8ndPcU/3y4z/Lf+NKf+mvz1FFAHiOG/y3Af5T/Kf5LjOPf8anprf/nE5g56vU85d/m2 Zf8Aft/oJxnHv+MtmX/vf89XqDPMWSf5lX4ziv8ANv51g2A4n/xpf+xtmDnq9RleneG4v/zlMJ/4 2X8t7nhDRxS0y5iWE2xnFjhP8lwXPn/PO/8ATJzBw+onp4w7Df8AT8GwnC8J/wCNl/zC2Zcxc9Xq 7xHLeU8SwHBv+wNyH2/7G3PUb0WjEf5t/If5sMJ/nWM58/7CL/nEc9RRQBYj/KcSt/NP+cD/AMZb MvPUb0GmXcSwn+tv/Ym/56Xnq9R4cOy3/WOv/rZimE/yXJ2Pf8Zb+rv/AHb/AD1FFGu6d5bxbDa/ +bYZ/v6zlkP/AJ53/pr4Bwho4p6w7Df5bX/8kn/fNj3/ABqct8Pq1TzmLDcWy3lL+U/9dMz5/wCS jAOer1USZiw3CcR68ZywnFP9/X/dx89RRRnvMw5sjnLLf8kuLChhMOXf+lJ/ff8A5OReeo3r/9bT h/5Jt/y5KFE9M2I4l/dwkr1BliPhr9X8y4Q0cU85dw3Q6fTzeRV6hNw7/fbQW/mvBxRPXsRxH+W1 /wDHnq9TN/LD7fz56iiuubo2/nlPX/JR5qt11/Lf+ctb+S34SV6mbEP94P8AfXz1epGYjiX+n/T4 cIaOKZv5l/rc9XqWWmJYD/2OcB56vUJnpmP/ADenJ2LYphP86wbAcSt/V3hRXqWPrdxHKmJepfqV i2Q8p/1KwbHv+NT/AFdH/OI4b0T5HRUP+cf+vt56jinnDsN/0D6fHnq9TNh2Jf8AJZwk/wDJGx7n q9Tz/wAiH++znqKKev8Ako4Dw+rVPP8AyTf+9Nz1ep4ybknFsydS8m4ThXbHsT4Q1urkuquJf1bo P6p4Wf8AfNkPDf6rcPq1TN0ZyTi2Jf79v+cz/wA81z1eq0Tp3/vt/wB9P8p/nX/du5d/5IXPUUUb DLuJfzKgwbp7/N/+cZmD/mHeer1DHl3pvhOG4Dk3+V4tf/fZ/wAxFz1G9BpiOJdPclYDk3FcUxau xr+fYZ/Vb+ruXf8Aku89XqEv+ZYthuUv5t/zrHJv/k956vV7p3iWE5byH/Nh/wA57DP+ei/5LvPU UUDeI5kwnDa/GcW/lP8Av5x7LXPUb0jc54ji2JfznFsTxahwT/fbgH/Gi56vUWn+W/7/AL+bfzau wXBv/J7i3N0UVYj0Zw3Cv59kzFv5T/vmx7+f5W4QUcU9/wBXMW/kOTc2YWf+dS4nmDK3D6tUAeYs SxbqPjuDZsxT/f1jOA/8w1l0f85bnqKKDPqJlvNmJf76f+S1/P8A/jU5azFz1eoTMNy3/p+DYt/y Rv59/wAxL/2KOer1PGTMNwr5/wD41H/JF/65rlwc3XqebYt8/wDynK/0/wBYuar1PP8ALf5lX4Nh OF4T/vmz5pmX/sUY/wA9XqWWHYl/Mv8AfTimUv5KP5b/AFWzLz1ep4yZ/Nv+Yr/07BcG/wCeay7w ho4pHdZsk3oP5Thfh/zEvD6tVWnnPDcW/n2n++X/AJ5bMvPV6vdKct/zL/kqYT/v5wHE/wCtOZee r1WWZMy3m3Espf8AGown/kvf887/ANMnAOer1LLLuW82ZIoP5TlfFv8AjZYD/wAw3mLMX/OWwDnq 9Ql4dmT/AJI3UL/QcawY/wDGp/q7/wBj/nq9XXXfO2E5JyHnLqDb/m5ePaZaPCGt1rtdGcNxbEs+ Yz/NO3/MU68Pq1R5loP9+M9N/XHfnI1sT/Kf8V2jkHyf/B33f8Dz1er/19SrMXTfqF/zi+e/txRN /OzRacxYbi2W6/8AqniuLfSeFFHNPOHYd9Z7/RwYZHkdezzPKE3Dex/Xw4eUT13iX+8Q4d16kViX cfr48JK9Xf8AyUuer1PXDuvV1/WT+W0H++vhJXqZ/wCZf1kx7/kR/wDBdy7z1errET/LaDGf9+31 c9RvQZ4j/vf+vw4Cq3XqD+nnq9Xv+9Zz1eoy3ozzJi2WvUP00xbC8Wof98OJf8xFz1epG+qrE8J/ 2h+sv8rxb+dYNj2Jf8xFz1eoAf8AkQ+vnq9Szt/LaDBvhz1e/nte/wCSbX/768W56vV7+Zf6B+fD evU84d/vy/nPCivU0/nz3/LOr1HF9ImW/wCW9S8m5sxT/wAGnhvXqOPnPEf6yY9/Kf8ApvePPV6j yZM6b/y2gwbCf5TXY17cu5d4fUT0cbozkn+ZV+M4TimLf75vDLuXeeoooy+Xf5T/AD7o3/Vf/kjD DcwZWzLz1G9M2Xc7Ytkivyb/AFo/5I3/ABoP6tc9RRSz6VYl/MqDGcJzR8jkv/u4sxf8l3nqN6d/ 6yf6f/ySf983/YRdQ+ENbpHZi/qnnavwbFRi1d/OTlrH9OH1E9I3p3lv+Zf9+HLX/MQ89XqR39W/ 9P8A62f8kX/fZ/zEWYueo3rr+pP9W6/BuoWF/wDOexL+qwzFmLnq9Rrv+SbgOC4T/Nv9/OA537Zd 4Q1unvqrmTCct47jXT3K+LfyXpp/zFOZeH1aoGsu5kwnLdfjP/TZx7/yUYBz1epG5i/4zePYz09w s/75se/41PTbMXPUUUsv+Mn8h/WvNP8Aznv+ed/7uDnqN6RYxLNeJZt/5K9sZx72/wDOI4Q1ulni OW/67YD/AL6/98uDYD/zDQ/6a/PV6lnh38pxH/fthfz2C4Nj3/MSj/pkY/w+onr2Yv5tmT+TYrb+ pf8AIf8AmJP+xvz1G9PGXcSzZ8hjP9aMW/3849/zrXL3/TI4Q1uu8R6kYtlvAMZ/mmLfzrBv+YWt mLh9WqIL1EzJ/Mv+/wDf+xBz1er3Tv8Am3z/APKcU/5I2A/8anqURz1eqxLLv82y3gODdQsUxb/f zjv/ADEuXf8AsQcIa3Syy7huLGgxnKf82/3zf8xT01zFz1ep6yZ/KcMwH+bYp/zgf+Mt/m7/AOx/ w+rVE3/EQzsem/RY4te/UvPnPV6q7OhGG4T8/g2K/wCnY1/Ieer1HCXIeEmrmwpcV/40a49HQz1v sryjlB9ahuer1f/Q1Q8xdbcWxIfynK3/AKkXCXI9x6KKAL+W/wCnfDvyTslr1LT/AJJvDytV7/ft hmIc9XqZuer1PH8sHt/PhJXqDP8A8buHderl/Mv5lb9nPV6nf+ZH2fx4SV6u8u4bi38+wb/ftXc9 Xq9nT/ku4x9XPV6gzxHEv5lr34Q0cV6g/p56vV7EcS/0DvXfA8KK9Q/elXE8Jy3136aZrzRhNdjW DfzP/jSZey7f/fsNeer1Iz1M/wBU/wDPx1K/qHhP8myb/M/+M1l3nq9QaYd/vB+vx56vUscR74L/ AN639nDevUjv/G7nq9Tz/LP5ab4phP8Azkv+Yd56vV7DsN/0/B+byKvUJeHZb/rJm3Bspn/pp81R RR4elX+9+M5s/wDEWPPUb0ZbpVhv8yzd/Wz8/r56ibPKtG6d4bi2Jf8AGTxTFv6l/wA+/wCwd/5L uL8PqKaMtiP/ABif6m/1Xwn+SXxP/jSnLvPUb0zdKv5thtfk3FsUwmh/k38yx/nqKKecO/rZiWH4 Ni3+g4L/ACHEswH+sWYuer1LLEck/wC+H+bZXxb+S4z/ANvEzFzdepmw7+U/8YzFv5tXZ0xn+Z/8 xFzVepm/mX9Y6DJuK4Z/0zcwc9RvTP8A12xb/jG/76f9838t/wCNLz1erjnPO39ZKDBv6rj+dfyH /nov+cFwhrdCbkvDcWw3AcZ/3uxr+Q4nl/8A5iLh9WqEnDv5Thv+cv8ArRhP8lxn+Zf8ZrhDW6AT qJ/NvkP5timE/wAl/wCwa/7G2YOH1E9ddKsNOJYDnL+af8kbAf8AmJcxc9XqZ855bv8AybCf62f9 3T01zFz1G9IzEc7fzKgwb+V4T/OsZ/8AN/z1epZZdy3i38hxnFcUxb/kg/8AMSZi/wCmtz1eoY/9 +39Q/wCbYXi38k/n3/Gp6a5d4Q1uvdO8S/0DGcWxX/ki58/8lGYOer1CXh382ztQf8bz/nA+z/nL c9Xq76iYbmz5DBsJ/wCS1nLHv+Yl/wCxRgHD6tUAWI5byniOA/8AJVrv5Nj/APxlv+NFz1FFE4zF lvFv62/ynC//AAVueo3pZZM/m2G/76cUwmuxr+Q/+Tfnq9ViP8y/q3Q4Ni2KYT/Ov59hn/Gl/wC9 BwhrdD7l3+U/If5vf+cNj2Gf1p6a5i56vV3h2W8p/wDMWf8AOZ/56XLv/dwcPq1VOH4mWZMp/P5N wj+bfzrOWPYl/wCOnnq9QZ9CP62YbX/zbC8J/wCS9/zDWXeeooo6xy9hzYSk3lba+KnbCjjP+MyM rir/AOA2bf8Agueo3r//0dPrDf8Ae7GP18ODWievfzL/AED+U8O69TN/M/8AV56vU8/zHF/bz1FF M3PV6njnqN6RmJf72jhJXq5Yjhv+gfs56vUy/wDJSH+/Tvz1er2G/wA2/wB/H+/b+S/Tz1er38tx b5DGfDnq9TLnPLeLZb/5Kn++XhDRxTNh2G/6Ba/18KK9TL/yIfXz1eo5PoRxLFst+ofJuLYX8j/v h8cxc9XqBvrKMKxHrT1K/lY/56XMHPZ7RQaRv8t/0D9nPUb08/y0fIa/84HnqKKZf5b/AKf+3hvX qaMRxL4fXxz/AIZV6njDu443XqH7p3iX/GtxnT/nG8Pq1RlcOzJhGW6DBsJ/6b3CGjirFOjOSf5b h+DfyvFv5Jg2A/8AMS5i4fUT1ZZ0qyT/AC3/AJjz/jF/9g0P+c7i/PUUU85MxLNmJY7g380yn/Jc GwDMv/Ga56jehLw7Mn++HBv94cFxn+suP5p56iiu8u4l/Lf5N/Vf/jafz7/romYuer1PH8twnEsB /wB9eLf10xn/ALuL289XqRvRjDf6yZD6aYtmg/8AJexPH+/PUb0zZew3+W/1NxbC/nj/AMxBz1FF I3Dv+SD/ACjFMJ/rnjP/AGDv/OC56jennDv+SDjJ/lP86/kP/jiwnnqKKONiOW/5llLOWEZX/wCc 9hmAZp4Q0cUj855kwnEsewbCcU/5I2PYZ/xmsxf9j/h9RPTJ1ExL+Y/ybCcUxb+S4zj3/kp4Q0cV zy5kn+WYDg2bP+eN/wDLvw+rVIvMXTfCTX/1TOK/zr+Q/wDGp6a8Ia3TPh3Tf+slf/NsLwmuwX+f f8xL/wBinh9WqWWHZaynhtBjOLYWP+MZgP8A5N+er1LL/ft8/wD8ki+M/wDMU5ay7/LOboop6zFm TCfkP5T/ACn/AHzZ88f+mTj/ADVep4w7Mf8ALaDBsWzR89/XLAf+MtlrLvPUb0y5yxLFsyf76cLx b+S4z/10rMQ4Q1ug26q/9MnNGU/5Lg2Pf8ZYcPq1VdfUPO2LYbnzBsJyv/vlxn/mFjz1eoy2XcyY tfBv5pi3/JB/8m+YOeooo8PTv/fbgP8ANs0f7+sZ/mX/ABpf/Bf56jejLYdhn8tvhN6HGsGx7/nW uYv+mTz1er3UTMn8tyl/WzLGE/8AGy/5hbMo/wC7g56vVrHdZv5T1H9Q/wDKf+czgP8AzEvPV6jk dKv62ZJ/30/85nHv+Mrf/pkYBz1FFGh+UywcIODf883GRkM/S4LD/lXnqN6//9LT7w3sf18OShRP THiIwjDe2LfXwj/nVbpnw7DcW+fwbm61T1w7r1PIw04bQf089XqZsR/3v/5Hv1tz1er38uxbEa/n q9TL/wAk3hJXqZsRxL6zz1erlz1erj/WP+WYDjOE/wDTe7c9XqDTMWJYviOIf8lbgKo4pY/8k3Af +Sv/AMl7hvXq9h38pw2g/wCm1jPCj+eV6h+9GmKDLnXjJ2LYmlbjODYGb5ky6L/79fhqeG9eoGus 2JZTxLqXnH+q/wA9/U3+Z/8AGavwpzyvUjcOxH/kjXxX6ear1LL/AJEPq4b0UUy7v+xtz1G9d/y3 +W4D/Nf5T/vmx7w56vV7Dv8Avu/nP7OOf8s+vUssu5k/q3/OcWt/yXvDlf54KKKMt6Zst4tnbPZx bFPHmsio3q/boRkn+ZY9/vrxb+S4MP8AnouHtE9Hezn/AL8f99OF/PfznAcy/wDMRcIa3T5l3Df5 bgP/ABl9f5Bnf+q3D6iekblzLfT3Eq/Gf99NdjWcv+7i/wCSFz1eoSsu/wC/Kh/lX8p/nWM/+SLC eer1e/mWK/8AGOxbNGLfzrGcBxL+q2Wv6u89RvXsu51/503lP+qf+/n+suPg89RRQa5iw3NmJfyb KWKCuwX/AH5Y/wD8w7z1errJeWsJxL/jJ/8AOZwHT+ruXeer1PWI4bi3yGM4T/Kf982PZa56jell l3+bdJcB/wA7GF4r/OcGz5lr+q39Xeer1Bnl3EsJxKv/AJTimE/75sd/41PTXMX/AGP+eoopmznm Q4liGM5TzRi3+/n+Zf8AGlzF/wCaTnq9Q+4dmPFsNoMGxbFMJ/3zd/6u/wDTIwDnq9QOYhnbNmG1 +M4ThY/5IP8AzrXMXPV6hjxHMmLf1Rwb+q/zxwbPn/GpzLmLnqN6d8OzJixwHBs24XhND/2C2Wsu 8Ia3Rl8R/m2G4D/KcUxb/jZH/jU5a56vUjcRy3/WPAdMp/75s+f8w1/2Kcf56vUj8OxL+ZUF8Uwn /m5fjl3h9Wq9/Mv5l/ySv+YNyHpmXnq9QN9RP5tmSv8A9+h/kv8APsM56vUQTDsNxbMmPf8Ae+7H /pkZg56vUa/LvTbFvkP62f8AOGwH/mGsvc9XqNhkzDf6t/yb/nNZy/5inMvPV6h7/luE4bQYN/v2 rsFybj3/ADDX/YpzBwhrdI/1EZ2/qRgOcs2ZXwn/AH849/zEvD6tVq6ZLxL+snXjOX8r/wCSz/M+ er1WvdO8RxXDf99P/Ja/7CXMXPV6hu8uJcHFf/Kf9KliOFih9oQhCfq389Xq/9PTGxHERhtfwafz qiimjEThP89xn+V4tXY1g3/PNf1j5utUs8u/77f9+338O69Tz/yIfXz1epl/5KPPUUV7/kpV9v5v z1G9e/mX/fl56vUj+er1cf8Akf8Aq56vVwFr4z+vhwj/AJ1W65f8iH1c3WqDPEcS/Lx4Q0cUtMuf aP1cPqJ6ZMwfu/Xwho4offRnmPqHlv1K9NMX6X4TQ50zjp/VrL2Yu2vPV6g16yn+ZdTOpeK4p/vm xn+Z4/7ovY81XqSHCmvUsMvf734Nw3oopl/5H/q56vUy4dmT+W4DjOE+GPa89RvWTnq9Tr/yUq/B v+x934UV6rqvSJ03/q3kP/fphNDbvwa0T1ch0qy3/vh/m2Fj/fz/AMZ//mIuer1GV/rJ/p+csJxT KX+/n+suAWzFwhrdLPEMt/1JoM5fyvCf51jP9Zf60/1i4fUT0GmIn+u38mxb+bf10zl4Zdy7/wAk LCOeo3pZfy3Fst5Swb+tGLf8kHE/+Yd6d89RRSN/luLf8xZlf/kjZDzx/wAw7z1G9IzEcyf6Bg39 aP8AnA5l56iiu8O/m2W/+xLg3/YO/wDOdxbnq9Tzh381xL/jJ/zahyX/AF8/553L3PUb089O8Mxb Da7o3/Wf5HBcm/yz+q2Zeeoop5zFlz+W4/8AynC8W/51L/xqf+/Bz1er2Hfyn/mE/wCbf75se/41 PTXMX/TJ56vUjcRy3/MqDBv6sf7+sGwHE/8Ax75g56vU74diWbMt/wDMUYR/OsZ/56X+rvCGjiuW XcOxbEqD+qeKZT/42OA/8anLWYv+mtl/h9RPTz/VvCfkMZxbC8W/kuTf+ely5z1eoS+neW8WxLAf +StbGcexP/jNf9innqN6ErMX9U8yUH9U8UzZ/wAbL+Zf1py1mLhDW6WWHf78v99PfBs+YZf/AMSD nq9QCZi6b9WMS/30/wA3ocFzl3zJmLh9Wq6xHEsWxGgxnFsLxb/jG5Dw3/x789XqKh1Ew3FsyZtw b/nC4Nnz/mJT/wBj/nq9QN5LySTj2M/79f8Akvf89F/0yOer1GvxHEsJxKgybi382/5IP/GWy3l3 nqKKGTD87f1JoMG/7DLAf+NTz1G9Guw7EsJztlL+bZXxa+DY/wD9jP8A5JHCGt1XZ6/+v2K5b6af ynFMWof65f8AMLZl4e/yWvVRL6Vf5t/v5zbheE/7+cexPm61VyOTMN/4yX82wrCf+MdgOv8A3tsw c9XqFBc8YiuJT57/AKp0PyM1bFmIUPtx6KOSMn6vM56vV//U0lMR7n6eG9erul7H9fHh9RPQmcO6 9TPz1ep4P/OY+vnq9Sg56vUn/wDnPc9XqQ3CSvVI56vUz89XqZcO/wCSfjX6+PPUb0iOAqt0M+Hf 8k4fTwa1qgbxHsfo4Q1urAvw+v8Aq6fp5/3vP2c9XqLz1M/53T1C/wC9nj/PV6kXl3/kn/r7eer1 PeSP8pz1epmm/wCSh+vs56vUzZl56vV7/nH/AK+3hRXqWWUfs9Pvr4cZFXq2I+g//MKZW4e0T0fv Kn/Mf5y/8R/+HPUUUZnGv+YmzH/3s8v8IaOKWPrG/wCSLz1eoMvQl/zpcfXw+rVe6w/8wflj/wAG XL/K5JRSK9h3/Me5y/72WActRtQbwf8AMYdQv+9nzdFFCtSf8lrmqN6CXpH/AM7Zyd/3/wDm6KKM Fnr/AJhyl/72XPV6ueI/8x/k/wD8FU/w56vUX/Gf+raYf/Bw56vUMXp5/wB5+m//AHouer1PUf8A zq/qT/3s/wBnNUb1I6df8xX0w/7wuer1OebPtZp/8Gkft5uiinpP+SlS/wDgrcIKOKRGCf8AMV9P v+95z1ep3zF/zBmWv/Bq56vUdJf+SZ1K/Xx4fVqi1U//ADD+Qfo56iiix9bf+Yxy1/4NPPV6gByz /wAwr1y/73v7eeo3oXMvf8xX0k+vnq9Rz8z/APMDZD+n+jhDW6xemrvgH0Dh9WqrY/Fm/wCdZ5P/ AO95z1eqrj0Jf7wYL+vgeer1Xa0//MP4B9XPV6ngf8wG3/hRx/yqeboor//Z ------=_NextPart_01C8E823.DA10E9A0 Content-Location: file:///C:/8E69C634/Classof2004_files/slide0108_image006.jpg Content-Transfer-Encoding: base64 Content-Type: image/jpeg /9j/4AAQSkZJRgABAQEANQA1AAD/2wBDAAoHBwgHBgoICAgLCgoLDhgQDg0NDh0VFhEYIx8lJCIf IiEmKzcvJik0KSEiMEExNDk7Pj4+JS5ESUM8SDc9Pjv/2wBDAQoLCw4NDhwQEBw7KCIoOzs7Ozs7 Ozs7Ozs7Ozs7Ozs7Ozs7Ozs7Ozs7Ozs7Ozs7Ozs7Ozs7Ozs7Ozs7Ozs7Ozv/wAARCAD+AK4DASIA AhEBAxEB/8QAHwAAAQUBAQEBAQEAAAAAAAAAAAECAwQFBgcICQoL/8QAtRAAAgEDAwIEAwUFBAQA AAF9AQIDAAQRBRIhMUEGE1FhByJxFDKBkaEII0KxwRVS0fAkM2JyggkKFhcYGRolJicoKSo0NTY3 ODk6Q0RFRkdISUpTVFVWV1hZWmNkZWZnaGlqc3R1dnd4eXqDhIWGh4iJipKTlJWWl5iZmqKjpKWm p6ipqrKztLW2t7i5usLDxMXGx8jJytLT1NXW19jZ2uHi4+Tl5ufo6erx8vP09fb3+Pn6/8QAHwEA AwEBAQEBAQEBAQAAAAAAAAECAwQFBgcICQoL/8QAtREAAgECBAQDBAcFBAQAAQJ3AAECAxEEBSEx BhJBUQdhcRMiMoEIFEKRobHBCSMzUvAVYnLRChYkNOEl8RcYGRomJygpKjU2Nzg5OkNERUZHSElK U1RVVldYWVpjZGVmZ2hpanN0dXZ3eHl6goOEhYaHiImKkpOUlZaXmJmaoqOkpaanqKmqsrO0tba3 uLm6wsPExcbHyMnK0tPU1dbX2Nna4uPk5ebn6Onq8vP09fb3+Pn6/9oADAMBAAIRAxEAPwDzFUjI X90mfpT0gjdwAiZ+lMQk4AxzjNWIELPtDd+tdSRm7ly3s4NygwxtjvtFaCWFrnm2hx/uCorZcNyM VfA79q6oxVjO5FLZWYAxaw8/9MxUJtrRVGbWHPf5BV1V3g1j32sW1q7xqDJIODjoPxok4xV2NXew XNtaD/llEv8AwECqZjtgSSkQXPXArJurue4fdI+QeijoKSOaQLtDcVxyqq+iNFB9Teh+wOdojibH ogqYx2qcraxOPZBWbaNIxAjSMepOTj8qmuJWiPMoJ9EXml7VlKCLYFjJ8pto1Pr5YqCS2tlBzHGo x1Kis37ROz/Jnd602e6mcr5i5K8cHmmq3dCcOxpW0EB3Hy4m/wCAipxbW+4EwR4/3BWVbtMCGQE5 6itOKXfGJNvAODTjUXVC5GXre2tsc2sP4xirosbPj/Q4PqYxVa2IbnPHpV9MMmM812RSsZ6lWawt B0tYR/2zFVnsrQHi2i/74FaroXTHGR+tVJIyGGKHFCuVY7O1/wCfaL/v2KsxWNnxm1hwf+mYpu4B gPzqxG68jBoSQEa2ForYNrAf+2YrN8Q2ltFYo0dvEhMoGVQDsa3kUEg9jWV4mjb+z0OcjzgP0NTU S5WNbnMod2MDAA5rRsoj98CqEab8Ac1uW0WIwOeBWNNalSJ4VA5x1qw5K4A6d6I0zt61HqNz9ktZ JQASBhR7107Igz9Z1YWqG3gYeYw+Yg/dFcy4OeTnPf1pW+dyzEsSeTQudu7sOvNebUqObN0rIYRm poITK/pz7Um5SQfyxV9LZXCyhsnuGWsy0aGn/uiUPyD/AGlxn8qhukSWc7EPJ6mn2txGreXIq57H bmtK0sFupslgq9elJsuMblK00tiDISwA9Bx+dZtzAFnYOzKOxxmu9EcUdi6g7u3PNcpqNogc4Py+ vpUqVy5QsU7C0mYF4JkbvgHBH4VZEgEpMqDkfwMM/iKhjsZ1bfE3zLzyKfcCWRdwQK3bHr7g1Zkz RsbiB22hutayIFXpXFxSvBcBnQq2cMOmfwrsdPm+024ORuH613UKl1yswnG2pYU5iBAAI61WfLZP erAO1guKHCtkYwa6TMz2j/eZqxGgK571F0JyO9WoSMc8+lJASxoRg45rL8Uf8g6PHH74cf8AATWy jcDaT9Kx/FQ/4lsXH/LYfyapqfCyomDZIC6kZPvW3CigCs+xh8uEHOSwzWpEgwAamnGyEydB+BPS sDxLPuaO2VuPvGt4/dP865TVplk1CQqxzGNufeprytAqCuzM+4wxznrTwu/IyAfSl25GeuelSpDI AMcA9+tedc6EiEQsp+Y4HoavWsrQAZT5T69KsWcDORuX8SKti2ZztCjHfHNK5XKNW1E2JEBHvWpZ l0G1V+c9AOtQ2emT+aqhNqscda6fTbOG3ukSQhs8cDHNZzkjaEHchhtXi04+YcuecfWueurVzIw7 /oa7mSESM+1eMY4rK/s4SzMu2s1OxvKF0csY5kiAjUlR/Ce1Z1x1yUdD7NxXV3lrNalyq/d5BIrM lMkpLGNDkdV6mt4yTOScbGI0r3Eex42ljQfexyv41s+HZtxkiLZ24IPqKz5RPE5MKFT3GMZqbRiI 9QRtpXzMqR6Gumi7TRjLY6eWPc2RzimMMdV5qyi8j1xjFLLERwADmvROdoz3AkGMcetMQbDj3q68 C7OOv8qhETBgD+ZoESxjBBPGO9Z3ijb/AGPER/z3H/oLVr+TgAdyOtY/iobdKiX0mH/oLVFT4WNb le0j2wKSB0GKuRxrsLMSSelRQRkRoAewqwQRxjiqWwiCR9iE46Vxjt5sssjDqxP612UoLKQemDXI FMbyBxuwAK5cVsjaluOjh3KAMBe9atlYNIwMYJwOtU7SMFl46kYrrdLiIAGOP515jlY7oQuJFpJE YDoxX0FaVrouAFxgEg/hWnHA0gBRTVy3Vd4TPJ4/CsXNs6VTSKEtkkYURr90jmoIYGN/GO+/rWnd N5beWoyCc8CoLBWfUVOAerY64qbl2NZbJY0B7mqJRbe6G9cKTjOK39mY1yCBiq81jHLGQw6/pSEZ M1sqF0IDhxxmuSuLZrW4faowD09jXfvb7VVc5wMAmuU123MFyzEZVhWlKWtjKtHQ5a8l3SNgZ+na oIH2zwuoOd69evWpp4trYGOfeqrrsmh+Y/K4613wep58kdvHCNw57U90ypxjNP2kwqQOccmnY3IO Oa9QwKjwv5YAXNQLA27kcVfHUKKjkDBjt6mgVhqYYhMHNYnjGMppsfp54/8AQWret2x1rH8aKP7J iPrOv/oLVFT4WOKK9uv7tCRj5RipGBPzZ4pIgRCh6DaKcMMSBV9CGQSjgk5AxXM3EOyacdl+aulk JyR1Fc/qboL5xyNyciufEK8TSm9STS41lQE8EdK7DTE2YzyDXHaH85xnk12+nxfIozXjVD1aWqud FZjcnXHFWEtlDggEkDmqlo5UgNx2q9bzgnDdjg4rA6iJ41lcBcbe9WrW0ihfdHGAxGCTVeORfOZV 52kipmvUt13SOqgetJCehdKFhyScdhxTHyhHWsObxnZRM0afOw9O9VoPFaTTAMysjdAeoquVkKaN yWTL4OcVja/am8tGwP3iDIxWnHcxzx5Dc+neomVizVKbWpbSkebTrhMPwVNXvD2jJrF0wmYiKPBI B6mrPiGwWCbeqkA88Vq+D44rCx+03EmElclcr6e9dcqnuXRxxp/vLM0JLcQzLCkKoo4DBiSeOhzS G2bO4Dr1FX7x45rhJ4MbGIOPQ1G77QOcZ611YCbfNFk4yCSi0ZyRbZQCOtSXFuqpvByfT0qdSN4O OnU0242uCVP3eor1DzjNiZVk2nrnpWR40wdJh56Tj/0Fq1yitNnHNY/jRMaTDjvOP/QWqKnwsaGA H7IpJx8oqIN5TZYnmrMhP2VDx90VRlYkDPWtTMJWLKxAx71gauhYxuAd2eo71sTSFY8ZrLvAZIm6 /L0rnrq8HYunbmVyrpkxtzls4zzXS2viTyQAuGUng1zumWf26Qw5wRmtjS9OhjmO+LIzjOehryZW 6noQUuhuL4pIkLlA6DGcdR6VqaT4lsru+ZC+xnPCtwc1n2+kWNvL57RFmPIGeBWJqUEcWqW80SbH aXse1ZSjF7G8HUj8R6WbXfI88TDDAcH1rA1PT7i/lBlkPljjg4H41u2U5FkF9qgdXMTIvKsfyrnT OlxucpdeGljsJGt3LTBvXOR7UzTvDFzcRmV/Mh6bATn611NvaNE4EgPXvWtEpK4CqB9K29raPKYu iufmMnTrG5tggmbkdDjOa02QryemKsLjueKiu2CRZFYM1Ssc3ryjyQxGfmxWnYoLPREjnUFXjJ5F Vbtx8oZS25sCrg8y5htoTGWhHLMen0qlJ2sHKua5X03JtCcfIr/Ln6VPlWXpk4qe8iFtbcDaAuAB 0FU4HDxFs8jtXqZfHSTOHGu7SEjk55A4qo8+HOR16VZCYfA61XmQiTBHSvUPPZAh3yF898Csnxoc 6NB7Tgf+OtW0qKntxWD4xz/Y0Xp9oH/oLVFT4WC3FABtYwc/dH8qouhYnAxg1d37Yk7jaKrPIMNg fjVktFC4zn6Vn3H3Cc8VpzyR4IycntWTdsDHhc8nvWM2JIbptx9kvVfPB4NdxaWkbIJIzhnGSO1c AwIQMR+NdPo+oyyJHGp5xzXj1YtM9ajJM35WeBNpIJPQelc5c7pNRjHVtwroTHmMsx7cmuftiJdb LfeUHArKPU6JrY9Asyv9noBye9SoFIBX171BaI4tVYg9OKX94OV4FYM6DTD4Ayo570oKlucjvVZb hk2Fh8pHXFXd0Tx7h1NMmw0yqvANUZnLuST1qWXcDkVVnbAGO9LdgyF4w3bpV7T5ZUtVIXMe4jjs aqsMRZz9aqPcTRbfKmZFUcqOhz600tCTQ1i6BVYNwLMcmqsSEH6is+F2llLvlie5rXAVYwR1xxX0 OHpqnTSR49afPO4wACXHekuIwTuUc0qffyRnNSyYHBOOK6DEz5Ihziuf8ZLjQ4f+vhf/AEFq6eVC w4HPtXPeNl26DBkc/aBn/vlqip8LBIrrGTbBm4+UY/Ks+5fDbRjIFWvPIgUeiis6RjguTyTVshkF ww8zAPas2U7pcBhwKtM264LnoBVNASzHsTWExItQwrJAY3Geau6Ogt78oSSMZFQ2xECADA381PF8 lzFKP720n61hXpqVNvqdFCdppHTzlhbEjpjOa5K0uG0/VQ0qMV3ZrrLpX8iAY+Qgs2Kwra7gk1GR WK8Nxu4zXlR2Z6lR3aO1stZiuIFjiYlT2NaUdsXwzsSvXA4FYyKgt42hZcgjpWsl3iIZdcY6Bqiy NbyLkyLNHtzj09qiV9g2sORVN70kkR8+gHNJFdi4k8mSN0c9MipZSZckYEVRnPzjFWnBjTDHkVVZ ScEA5PAqQbH7fMUAVVgtxd6l5P8ACzgHHYd60Qqxwls84p2kWxS0vtSIO2JGVfdiMVpTjzSSMqku WLZjRKIpfkwUBIx7dq09y8AjtxWdGoZWbPHfFW7V8w+WW+YevX6V7VCdvdZ47JFG5iKkZN3IGaaD 5YBJ4qWD5unY11iGtGVQHHJrmPHgU6JCQP8Al5X/ANBautmQuNw7elch47GNGiB/5+V/9BapqfAw MZmBiRQeSozVKZ8/d59qssQIQ2cDaBms6SQqVCjqabMSN22Ic4JPX2qNV3dMY9qbK25gi8jvVhFC xDJy2elYvVldB+OVUnkDGK0orRpoCoHJHB9DVCCPMu48sTW/a58vGT9K0ir7gmW9E1Hz9Muba4H7 6JSMe4Fc/GI2ug7KCjeo6VNqM0Vlcfa4Z0WQjY8eeWFVdKmSeZkJyOtePWo+zk7bHqU6vOl3Ontb W2WIOxwD0xmtixt7ULlME+oFZNkMjyz0rbs4VXhSK5G33O5MtJCijOKhu15SVB9x+vtVwLtHPeop JEClDjFQDZE4eZlAz6mpGTEqD+6tEBHLg8VGZfMlJzkDrQSTuj3DpbwoDJIQoArW19ItJ8P2+mxk ZdvmPrjkn86u+HtKMC/brhcSuMIp/hX1+prnNfuxqurSFXIij+RDzg468120YcquzzsRU5nZbIzI guPkIxjk1CVfZhzkHjIPSpGR8MpBBHGVodxHFgcHr9K6EcrI7e8kU+XcNvTOAa2LdweIyCvr61hE qeSApHaporp7c7o8g+hHB/CuiFW2jEbzDEZx1rkPHwJ0aJsYH2lf/QWrpLfVYJn2SERsRjLdD+NY XxCUf2FAQOPtK9P91q3lJODsM4+5kPkRgnOQKouTJIDyBU0h3BcnoKrysEBb+LGKtmAxVBIyDx71 OjCRwoPCjtVRCQmD1bvTkJjJCn5m7+lZXsUlc0TcQWahnYluyjqap3uu3U0XlxsYU9F6n6mm/Z2Y Etkk+tVJYTzwR26VlKo3sWkVXlZjlieferOm3/2S6V24XoTmq0kLJyRgVG6ELyuBXPJXWppGXK7o 9S0m6ilCsrAgjqK0TcNb3IXqDyCK8x0mae3MP790RyRgGu0trC8uFEjXTyLjgk81xTppHowruS2O pW9DjBPA61n3d2JZNsZyBWPOzWsog3kkjJ5rT0+3knZI4oi8jdFUZNZuNtjTn5ty1FJL5eCcDH51 1fh3w+7Mt7fJhfvRxMOvuas6H4XS1K3N+BJN1WPqqf4mujYhVJJAAHJNb06VtWclWv0iZHibUhp2 luFbEk3yLjqPU1w0Ufl42tuzyeOpqbXdUOqa0WDEQxHbH6fWmK+Dtc8AZ4/zxXUjkGzRlhkHlv4f QVUmbysDbuB/iDdBUk8oY43nB74rPnkJD4bCheue/SmkSRNK4dwnIXqPrUscrCMMepHSogyCP5gd 54LetLywGM9OCKBolzHIpzu44weAKxPFhkTRYY2kbAnHG7I+61ab8HAbk8EA9axfFRb+yYQV/wCW w5P0and2Ay9pChiedoqjcNvkEa8A8mrrsPKBJ4xVKFTJOX9OK7ZdjFDpBt2BOTjFSxoB2+tIEDyF 8jCjt61NEnmOTg47Vzzd2WloKZVSeOIctIwVc1of2dHEvmSHcx6N6Vl3I8uWGXaPlkHOfetnULhf sm4HAXmsyjEmhN3f+VGuVjPOKm1OyWLTmkdcYAxitPQ7QLbNO2CZDkk1neJrgLCIR1duntQ9gN7w t4PXXtDj2HZLtJVvftV61F/oVy2n6jEUdPusejD1FSaF4og8I+Ebe4eMSTyL+6izjd7n2rntV+JO p6/G0F9bWuzcDGyJhox6A55rGUOZWNqc+VmykMmpeKUt4IzKXQYx0Hua9f0TRLfSbVVRQZSPnkPU /wD1q5z4cafpx0ODULVN0kw/eOxy24dQTXb1MYKI51XLQSuV8ba2bOy+xQOPNmHzH+6v/wBeujvb pLO1kmkOFRSSa8mnum1fVJrmZm+c5A/ur2rRGRYs1woZlB5yRU0uEO5XI/lTU3AOu0KyjGAecZpW fc2VIzjkEflTJKs7skxQImFGCSe1UJyB8oA5IyRzVmVUzkvxjPDYqg7rIflwRvx+lUgHDATO5gT0 p21OcElj14qMYJCBWGPepA+58ggKeRk0mNCJuld12D5cY4way/Fxf+y4sgAecP8A0Fq3EDHnG3uT isDxYGGmRcqAJgOn+y1IDk01B2QpKvXutWraSMIXV9xI6VlBiMUoYhgRwR6VqqjW5PKjZ4WHA+85 rRhVkjCRxu5xjgZ5rm2upQRlhkDg12vh9kfToR5ilgvJHPP+NTcZlXGnT3EeceUqsCSaS6JlaO3z g55/xrWv5ggxngHoOlUNLgM14Z9oIXgc0CNqKP7PZjYcBRjkd6468jk1PVljjyymTy1x69667xDd Cx0klVHIwvHf/P8AKs/w3pTLJbylQZGO1P8AaZurfgDQMxPFG4XKJk7Ix5cY9FFZECZcEVu+MkEW otGOiuRWZp9rJcyxW8IzJM4RR7niktxs9A+F3i1tG1M6bckmxumHzdon6An0B6V7jnjNec6f4R0/ Q/DzWBUTXE4/fyHufb0ArotFvp7C0XT79y2wFYJmP3wOx9xSkuoJmf4+1UxWiWEZ+ec4OP7orlbV DFEOME8ZIqPV9SOreIJZgcpG2xOe1W13AEyKPLK9P60JCY07g7HGWAzx0x6UPMhBcrwoyAeuabLI v+rAB/HORVV18yXaqYGR93+dMCC7mYxZjjBeTgeuKoxvvHkqhzHnL9t3fFaVzsjUqgAYD76849vY 1Wit5FLHfwBxgfypoVyJmYJtyAehzU9uoEY4DZ6fWoGHzbx948deMVNDnYMBhgZwOcUmMtg8uCwH fHX/AD/+qsTxao/seJiQSbgZxj+61bHzlehUACsXxWP+JPEFbcBOv4Ha1K2gHCDPHenqvfFOiTH3 h24pxJY9c00gYzbznPNWLO/uNPmEkD7fUdQfrVdiN2zv/Kg/dPPI7035AdE+pC8tg4OG6Fc85rod CstkIYDkDce3+f8A9VcPppAv4gx+VmANei7l03T3kPAAyfy/z+lMRzXiW6F/r1rYg7Y4iNw6gV2H h+BH1fzSAIrC2HToGP8Ak15xpU5utcmu3zwGbIOMdv610Fx4l/szw9NDAQbq+kLMfRRwKlMZheK7 hLnV52Q5Acms6J3Qq0bFWUgqQcYPrUE5ZgCxyzHJJqSJuADimtwPe9Fuft2mafNJJ5jywrJI30FV /G2oi10qO2UjzHGeOoJ5zVTwNID4VtpWP3Y/Lz/wL/61YHiHUP7V14gEmNDhfoKTBCaXC3l7wGz1 BrWLERfLwV6ntj6VDbxqEBYEMvB6dcU92KqI2YkJnnHP096BFa6RtwYDaeQADSRljGsJABbJbipG wv323EL171VuJdxG07S3bHagB6MruyKuQo9OlJgAEEMFA7d6kjQJGZGPbgj+RpEfKsoJDHhs07gU ZmyBuU59GOPxq3aJhgFGTjsTz7VTul/eBznrxnvV+zBMTlSAMfKDzQMnkWQ5CjOSPlArnvGCldJh +Q/68HP/AAFq6RlXlgW+XjAPeuf8YknR4mZME3C4yOeFal0A4VRhBgnp3pjMAuM89jSGQYwDyR0p qpzuc5PYU79EA+KM5yD9TUm0bc9PwqMtgjd17AGnn5ioZqaAeu5WBUnIOciux8Vami+H7dIyBJcq CxHpjJriupwM89Kt61dGW5jhHC28Sx/iBzSbsA3TH8m3uJScBiq9OtQSyfabnexO0cL7ChyE0yNe N0jsx57DjmoY8Ip/nUoY64wTxxQnAXPcUzPmMf0qRYmluY4kBLOQoHuad9biPT9JvzY+CLK3Vtss gaQ+y5OKo6ZGXd5mBYMePeqs0mzFpGSQgWFfoox/PNaMqTJpsnkrt2oelMHoi6l7ZRgq067+hXPS plHmjzN4dOx3fpXO6VocupRG4aYpHnaMLk/Uj0qTS7qWy1FrNiGG/YRnjPqKfutuMXqtznVSWjlG yexrTgxblGRl9xPpUdujSNvZN249PUUtwd8+3hj7DGKtoq2sLO2dw6dev+f5UjcrTGOJzAnT72D6 +1LEFdWLAhyeMUuY5XXAbOO465//AFU4K0ZAYNyPmpiM3UfMUqFULz1IrR0rm2O4D5u5FVtVQMgc Bgp5Ge1WNIZSuMHbkAHPWkxl+aNYlUqAW3dMZB/GuZ8auiaXEu8Ze4DY/wCAtn+ddVLBskBUksPv dwPwrjvHHMKoCAscqquO/wArE/0pdAW5w6RYAOctj8qQsEBAOSe9PdtgAwQSOuKSKE/ebFO/RDER Mcnqe9L0PH6044JwBS4GOSBVCFgIEys+MJ83T07VWkZncsTlicmpJTt6VHkFTkc1EmUizejbFaxH I2QgnI9STVcsNmAKs6ntW6RVzhYUA5z/AA1W9ux61NwHImGUngetamgwhtSa5PSAbh9e3+P4VmA4 59DWzpCFLKV1+9O+0D2qhG/pcQnlM7jcBwB710lum6EqSWTGTu7fWszR4TFFtC5CjJzWwiRg4iOX Ocg8ZpiM5rS8tY3GnThEc/cZc7T7GqunaW1nIbqd1dxkqp6E+pNbkrqiMcbs9CD0qjcK7uQqlefm 9KFpe3UhxUmm+gtjH5rlyME9AO9WLuRZT5YLYXG7d/EamWFLe3DIoBHQEdTj/wCvVXyWEqruBwPz 96CmNi2yFwOQoxtAqy0Z2odzgr2x/WmRhRkqMknDGrKNtKgnknrj9KLgZupOZEADEIOgx0osBmJF DYGc5Yfyp+qxBQHicDPbvU2mQhbcHdjB64oGaABXcSS7dwRjPH+f1rg/FLm5smmJ/wCXoKMDggK2 MV3lxMILGeZ1HyoT6dP6VwPiBX/sCBmySZwSfwak9hnLu5k2tK2SBwPSkzkcZqLzC2FqXgdB7VUb W0ENcdCODTDnoeakPGTjNRH1psYk25gXxgfWojnGMU6UjA70SEgY9etZtDRZ1Fc3xwRxGg6Y/hFQ MOcnpU2ohvtp3ddicZz/AAioW+6D3qUA6EBmweM8V1GjRCaVVjG7Yeg9a5QPk5HGentXfeF7NYLe M8FiN31JqkDNtFCqFJKhcbmHc1PwUd8EnGR2+mKVlVIkbkeY3HPQ0rqVITjcBk+lUQRSlk5IA9Kd bhpZQXbnBCjpuqMtvG8jOPXrU4Q7SxxuI4IHY/16UAE4EqhUfndtHvTJoJDJiMAHGODmkCByNhOU GcN0p6x7nZ84PTrnj/IoAfFbsIyPm5GCw5qwpG053HqF4ohISJQScvjkD0p8kbZ3qVCMfu89en9K QzG1LajIGVs5HQ81o6XzGAD0PfvWfdAvdAsRhTnGPatKzlSNl+T5WbbgcU2BD4mmEWm+SgXdcMFy a5fxNGE8P24PUTjr/utWr4puGk1eztCOEBYnPWs7xYCNEhUAcTrzn1VqHsM//9k= ------=_NextPart_01C8E823.DA10E9A0 Content-Location: file:///C:/8E69C634/Classof2004_files/slide0109.htm Content-Transfer-Encoding: quoted-printable Content-Type: text/html; charset="windows-1252" CHSAA Hall of Fame
Jeff Rohlwing
nA great representative of the value= s of interscholastic athle= tics and activities, Rohlwing was a three-sport athlete and a two-time All-State musician in band a= nd choir. Rohlwing was a letter winner at Battle Mountain High School in football (4), basketball (2) and track (4). He also participated in ice hockey. A two-time all-state football player, Rohlwing won the 100 and 2= 00 meters as a junior and senior and was the 400 meter champi= on his junior year. He was t= he state’s top rusher and scorer in football in 1992.  
------=_NextPart_01C8E823.DA10E9A0 Content-Location: file:///C:/8E69C634/Classof2004_files/slide0109_image007.jpg Content-Transfer-Encoding: base64 Content-Type: image/jpeg /9j/4AAQSkZJRgABAgEAlgCWAAD/7QE6UGhvdG9zaG9wIDMuMAA4QklNA+0AAAAAABAAlgAAAAEA AQCWAAAAAQABOEJJTQPzAAAAAAAIAAAAAAAAAAA4QklNJxAAAAAAAAoAAQAAAAAAAAACOEJJTQP1 AAAAAABIAC9mZgABAGxmZgAGAAAAAAABAC9mZgABAKGZmgAGAAAAAAABADIAAAABAFoAAAAGAAAA AAABADUAAAABAC0AAAAGAAAAAAABOEJJTQQAAAAAAAACAAA4QklNBAIAAAAAAAIAAFBIVVQINQAA AAAARAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAUEhVVAg0AAAAAAAEAAAAADhCSU0EBgAAAAAABwAGAAAAAQEA//4AJ0Zp bGUgd3JpdHRlbiBieSBBZG9iZSBQaG90b3Nob3CoIDQuMAD/7gAOQWRvYmUAZEAAAAAB/9sAhAAC AgICAgICAgICAwICAgMEAwICAwQFBAQEBAQFBgUFBQUFBQYGBwcIBwcGCQkKCgkJDAwMDAwMDAwM DAwMDAwMAQMDAwUEBQkGBgkNCgkKDQ8ODg4ODw8MDAwMDA8PDAwMDAwMDwwMDAwMDAwMDAwMDAwM DAwMDAwMDAwMDAwMDAz/wAARCAJ9AZADAREAAhEBAxEB/90ABAAy/8QBogAAAAcBAQEBAQAAAAAA AAAABAUDAgYBAAcICQoLAQACAgMBAQEBAQAAAAAAAAABAAIDBAUGBwgJCgsQAAIBAwMCBAIGBwME AgYCcwECAxEEAAUhEjFBUQYTYSJxgRQykaEHFbFCI8FS0eEzFmLwJHKC8SVDNFOSorJjc8I1RCeT o7M2F1RkdMPS4ggmgwkKGBmElEVGpLRW01UoGvLj88TU5PRldYWVpbXF1eX1ZnaGlqa2xtbm9jdH V2d3h5ent8fX5/c4SFhoeIiYqLjI2Oj4KTlJWWl5iZmpucnZ6fkqOkpaanqKmqq6ytrq+hEAAgIB AgMFBQQFBgQIAwNtAQACEQMEIRIxQQVRE2EiBnGBkTKhsfAUwdHhI0IVUmJy8TMkNEOCFpJTJaJj ssIHc9I14kSDF1STCAkKGBkmNkUaJ2R0VTfyo7PDKCnT4/OElKS0xNTk9GV1hZWltcXV5fVGVmZ2 hpamtsbW5vZHV2d3h5ent8fX5/c4SFhoeIiYqLjI2Oj4OUlZaXmJmam5ydnp+So6SlpqeoqaqrrK 2ur6/9oADAMBAAIRAxEAPwA//Kzy7Jq2ri3trzjd3DBLdJ9lqPtr0NSBmix4YzI2RGjs/VXyt+RX lu30y0m1ixjvNWeBfWuuRKglR9gf1GbfFjEBQDZI31Yx5j/I7ytp11brpunvcfWGpOrUpxY99jsD 1ywxtMM1HZ6Bp35c/ovSLiyMiWtuyEW8cSIzJQbUZlNPoysQps58ibeJ+TtTtvLH5tvp7ARxrGYr +8nYUbnuGJNKb+P3ZXQjNxDllM8uWz7NtXtpy09tOk6ttyjYMvj1GZV22GXEjaYoaKrTp+GKvBfO H5TaL5h1+61y/sUK3MaxuingSV3Dl/njkHENui6PABxE835xf85AQ3nl3zHdaNpk5t7OyAEEUTnm T2LtUU+jNdqZCJAGzSJjLIiVbdHiGg/mr5l8rW0tlcLJd29zIWVriV24tuKihyiOXzbBEw+jZG3W uXevKdTe3Ms9zt6steKgHYAEkgZCUjLm2QxHmw3UoNYAdmdAqnlFBHGKjpQA0ptTvhodFjjkASyn 8tdJ1TzFetaS2bzqqsAnPirON9z8syRAUzhj7y95T8lo9QlsrWyiSW/dg1xaIRJJxHUkDpt08csx QNt2Thhtdv0Z/LPyn5f8meXbGTT7gafEYAt3bSj06s25DA9CDmbCBaTlhHnGilfn3yn5l8yajpsm iNFYWNvMlzOoDFrqh+xJIfsrTsBlvEKotEseXL6uKq5I8/lLomp6epl0WK3ubqI/XJZ3Mjcm2b4Q FB9t8hIByxqPEhwzHyfEGt/84vaV5X/OrynqNtI1jo+rageEziixXMa+pG21KVYUyyhkgT1DrMw8 KQgdxJ+plpFLDbwxSymeRFCvKRTkQKVoPllLkgAckVilo9Dir53/AD08gx+b49DuOcVsLSRxd3ci M4WOlR8K/aJOwHjkM0/3dN2kh+9t43f+QtP0nQ5dG8tWc+n2nmKRYr+9uHjS4lnQqYoghSQmNQS6 8VPLvmmPOz0d+PX9W1dHp3kb8p9G0G3uriwV9V8ySBIm1K/BkgtGejN6MR4iqg1Pv4Zfjxylu4+f NtR2i9u8v+Xv8PGURXLzC6b1L0OSQ0nii14oPYDM7HcebqssoT3AoswBqK9MuBtx28KuxV2KuxVo jx3xKvO/zT06XUPIuvrBaw3k9pbNdRWs8aypJ6I5svFgR8QBGWYhEy4T1DXOUo0R3vyIv9H+peeL yyEV9qGnak9te6M7yFV9O8RZ0QhyF+HkRt0p075otXE1t5u5JlHdS8ya+uu+YbrTdGgjV7q7NtZy 8qieQsEShFaBj09s00iRsXHlMyO+zzX8w7y4GpjydpkzTWHlyV4J5UBpd39eNxPTwBHBP8ke5zOx wAhbVkjZsclHRNBs9GRdT18m8uKLLFoqGhIrsZ5Nii+w+I+2VnLWwZxAgOSJ1mTW/P2t2EYJvJpF itLC0tl/d28KmgjjRR8Kpv8Ar675TjgcktmGaVg2zu+/5x58xaYIrjULMwW/D++C1qDuOTAHNtHS kRsbsJRAjZKGsPLEWhOkc9uY/RoIiRVW49so8CQNluEoxjYZFqN3rMliklray2wNVaWH4R8Ow3YH p7ZkwjZpgZSyP1l/KaFZPy88n3EsUomk0yAyC4YNJy4g7sAK165tY8g4enyEwrzLPb5ZOK+kT1G2 c/21jzHh4CeYbeiOUHgtetBUZvMdiAvnQQHxR/zlV5mtvKB8tanbxyC6Nw/1gqOJMdKGh+eavtvs 8azTThW/RMpSlMb8nxfqX5hSeeruDTtJS4ld93lkqoTxBAJ+jOB7L9nJaPITPk2ygclCn1V+T317 Qr+wj1GRbC1mT97eJIY1nkUfB6o6VpsM6TtLJmxaYnH9jdkwDGASzr839XtdQ0qSx9Ys0hpJJUGq DwoT1OeX6XFny6zjyk15sMlEgB8zaX+VbnSz5hhia8hnldHVd/TIagLUP056dptJxYwe5cOOOSyD VMC1nT00/wAz6dprhYZpZk9MVO1SOvvlGqxRxQJphM0//9D6O/lP+VNv5FtYdav4bTT9JNu0l5qV 66jcqCWDORQUrUjNdpsUjuOTcfCxQ4py37n0/oPnKw12zhn0i4W9sDVF1Ff7ocDSgetDmeDewaYm EvVyDpPNflW2vZLa+1VI7jblczfBHXsA52phkKYHURj02Yn5x/OHyxounXg07WILu+t42qqozqtA SPioFP35EzACyJIJANPg/wAjfnXoF7+Y91JrUFraWF/ckz6tdiSSrMeJaVt+3fjQDMQ5RxMYZZYh fIP0r8t6lpdzaK2kXdtqEdAzLZMHjHLcHkPEb5mR5ORLJDJvHcMwB2BIptXJMGz0xV5Z+Y2uavpd pCmkX8dhNKxV2dFZm2r+7LbVHyOMjQatvEAMqt+Vv56TWllqU+qardTTXMw/0m7lLPzkJ+yOVPwz Azw4ubZLHDHI8O75K1fU4tQUfVmdY4wSOakE/LMDgiCpFlBaT5uutLTg0qzojENDMKg18Cvhl8Y7 NschDNovPthqjJbTaPJayvRFuYauHJoO/Q75IRj3toz7UQ9Z8ju9nciXRbz1Z4xzljoQAoO/Idu4 NcnGNHmzmQY7A2/ST8lY9Jj1ea5uZLBpdUtVFkFkhd2AoapxYsxO9RQEZmY6PVpz5Iwr1bvojzDq ug6Fpsk2rTQ2ts1TWStCRv2qdvwzIi0Zc1CzuhfKHnPRPN1q8+j3UFzDCxTlE9S3HYniQDQdMB5s YZRPdmdB2HvsMDOmDeZ/Ltn5gudNW8rL9VuBJbgAcVI3NSfliJVddQmQia7wziJOEaJWvBQK/LEK VTFDsVS3ULeG6gMEoDFqmPluoYDYkd8rnRFFswkxNsf0/wAt2ds81zOwnuZyry3JWlOA4cVPUCm1 MxhiBNuXPVS5R2TkNb2gEUKBe/Ff4/PJGoNRjKe5TCMtIg7V3p7ZkAWGiQ4SqEMDWv0Y8JY26rAg 9R92EKuR1cEqa0NDkkL8VdirsVQV+oe0uEeL1kkjKPFWgKsCDX6MjI0LZRF7PhX85/yoi12F9W0e K3ilgtxY2UXFkeOFQQ375fiqeNKAGtfDNRLMASDbvoRE/eXzroX5Zv5K0CXzff3dnDdWSXt3pKSS sjl41Fujr8JU0eQKp23Ne2U+HCcvTfya8mEA11eOW+n2VlZWuo6ncWthEjPFNcKWuL+4IUMPTqDS v81NuuXRx9KaJihyQ9z5iQ6df23lywht/r4jWWa4iWWRo0bnQs/L4iRuaZgZImB3DjyMpc3tX/OJ dje6x+Zb3F1oEGp2kVlKmoXEQ9E2odgFlFKoakUA6nM/RQBLizMoGJ7n6syeU9GlsHsTaqY5Fo5c Bj9Nc24gByZZMxnzeJeYf+ce/Kl3cTXlvAA0gdirkhA2wHTp0wTgJNeKAErkdnz9c/lrPbebbby8 l1FBp93cJA7IOSkPuQSvj4nIQx8Mk6g8BBidrfevljS5dE0TTtIkKMNOhW3iaOtCiABevtlzXGEY ColPeLFzyoUH2fGuQlAS5slQjY5KlfDX/OTvlQeadVRLa4TUJrW1Bn0oyAyQ1P21QGtD1rTMfVkx iC5Wix48nFZFvBPyx/LWx0LUk1AS+k0Y43Vtcio36+G22c3qdXcqIcyOCOM2X3rB5O8vTaTFaXMF rJaSqJbO4NOI+GpIYeHvm302ESjfQuNLLGQBO9jd4L5v8saTYTTLHcAhRQrz5LxHevYZrtfpMcOg a4iN8QSSLzVo+naTLDpl80LoONxaqGB5AUFFIofnXMeGphjx0DuygRvs+WNVvmu/ONhqd5PzgN0r ySSblQGFKjNVq8ss2M+4tE40H//R+mOh/lJe63patqV5c38jxI0CXcsk0MewIKqxK7Zg6bHKhZNN gxwriAFvZfJH5VWWg2MkeoTtfPNQogJSJKdljFBmbwgBrEY3dWUF+Zf5faLfaE7tayCKxR5D6H26 KCQOtSfDJCJOyJGIPFW9Pzp88XfmvzBenSFuJbLSo4/Thtw3KUxgf7skFDU+GYeY8I4UxiZ/X8nn un/k95hl4T2MNzNcM9R6SsQVPao75VjwmRXg2frf+SekHSfy78uxSOZbo2yLcyMgSQNH8PF6AVIN dzmdGBjs06eQlDY8iXrfjkm5RuBKYn9AqsoB4FwStfcCmIQeT8fv+cqPMX5jXP5iNouuapPBFYK0 mg2VpWFBETTmpQglm8Scr1MZCq5Ou0uIZpni3lfXo+LfM1hrF0EvtYvbq8vWYpE11NJO/EdSrOSf ozEMZS2PN2U8EMT1nyp/zjV+bvmzTLW/stGeGyu4fWtFnPB5F8AO1RuK5dDRx/iO7AzNWBsyuP8A 5xF84WkbTanaMssY/fb/AGak7ge2QyaejUS2CJIvooy/84++a9HlguUSOQ2JE4NakcSCtRSnbvlE MAJoHdkIGvVt5vdfy90zVUuZjd+RoptI1WJo3urIGImSKrclaZioBPXMkYhYBoN35o4yCPVT0ryF 5P8A8T+a4bBdCvPL1hoFytzLeROkz8qNQSGMjhQ0IFTXMjwhAONl1AzZLMQfc+hvzG0DVrXyxdxX Oq3PmKK4RbeC1it29YsxoCxWgoO9fpyYAAsN0qNCMebzb8sfLvnry3dwz6KLWCyjNJ1uogeYcVZV kVKkj275Rx7EdW/Lp+Qunv8Aq/mbzn9Vgt9L06NbuZma8vp1ZkhjWtURFKlmIFak07bnK55ZR6MR pPNZ5UvdR1Rp9Z1EyQXL3cVrDaTShisUPxs5jXZHcH7J3HemY8MxMmzJhoU9dil9RFanEsPsnrmw jKw4JjStX3GSQsaQLWppTrXASkKM8YlAqSpFOmV5BbKE+FSaNvRCEUUGgHj88jW1MxLe0puWhieO SScIq1BTYVNduuUSDkQsjZXS8nrFsEjNeW1T2puNumWQkQGBxhNo5V4gsQK04mvWuZAls48oqodW qBucbY0h3MiEcVFD1yJNMwAVdGqPDxyQkwIXcgdgd8NrTdcKEu1WeS3027lij9Z0ibgniabV+nIz NC2UBZp8w3mtw6Xcw22rXH1Se5u4pLWwYMI/XKgUk4c+HWgFfi9s0Oe5El6DHEgDboib/RdB8ytc rrqW0txLCGuI2TiqxRsOEZDCnHlUgdyMoE5jkW0SrpbyLVf+cftLZ5757uO0sdXBtrTSNPijErxs oBEfqsEApsW3rmX4swAS18UNw+f9Q8lnQ9Wv7bSvJNxZvZQyMDdzx6k7BRRi8ccHpryU9BhkRMUS wngI32p9Yf8AOJlrBaR67GmkHTprq3t7u9ZowoMjySKqKSqsAiKNiO+Z2jiBHerdLrL8Ud1PtOnu czWlDXkRmtpYxvyUjiNq7dMI5sZBgvl3yVY6dfzapJHzupn9SrUNG6Dt4Yn6mUzxgbPQ+IwLTeKt HocVflT+c31u8/ODXdUsr1kS1mEMVwzvzAjoKChA4g9Bmk7a1vBERtGjw+m/NKl843Nkot5r1Zbk jj6rDkprtQ7ZyHjnIbcuWe/SOiGu/O/mj6uLWDzJd21sgJito5WEYHWnHfY5nw1mSA2Ozj5MUDv1 SU+fdXuhFFdatNdx7iSOQ/wpuBmNq9ZOcd0ACIQv+Iq3HpIeMcxJYLU0+8nbNdhyXs3CZUNXsLd2 s7zsr1DA+PYjL74QpNxf/9L7w6YghtbWGO1KcEVWrQBQBTbIY40KZSvknVNqdMmxWSRJLG8bqGRw QyHoQeophBIRKIkKL588wfkVYX+qXWoaVLDZxz7i1KEAM1eQ8KGuSmITG/NrxCcTV7dHrvlzyvp+ g6TYaeltD6ltGBK6ooq9PiNaVyB8m69qZJFBFAvCJBGta8VAArhJthGAiKAVsDJo9D7YqTT8cv8A nN/zCmv/AJjW6aK7xHyzai2lvYqgtMSWYKV3+HkBkdVl4YiLrdJAzyTydDyfOv5N+StT85+dNKvd XtLnUdM067il1L1C0jtGrgsorWlBUmmU4xW5djKPFcR3P6AdNtdOjtbZ7CGNIfRjWDgKAIqhVp8h tlwj1TGZ4eF5Z+cHnOHyNov6Rj0BteupKt9TjfgxRd3YbGpplkYg82jNqMkKjEWmvkzTPL/mfy3p /mWLy6mnTa/Cs7wXIDyIrdjSoyJO+zkx1E8samK8k/u9C8r6b9WaeyEXFRHGUBCfCa7jpvj4fFvS Yag4hQ5K/l2y03TpNQhs7IWbXU/rOQBSSoFGBGxw8NBgf522/cyO5tkuoniYfCwIbbqD1yJCQaQN po1vbOZmHqyfZjrQLEvZY1FAP14SAyM1XULe1NtMssfNZFo6jqR167ZXMbM8RkSlmn6TaiCCQIv2 xLGoQLStK9O/vmNDEDu3ZMxBTtwU3p9ncN8vHL6poBtjHmHzLb6JEHZlaR1+EkkDcGh2BPUdKZTm y0NnJwaY5N6eav8Amms0Wq6jLaT2NlozwWdZaf6bd3kipbxQjYHkST1Ow3plXiGrLljRgcIB3l9g A3tN/LP5nJqUWu3GpxpaWmjlpPrPRXgjb0zJU/zyVRR3oTkxmIacuiqq5lCp+dfle4m4iYi1eaaD 60CpERi2PqqDyAbbiQKb4nOJcljoiPkrazrsF/bWd3Z6kiWQj+uySH4SyKCEUq3TmQeo/XlMp7W5 WGFEghhDfmNrFlPZaXHBJcXL28NxcaaqcWgMzMwLybr9kD4euDjIDL8oJSJey6Xqk9wkYvVSO5kA LlTSMGgJRa7sfl0y3HO3Fy4ox5bhlgkQKhRh2Br2zKB2cEgnmiuaABmYA5OO7VRWycWBKjfryxIt MeaB4xgMpkYMd+QPiMhTdZ50oC7e3PpuxIY/A3WvzyInTKWMS3CC1C8SdDV6Q8TzU7V9iK/rynNl vk2YcVHkwe80yC7rCqLbtIp50UBVB6cuI+InrvmBLd2MMlb9yXw+WdPs/SBAvZUQbMpWgUndVqeI FTQDxOVcIB3T40jy2U7q5s45p7u4CkkhLSOZ+PoxqKU2AC7UpTKpztYxPDXex7XDo0tr+hruKJ/r cXO4tqPzdHJAVSBvsakk9MgJgMqldpv+UHlDRfJT6h+h5LlYNUCerb3khkaP0yxQJXoBzPXNppNT exp1utxmUhLue/hqiubUGw66lOWVYY2kkPFEFWOJNKlGlail603o1MPI8CwoevfAJWxFp5XJMlOS aOEAyOqBiACxpUnoBjSCa3SLzPrdjoWg6pql/dJaW9rbSP6rGm/E8QPEnHk05sgED3nk/FLzB+Ym prq2qXF3GL+O4uHeNn2kVXckCvfON7Uj42QgdG3FKUIgBjlh5jGs6hyVCisaMr/DQ+w75pxpzAbs xLiPKmW6qL22toZrccyEDCPrWvbJwBumRhI8mA6n6twtvLFMba4Uj1YAKMp9zXf5ZleEK3FtohHh 35sj0CV57mFbsNFKhoSo+FgM1eXDwT2YiNC+96X5ggC6WODkCn2QKEVHU4mXK1kKFP8A/9P78144 FUprmC2jaa4lSCJPtySMFUfMnCxlIRFlbBeW10oe2uI7hCKho2DCnjUHFYyEuSJpiybxV2KuxVa6 8lZa05Aio98UEW+Rvzx/I/QdcsRf2lrFHeSOwluSAGoQWJJoKmoHXITjx7tYxgTAGweQ+R9H8ieT 9IhsNc+uWGuWExaO+00MRKGNQGKDYg5VCBHNz8WSWGJuNjv6vdPK35gX+nXEjLOZvLt2VMFzclnM bLszcqmgIHQ5bxbOIQD6x16PQb/VfKnmO5h9O6/Sd/OvCC3oOAPg3zyexFtscsJR4at6T5f0230n SrSxtkMUUKmkXLkFJO4B8K9MWvhEdgj7ywtdQt3tbyITQSCjoe+GJMeTGURLYrrWzt7O3gtbdOMF uoWFDvQD3OC0gACgisUtUxVTkjRxRhWuxyMhaYkjk0FVFAAAAG1Bttg4QAtklCzvBPA4Mw9Mj4mR gCO2VykCN2yAlGXJhWv6RDeQK6W1rcrApEckil3Xn+1yJI6HuPfMecRzLsNPlIPMvDvPml67a+Ut Ks9M0a2JF3NqDywyqbeNkZY4Xq6irLEzEeHvlMyAKHVzcEvEyc+ld3mfm8O/Mnzdrtrc+ZdEUDT3 1qCI6aZCqo1tbyMkMj8hxX1CvNSTgPpoFlY4RPu+/wDGz5R8tebvM2pa1caGstb0XEyPEsaMk0My mrrwXf4UPTfkAchI8J97IbRun2N5B8x3Hma3NzNKLvUr6RRcIwHpJcyNwsrVB/u5oIIldwNgx32y Jv4MxEgC/wAd/wCp9NRaDZ6Xb6rrusej6Viqtai5UGOP0gIxLNxALVIrTcnpl0Rs4mXLdRieZ/AC ETWbjQLK2vtYNxqPmLXmW30vSKL649UlvUlUGkS0HIINkXrVsPFwjdj4YnMRhyHMs1043MFr699c 0eUB/avWi/6tN8MZmt2MxG6AUbrzOka847lEh6SSEcyKDoAT1wnNQ2YjACwqb8yLqG6SKzkMxkJ3 m+zQdwvRd8AzyZnSRPMUqQ/mLeStLG1nHd/VRxuJ4+QWpG522oPn9GHxiUDTAdVR/O8UjvArAywr +8IflGjHtyHWgyBmSz8GlWLXbK+hmQSiSaOqXc9agsfsigPTKZG2UYcO6qupfU7ZbZ5awj42uHPJ mbwqAOgysySY2bGyGuNfgtLKS79IfV4QJDIHKTTchUkVBJHyG2VmQHMLRtjc3nDSp/RS405g9w6E MzB0HLoKFFplEpbswJXzTxLiDUP3sTeoK1aiKfmV7g18MZURsncdWQW5azrcRlJplFRbp8LMop1o NzjiJgbceceIUy+z8wqyhGt57eVlrSVSFFOtWO22bjFqqG7r5YDe6Savq014shuL1bLT4KeskIMr SgkbLx7npkcmtBWOmo23ouu2l7FFZQ211YBm42ruytLKBvyBUkU8RuPftmRgzRkGvJCUTuGfWQva t9YK+iABD/OfdjWn4ZmOLRBRN1aw3cLwzoJI2G6t0wg0yD47/wCclNFh0/yxc3t7fc4lYR2Fl6rA lq1HwV3plOYGiQmcYXEgbl+XerSQySmaWQlIyaxMamnsRXtnMz9Mvi3gUbKYaBaRX0hXS4ZRcniS ZVou/gcoljE/JTMS6PYRpVzGIIb6IycYwvOIcvi27H3yOPCG6OIjc8kqu/LMBlkkMjQpK3xlweJq NqbbEZn49OSPJlxYwhTb29nLbGMSPJGw5AKak16dBmo7R03AC0ZJmqA2Zl5mvLmLSayQswWMfu2X iQKEV9800SJSobrjhKQ5P//U+5vne31qfy1qn+H9Qk0zV4YWlsrlArfGlTQhlYGtPDLMVXR6uJrI yMLBoh8V6j+eMKaWlr550nUpvMFqTGLSMsI5JU2qRwULXruSMxZy4SbZ6fUHw+HhBPeXvn5OecNC 8zwM9pqsa3scaMNLYqrxxn9njyJJBwwmJN3iw67F9CBunSmWptfil2KuxV2KvLvzRnmttDFyLpLa 3tC0tyWRpCVAIoFWhJpk4wsFh4sMZ4pdH5k6X+YnnD8wPzUsfJNjKsOkXt3LFao9tSVUCk7uprvQ 0qMqvpTVjyToHiIBPJ+imh/k55ftNMjF5Zzz6gkapzeUhSV6Hj2qeuCnOJAobPl/8xo7r8q/PWka npOk3GqQxA3Op6bDL6YeFvhZV6gtTpyyM41EG+rg5cpMjwRsxfZn5eecdJ81aDaalpcU1tbyoOVr cIVmjcfaVwKj6QcuIIAbIZuMbiizabUo4njjVGmkl+wqg9uvywM7TDsPxGKW8VdiqSazrMWk2kty YJbtokaQW9uAzsF68QSASOuUZcoiG7DhOQ0Hx95p/wCcr7K3m1HT9O0uSOSyqWknYxsqrIFNV233 oRyzBnnlI07KGhEaeBa3/wA5Ra7A00lkst69izJfaZ6hhlEUh5Bom+xIVrQ5QZFzRhAoVzTNP+cl L5oUvLPneSSRLdWd/GfRuJYAoAQhW9MuhqpU7kdsnGRaziF8tmdzfm1DqNvN5rsb71LZrexjv7Hg DFNJMWKw3EfVFLAh2HRRtvkbMhSxjQqvd8HhX5j+eLrXNSu9Vl06O6tNVQiQxsrIFVOBWMED4aDZ T0BwndshGogPMNE0dLe31W+8pT/U9W1e1nhaQkJLZQTUjmSKooPWVjyKmvHpQ7413t91QPJ9b/lr ND5X1vSrjUrCLS7Pyxo0Cx2oL0tpL1eAlkDCn1m4SIyyU+xGoA48srjAiwT1asm8SL5kj9PyHJ73 Zea4PNGs3j30zWXlnQoodc19GYkyvDV7e3koaKFASZlpUllU9xkwd+bRweFGwPUfTHy7yu0XXLTz L5gbzDLZyVhjee3hRviLSLwgi4jvT4juQO++2WGjszOM48fhjn1/Sfc9JveUkPK6ZYJWQiONzVY1 Y1NRsSckWmJo0N3nWqRafNJAs97eXUaElbWBBCjH3bvlJkLckSlX0sRvJfKsEvpD1JXiPqSxISyc ugUnYNvv1wWy4p9Aw2fS9B1QytJ5n1Vowwb6itYLbb+ZYAC9K+NTkjk6Iuv4WrLQ9DljaKLUr3Ve EhaO19H07UAGoooAYmu9Sa++C0GRG/CPmmhtp7RzBHNLJWr+hbRpFsoPwueXHavUk4DyQJiR/am+ j391Z21dZEdo0xrGiXH1j09vtN8AFT7GmV8KbB5J/Lc6NfW8d3Peu8kSUiliHIM3YD4qClKHbImI SJHlSjb+hM8yJOZ7dB6puCKgBRUgmm1MorvTIUi7DV7aKZDFBNbxqRV1rQ1pXbxrlR2LXKMizG1u beV1PoziKJQZJGoD8Tdeu256ZaKLEwlXcm7Qi8id/wB3HAjfvSalf8la165YCT12aTQ5sQv7lobk 2tvDNapCeS3DSgIxIqxZY1J49qE5XPyZDbmybycON/PctJEY1qSwFDvQd6GldszNFICVONqfp2ey eoqqCSBtsM3YOzqjaFt71pkkYxUMbEECv34iVpESXwx/zlfd3OsDTdDiaCKZi0scL15MOgNe1cxc 8yAsY/vR5B8f/lx+TWo+Z/NVrpV83BpwzpCp2JRS27V8BvmnO4NblzZ4TYMtgX1ev5G2fl21N7NE E+pV9SFB9pRtU+3vmLlBgd27LhjhAI3XWHl+ymvYo7lIliYng0VGfjuK0PSnvmvGtPFtyajONDf4 I3UfJHlbS9PvYppH1BZ6GORgQyd9moN/lmwwdoY4y4SWE5gbxilVt+X0E2s+XbqIrqGhXDx+pcFQ zI5NeLU8KUOZPaWM5NNKQ6hEIDLDjB5dEx/OXytYxaDdSWFpzuBSJOC14V7mnTPL+yBk/OESNxty ckpCA4A//9X70fpPT5bJbwXMb2kyB0kU8uSnwAqT9GQExIWECY5h+aX/ADkB5h03XPNl8uleX55j pnGL1EZVVyu55BSTSuxG+RzRidnHwZJmRNB4Z5E8t+cvNvm2K00iG4sb7l6vq2xaMoUI+wVoRTrm NDCYm+jLJijMUeZfsD5F0vX9I8uafZeZNWfWdUgWkl44Aam1FYgCpHjmbHknDjOPa9mY1wty2SRY 1LHt2xVDQ3Uk0jIYSiqK8jXevTFaI3KMJ7YqhLyztr63ktbuFZ7eZSskTgEEHDZG4QY2+ePKP5A6 LoXnu983ywLRbk3Gkoh4tER0Jp8zk8hF7dWjHEyvi730jxGVhvpKdR8v6LqxrqWmW94wpR5UBO3T elcIkQpjz80da2VrYwR21pAltbxDjHFGAqgewFMSbRGAiNkTxGBk7+GKqckqxozuaKoJYnITmIpA J2Dyzzb+bvlDydFcSa3dvbiNC0aFeLNtUCjEGppUZgT1YsudDRTkAX5w/ml/zkjpnmXVZR5f866j p8SvIYrER26LyYV+M7OANgN/vzCMpTLtseMQj9O7xGHzXF5iW61jVtRXU3WaC2aeOiyn1HErEhTy O0W/Id+uTjsWRiOjxW6uPMUepSTXJNw9wzPNeJQhuZJYMu1PamCVEuRDCZMl0iTVYVUemqcSZWUf ZY99u1e9MrB3bfypL0nTteuYbMSWiUmqVurOpUOvAekrHuAagGm22TDTLBISXW93ci3VbRmltfUD ek44srEcd17HYDbLQbZeCWR6XGLe+F2IiyGMStBT4XAoeBA267ZGUkxhIh6Rpuu6hqBg+ss1y7zG 71OMbtM7GpFdia8Qg8BtkLo2EjAIRArkHp3lmRodDm0d7mH9I+Yr5rnWtTuDSGNWZpWkl7sS1KKA dgB4ZITNkoljAI22Aep2nnjyN5CtYrbTro6zrF3IUtGEiq9zK5IcvQkW8ScfiJ3Nd99sHFQtxcnH mkRyHd3Mmf8AMHy5HaRSanrdo2qyyBZdNt+RMVQTRUoS7Hag++mVHN0Rjx0eGI+LD/Onm60sbCIz yFZnLcrCNlLwBlLILhxTizbfu1JYd6ZV4m9twgJcvx7nyt5x/OPUvL5aG2nt7GW9WsMPBJJBDuVY A8gpYiny98lGdlPAeW5ea2/5r+Z9dkjka71H0o4VAtYJGVQqj7TcSqKW65YSUeDXRksP5n39gxhl iulLRAi9lJWNABQhSzcmI8VyQsiw1yC1fPmpOkT215c3Lcf3QlPCNG3JIStW3FathonmjYJ5Z+d9 SgYXms3ax25PFroyMH6/CFWMN39qZXKEr2UEHkzuw/OHRphFzuVhETcYD6TV+lqAfEetcr5c2fBI vQ9M/MaC8tjFZSxO0kimZJEU/IAqeO/zyMsm6eA3T0fSPM9vVXa1t0ooIEiOygV3KbkVNO4pkAYt cokdWfW+sW1zAoso0tIWqUdkUMznaoBG/tkjLuauE9VeQ+s0ai7kazQHhbU5KX6sxKjcnxOR6p9P duj7O5neRLe1fjUhlQgnkBupbkAO1cNHkiQFbpt9Rt7FCEkdLi7nSW5lFAtVA2PtU1O+WgcG/VpI Mvcqz63qN2s1tp6NMqkgyAjoOvTp865I6qZ9IaRp4g2Sw3WPOmq6PA9pYcmncEG62/dbdAT136nK o6+eLmWEtLxn0vlH8wrjV573/EHmGxu7h+RXiRz5L1BWhG24GD86cmxOyY4hg3q0s/KfzfdXXnrT p101tF0/TnIh1Gb4/wB5KCFBUDZT0NTlkM2OB5uPqMmTJQI2t93+ZLgahotxEI4zc3KBQ6VK9K19 q5DV5IzvdtjxEV0eOWPlmLREGrCJbyW4qt06Ny9Nh1UkdCOuYH5UeHYXFiibPUPJ/N/nmH15dKt7 d44kbjJeDcrX+mafPCpW42aUr5bPMdU115USCy1Ka1l+0PRkeJXNa8uNaA5ucGt/d8J3bsQjIVXN kSef9ZFksOr6uDyRY5VdAWYDYctiCffbNPnwYsJM4Dcpy4xiHN//1vW+lfmHrFxFDoNpq0um2k7g R2sLlEPLZlBG4rWmxGcJg1+QS4b2KziCd30F5X/K/wAv6pp4neGeK6ABLSIaSSfzc269T4HOv03q ALlxjwxqvk9e8n/ljovlu9t9XtowdQt1IEoap4sKUIFe2ZQG7jmEAN+bPte8z6boNo1xdTovwmjE jiPc9/oGSHK2onYvjHQf+codevPP1/orzWD6Cbgx2kt1C0bk1oArxudj2qpymWoANOLhjMkS4tj3 vrlPMM+saT61lDE07oDVH5qCR2OxOT49nO8PiFApro+pulmkWpusV3CtX6AMo7g4RINQuG0kLqmp rdQrJpt8CNwXiZWAYdQevTBLyZxiJ7Jlper289iJZ7lOUPwTSNsKjxJwxPegAjbuQF7518uWE0MU 2pRt661EkYMiAA/tMnKn05K7YeJvtv8AoSGw/OD8uNT1afRLTzVZtqNvQNHIWjViTSiO4VWPjQnB bSNXAmtx8NnoQu7cxmYTxGEDkZeQ408a4W7xY94VIZ450SWGRJY5BVJEYMpHsR1xZggq2KVpIANc EjQV4v8Amp5yby5pDXa3FtZQwMDLqd1cqkCb780VuZAA7DNXqMtu20WAcy/I/wDOX80dD83Sz6OP zFhleG4lk+q2ek6jMVANeT3YjZz233p0G2YscMjvTthcRQifsfOlv5C8363LzjvYtXsp+Do0kEyn 02+IMXuUjNSDsKZaTEbDm5GPBKXOw988o/kRr4toRdTSNGLhnZGIf4mRRsasSPhI69OmVTn3OTHT xvd7XY/lK1rEsMkTSKQSFIJKV8PauQJcg4qPJPoPy09CL4LVmEa1JZa0G3t75AbHdQLKTzeSbaOV pPqyrsQRSla9PuO+WcmUo3zUIvJ8cfJggBZSCaVO/wAvlkATbIYgUQnl2aOIQ8fUFD6RAoVHXCZI 8IDkr2OlTRhVRfTLCrBdiQprTbxyUedL4YKbSRSp6iRExkLxVQaUP7NDTbrk4tcsfR51f2oS8guJ mld/j9aNFoQq9EqduJpgnOmvwWPRa7rGi6i+r2EH1edQwsY3+MxySbLLyINXB+zUbZUY3TTLT3sG D3OveatZvZbe51g2cAT07m4f4noOoU02Zv2iBVu5wSiBv1ScQCAuJfLOgJHc3yNquoz1EMD0klk4 ggVjI4qm/wC1tkYndqldUGJXf5q3kUkqW0JtLdQEpFVTRSCAOJpsfD8MtjsWiWPqVez/ADSt7scD JcW8sR4+rNLUA9SKvWn3ZPemox4d+9kY8wLfrysdZtLaeUghoZ4WZXrUE02O/Wq471uwCNWfzHKR HJW+ULUXYJKEGtQBU/0yQkBySRGrGyCfSPMaSSSWtk8Z+2JQCYztUiZDsPmMBrqFPCAKKc6ZrdxG ywzMlhqacFntVc8WY7EqCFqD0yo4L5NoyG93tGjec9X0uSS3hvlujEQk0Abkw4mjKpX+uYk4ENo4 Ji3uflD8wvLt36KSk296y/vIHJEocVG1e345GEgTXc0zxyD2e1ubq+9K4sLyOe1mowoynjUbghdx kwO5q4L5pvC+txGERJ6kDnirx7If2a1r07UyW68MSKZDDqNzDNW6t2cLGXa3jBaThQkncUyBkbpq MNtigV1X9IO8EUMkNuyuGkSQrw23ZzQUG/c5DxTdFJx1RO7HLy40LQI3kS2S61KVQlpfXLtIo5Uq 1K7kHbcZWTGkG5ctg8s8wfU9emkuJn9a5hDDkhCVX7XSnY7ZQZWe5iQGO6Lq2l6BS2063N0XIuJr 2UihckBYwvgtPpOHPmjsBu4mTKYy367Pfbf8ztOvdIhLWwt5gnGRSwChgKVBG/0ZVk1kCKrdjiyH kS+cfOXnxY72URztbwzlhI0LMoIJpuAaH55jwzTqhdIySHMh5te6tp0sBuE1OPmdpIpNya+9N8x8 19UT8OQ2DzrVrrUbiIy2wpGSQrBqBqbCnvl2njtbjwyECwLeaNc6618tvK08iMxHEsSQadv89snk wylIBqmTN//XlMGrfvIJreSSaWEgq6HjT3B6dc8/hppA7blaB58n2p+Unn/8wV0WVdY0iS7sZE9T TLuRSzOEO32aU9s67RAxgBJhjMgSRZCA1f8A5yk0+HW7vSdatLrTLCOMw3VzHIFb1F2oEBBAPShJ zLlmpqhqDI8UgKeX/mP/AM5G+XJtGW08u6tLLbtEyx2KxsJyzAg85GKog+VTlE897BnLIJjYUHxI vnO4S5aWGf0GZjzlhI51r0JG5zWZBIm2VARG3J92/wDOO/8AzkRDpFufLnme01DVLedg+n6lEHaS IHYq8YNG9jTMvBqJRHqDUcssB2Fh7751/N/Sb6tnb6DrYjlWkV7JHFCgp04r6hYgjrmcMgkLDccs 5neP2vBL785bz8v7Ge6tTPcadzLq/Eko56l1YqKdtsq46OxRljLHvVAvHNT/AOcwfMFws8Ok3CLB d7us0O6kjqoJK9ffMXLrDE7NM+OW9vS/yy8xQedXgjv/ADXfRX2stGX04PLEnrEUZCtFjNe1Dlmn y8W8nJwxxxH08+r6F1f/AJx4hurV5Srw3aRM1q9SSGI2BPvmbUh7m/Jp4SjYLwnWvNF15Y1DSvIO maTcNY6TdR/pW/up5Yn1K7FAVSFKRpEgNI1epY1JzHmJQsk7NWPBDILA5F+inkKO0tdM/R9lGUjs +AnrWnrPGrtQVoB8QAp88yMMrHezyx3G1M4mnjgRpJWCIoqSclPII82EYmRoMC17zDX07SB/31zy +rWySBZZQDxJrQhRv3I9s1eXOZmhydnptNW53+4PiX/nJrUNV0fSrjRtAiGred/MtsLXQfLscYnC K7L6sjB+YLKFqeO4ru3bKYx333dzpMctQRw7Acz0/s97z/8AJH/nDHzjNbwa7+Z09u11NS5ttFCC O3ikZWBMsSU50qDRupzI8OU9gG3Pq9HpTQPHLrT7e038gPLFo8M907XlzEix8yFVQq7BVAFFFNtu 2TjoT1cCXtBIWIRoMxm8laHpsaxW1hEkaJxjQClANz898ZaamvD2plycykknlrTJHY/VFV9t12Py yvwq2c0ayYHNjer2UFuGjSPksdViiAG/Lfc/RkZwADl4ZSlReW6zo0FwHMcALNXdQBT+zMchzcZN 7sOOiGJiW3VR0HtvgGzYZglRfTFLAigIB+Idh8sG5tnGQGxV4NJtzyZoyKim+33fPDGJBtEp1yWN osHMMEIAG4PTbJHyYTlY2YpqOi2kl2xaMFymw7fdgnsFBoMTvvL1rwaMxHlUFBTwFBgOwpmYyphN 95WoGESKJHNTxWnEd6ZAytgMdh5xrXkuUISzOJZFKtKasdz+zXbBdLwginjfmHyjeWsUlvChd5hu 7AkqKg1X3PQ4eLe3Hngt4Vr2gXtgayIZFBqyq7BqipJNKbd8uMhTjSxUx2DzNJpTcIoTHOm/rqx3 NTQFKew3rkzuQ488ZvZ6x5R/NbWI7iBLn02VGQGQAIwUk7GvUH55Ct9ms4x3vpPSPOZvLXnLZ2V1 Jx9RRNFIRyO/JSHG3yORGQg7seG+qtqOqaeludTPluznkjo7yJLL8IBrUAkjanhk+LdeE8kmsdYs 9RvjALZrbVaiW3aIcPW8SBXidt+u+RkERMobMus9btvUgS6neC+TlxAWjA9uQHj1FMxZYQDYLkRm R5vbfKHn/WtFRFeupaa1A9zCOc0a1qwrQlRTxGY5sFsOPiFh9L+WPP8Ab6nCl3od5HPaV/ubgqsk VTVyqg9fnhEyXGnjrmyh/M7TEXMEYinFY4/jdneNQORVVDVHzPywcW7QcdCghbjXhPAt1FGVtpU5 KFX4dupaoBG46EYJp3A3Y1cXLaiZ5LlQxl+GdpSVYk9Aae2+2Y8zuy2qwkt3ox0ueVmflHQGFieS uJFFACPc/hlBFsZQNMWTyyIrqVllERNJIU6ChoWp4g5TkgRyLiSxiR3UNcsTbWwuNOmQlgTNxYbG m9RkI4zbCeKEutF4X5hJvLCN3maOWGd0kXjUP0Pwn6cz44/T5sYkGJ4nkc95qIvxY2yMsUrhE5HY ljTb51yg6WUju4eSMgdn0P8Ak/YWvmm7PkvzDpDPd2kLz2M4kWJ5n6LEQ4IJNailM3Oh08THhMd1 xcWIgWKkyPX/ACK2lX097qGhfUo05QG0k+F3VRsYzTqKdemXHT8OTcNmXFLHkBjuC//Q775C/Ky+ ulsJL60kMMUo+tMFPAqGHIV8KDOa05iJebkeFUCS/Q6+85/ld5Q8vR3V9ren28GnWoVLCNlkkoBR UEcdWJJ2ze4xEjfm489YMMCIix7n4hfmz52t/PP5i+YNcsIZba1urp2toXQxMVDbNxIFK9t8q1Hq 5ONpI0DxDc77sMvNNaaLkzlFcfZ6AVqOmavjN7dHMkI9E68k+S5bzUoZLqUpbbp6zAskbU+FmoDs DmRAWERhZ8n11+Xt/wCQvIutvpfm6/8ATt9RtilvrdujMkEq7gFuH7Xyy3wIolqI48guPEG/Pn55 eRtG1nQ7DQbu91nT7SZzeag6M6mNwVHFCASPormQIwiaiGvPnGXNGcIUIvGvzW/Nmy8y6O2keXrK 6i065dXu7mRDDsD8KgFiTX5YyG3pDbkyzzyHEKAfKFmk8l4kUMbESSClKno1OnzzAliMj5oIfpt/ zjnpN5c2L6Pb21jd6naAPAJ4kWRSDUsrt14k70zIwYz3NmOBHpkaBfoyNU1RdEthfaeJLuGILOyM HWqjxHTNiBtVoJMTQ3eGaJ+Wtn5p833mqJYPplvFI15qV9cqbh55CdkjZ/hjKnf7JJ8cwskeI05u KYxCyPc+oNOhtNKsGeAELQK9BVi0arGK0G9AoGMD4USWjIDkmIvP/MuvLdxSRHUodPijJPK5uBZ+ qQaFQZFrT/V3+WarNnOQ83a6bTxxiyLJ7hbEL3U7/S7dv0bYNr3mS/dotHVJOUTO4FGJRUWOFa1Z iSx7eOOGJ+nq5oxeIdzwQG5sch+tnfk38s7HR9Rm81eYHTXPOuoIou9UdKRW6gbRWkZqIkHTbc9T 1zc4dMIiy6nWdpmUfCw+nH9svOR6+QercaDMsCnUuI2xVjOozmSWgGynih8ajKMjstPDhDGLmXip YD4+tOu/SmYsjTsccbYRqSSXjkGgRG/Z6A+565iz3LtcJEAxu/SGFxEiLTjuDuSanqcplUW+MiRb CboBzITQcTsFyIN9G4EJVMsZG9CP2uxGTBtWkKbip+Ib12ycTaeS6UgVA3UigphQSx+6tSJDKVoK UUnK92eMg7JRPCpALAMfxrgIpuBQLW0TU+AOx7HK5bJItjmoaCLgMSPhrXft8shTOhTCdQ8qRSeo UUmQrSpFT39sS1+GC8Z81fl99f5osK+qsRU7ft1oPww2g4g+YPNv5YXlgJnhiIKbsAaFiRXfl2rk xlI6ONkwh4Xy1XRNRCC7aFlNRHI/wmh6dRTrmQDxAjq63Jjq30h5E843bokd6xjiA4xTKBVGPgR2 PvkZinHoB7NpWtSXSp9cuWtpiAPrC0ZGoT8LqPEeGVE0pLeo6Rqccq3+j3sU0bkcrNvTYI3cowCs tfbCJCf1BSb2W289/JGl7dQQzzKeMqHkSVbfmDQkb5GUBzCYk9Hrnk/UntEM8ssWmRycRGblqeoi 9fSoKt9CnKDEFsEq5bl65o9z5X1OSS48vTm11daH1lBEMj0+ItDyQmlRvWntlXDRZmZIHEHsmh+Z ZreKSHXrZrG6Kxw27qY4Y3PSoILMSw367YOFpnH1bJxda+Faa3uNIaWGoVGE5MjRlRxREIp8VK1r ldktUgVRdDvLRbdY4ZbS1lHrSWrusnoKv2lMtT8XUUPfISh1U10Ty6kS69R5bNrTTwscSID2C0AJ pu3UkgbZWI0yBKV6jZ2D24mCi1ezIWC2COWK1FShPb3JyE430aZx4ve8w1zTLO/e6lVZtORG/fc2 JU1NFNBQAeNTkYU4koR6sXbyvYtpkDmSOUvK4k4mqvsBX2yWbKRddGHiAMai/Lpdbv5bW0to5FHx tJGatGB3A618BlWmlkySoONkJJ2eoQ/84vfmZefU9S07zctg0KE2kVwtXUUAUMzVJHzzr9FpjVyJ BcLKJHYhKNe/Jv8A5yG0i2k+tSw+cIbchraUu7PFx/32vOvzGbGekjPfiaxl8I2A/wD/0ftC3k+3 0nT7WW6KQ29hCBJbwKSCRXfYEmua/wDk6IshvGtiI+seovmPV/LOk+fNYk0tZ7tGnuGMUUcVECCo oa0p92YkZSlOiKboTEIAEfHoyFv+cL/IWoW5mv5pVvmUGNwBQHqQ475tsMAI7uHlHFKw+Pvzu/5x 6m/L6e3Swi9ZLgMUpvGQDQb9jvmJqMAiOLoxERyBtgXkyLUNEY2d1p1vcpOOMiOWDChrUcSB19s1 8s4xiw344z6Mp1DyNDrcqT38ItLX7UMhZuIP45i5O0e/ZvnphzkUw8vf849W+tS28zlrqK4uFjW4 iU/ACRTfbqDmZpdUJyBibceOHiBI6PrFf+cP9CbT2tJPTSE2/BQtS5JUDfaubuAvdGSMTGhzfnz5 7/5x58zeQfNIh0o3E9vHKZYHRGfqf2h3r4ZHJhvcOLjkRcZc/wBD7E/5xu1zTbfzrbab5jurSC6a yaCCFkSBxI3UtWhqx9sRExi3zmNid36KF9PgtpOEkSxqp5ksOIp1r8smKDZKUh6iNkh0u6tL7lJZ yJLFcTmFGtd41EXxOC6jjv0IPXMYzHE3cZMQT0TTUbGOe1Gnw3DWUbjihiPBlPscx9RDi9IKdPkM TxkWx7Sfy80Swu31G5jGpX7VEdxcKG9Nf5UBrT59cjh7PHM7uTn7VyTFR9I8mUWmh2drdteKoaWn GGoFEB60AA3zKwaWOI3zLi5dZPJDhvb7054jMtxF2KqUjFVJ8MBNJHN5/q16kDzICOb1NSehH9Mw 806d7pcJkASxDUNWjjAD7PNHWIVAJJJBaldhttmLKY6uxw4b+DGmv3Z3kCiMN8fNjtTbceOUcVjZ zDAfBguuausErolyHkPxyhKGlTso3ymUrO3NyYQJDB5dZHYlg25JJriJN3BsLQzXXqVcMV/matag +OESNprvcmoSEEcWYIdz1BHfLYm+TEhNY7iNT8Row6DqN++SBDUYluYJL8Qeu1CMefJnE9Enmt6E stOI3K5GrbIkWlc0NN0b4lpyHz8MEo22hDXHxoE6PStD0yFJETaXyQgrsgJAowFd/llfNJSW60qG VXrF8Z+Ibd8iRXJBeZ6/5VivI5Q0K8mSh2BHTxwElEsb4s/ND8t3SR51gLKTX4R0rUiuW45myXFy 4tniPl9rzQ75YUndbaSSk9uDujD9pVr8QzJEvT5uoyw4JPd9K80y6ZfNaapYiSKqyWlxHJwWZdqk VrQivfMeVMQAeT2nRfMWlSRxszNL6kgLRlfSZCexdC9SOzKB8sro97H1M0nvrlLdr/y/H9Y+H95b xtyuQ3WokkDEgDpRcsEgdkGHVKtOlnvZmmtoU5SkSN9dRZGDCtCW4r8h0xoXSyJjT1LR9f0mzlim 1O8iS9/bs9OJBAY7eowIRQRv45TkHC2xkZeb2aHXbbW7Nfq4uIran7u7DcZFB6ksu4NKVp1zGulB INlBQedtY0G7SLVJZtR0WSiRakrgzRjcqJOQrsadanbISkbZ+Dxi4vVotZvvMItYba7N5Z2ZLr6a hQ8AQCRzQk1B7mo+WUTmbcQYSLTnR9Xi1TTYq2VuunQMbbUl9R5JFmI5eqW5gfZINABQdcsI4hax juk9y11Hd/vTEsdmpYyEkK1sjEL3pU9u9crkmt7YV5h0y7nnt30+R5LG7nVtRo3MGoogoR9lfbvv kDwjq4eXBfqCEvNEl06zm5wrIbct9XRRs3KhrQ98GTf4tfhiIpryNql5puo/p+xjHCGXhPA6VoR1 5H9n5HbL+zRLHPiqw67NGUr4eb9D9C1a21zSrLU7Vg0V1GrkeB7g/I52uOQlEEONG+R5pyQKfRlj J//S+/RUYorZhGt+Tre9ubbVdNb6jqtjIJYGjoiSMu/GQKNwcJAPMNOQZQPSb8ujDpPzx8n6bc3G meYxd6Fq1m5iurWWB3TkO6yoClCN9zkZkRNNeHUyyVcDu+evze8+eX/NTxyywzXdpbk+hBboWPEb gu5HEV+eanW6ihQ5OywThj9RFl8K+aPN0Ed7Lb6dpE1rESQn73lJsep4r+rMAZgRsGcsxlOgKtF6 R5onuLSJbp5JHBokaE8V8K8t/nml10udFsMqD7m/5xl8x2uqOfL+o/VxPbA3NkpAV3H8vUVK0zb9 hTs0XDMpQ26F9n6xrWm6FYyX2p3KW9vGOrHdj2VR4nOqpqlMDa93kyz+VPOtrcyTalbQ3McjNNaE qJSo+yStCafLIk3s5ODJHHL1Cy+PvzOtrHS/zI0PXdEtaTWrxRiGWsTT8HBWYp1UAgdeuVZcxhDh Y/ljLIZDkenc9cuPzr8zeb7Q6PpPlq00qW8b6pcapLJ6sjKSFkMacVAJ+ZzC1GtGOIU4csiY36R3 Pob8vtHnsLGKa4ccRB+7ABApI3LcGtCABXKNHeSRkeTlagiMBEc3oEL212/qRD1Qmwmp8P8Asa9c 2MBGR2DjS4oCrpMOI29syAKanUwq3irsVSDW7wW9s6cuJdW3+Xb5nMbNk6ObosPHK3h+va4DIsNu 4Mzoxj68iWH2qmgFSaDxzWZMnc9XpsHDueTz7U9YWGVUm4iaF+MtRyZitdidqAbnp9OY4lvu5cMf OmHaj5puJLi4CKz84mhjaRmULUUVv9j1A75GTeMQAHvYlqF+zmqH94xHxgmoFKHvkeTZy5ISOWhN PjAqBXuclyXmvaarOopU1JAqBv1GTB2RIIm2vY0pzUqHG6g9vA4TIUvhik5ieOTYkchQKCabDcZI bMZA0qtI3M8foI6H3yQnaasdy74ZAy03b7QxBpIFFQkhVQ4JHEimSI2tIO1pbPbpLxZGWqnsa9MB vo2QO26XmNhy67Hc165UVvdQILR/EvIilK/PIcKBzSi4s+RNF5Hbb2yJizsHm8180+VodQiuaxqT ICD8Pf6KZGzEpoEPg/8ANL8v7rRLg31ryjVWBqBSh2pQ/RluPJZdfqcPExbR9Si1KGGz1VirJGBa 3S/CysvUV3O9MslQO7q5QMRYZtpmry6fKImiLqGCqTWj16pIhPTwIORkBVsOlPVPL3m2EXJSN4NP l/lkBryHXgzb0p45Ua6MTvsXoEkv6ZguYp5IYrqVSsASnoSMwoVZVNBUA9dseKk8I70LpZl8vyra 3emlEdBFEkQBAUAheUlWAFa/RjI2zs9Hsnl3WLpI0MV3BDbqfj02CHnzY0rTgp3B7kHKTG7tG0ub 1GK1stZ0ua0WESJI/O7nLBSTSioVpuVoTtvlcsdhjHIYnmoaLqmo/l5cTWiazM/lu74w6hfRPR4P VILwsTuyhetR7ZjcPCaLfPHDMAQPUHtNrqHlu28vPD5Pdn1C8uI5b69nXm8iuoVfQVCV40UBq1OX 3ERoOvIlx+rb3fpTm8s/rtrfw3Mvp6mg56hY8Aw5cahR3FBvQ9DlMo7bc2ZPxYTourSaXdG2cRi0 EJFw8yK4hjHQty6EVoPGte2QiT1aSaY95v16LULi9tY3WGbTvjnt3RQEiP2X6iqkbgjIzjxS8mrL js30W+Vria29OS11DT7lrtEGoIlCrRyCqSMlDU0NCKZZizHDzcWcYjcGn1R+XWv6foNnLZ6peekk snNJ+J+rivYGpI+dAM3Wj7Zw8pkB18sUuLiRvnD8+PIflWGQDVYdUvE+1Z27AkDxZjsMys/a+GI9 JBauI3VP/9P7+Yq0QKHGlfHP5tXflA+eLfRtUid/rs0Mt8YaMaAqrBwOlfnleUR+LVhzi+CI5F6/ qfkXyzFpFxHcLarp88BSAtxpQj4SNtz03pmLLSCW7mZMmMw2FF+aWu+QdO1DVL+/skF3DZ3MiRyc 6KFqVZaEgCmYmo0piDQY4MMSPELHBpOl2Mr21sSODbcQGANelQc5HXYyJMxkBkQ9g8h+VPN+ozSX ugzQ6aNOYSJfmNjIjHf4CGHbtmw7MzyxsDp5Zjws28y+WfzUFzZ6jqnmuS/iU1gS59RuKVIK0LkU NNs6CWuMYWQ0w0M8c+F4556uvNGmS/Wv0k8UyI3pG3Zo3JO1AUbkPoyiGsMjzbpxBNS3YT5TfVNX v4zPdP6yuJbgzOzy/CwYsxdqkUHj1x1eafBdORGMYc+XWn2Z+VNhaz6zbaRDafWpWeS5e6Y8TGib k7E1B2pmmxZTly0RbZCRHEY8n2g9q7Q21jC3oQjiboqaNxA+yPn+rOkECAIhpGSiZHc9E6jiSNVR FCKuyqNgAM2EIiIoOKSSbKrk0OxV2KqE0vpLUkL7n5ZCZoMoxt5H521i4ALW7mGC1DowK7O5oQQf 8kDwzWanI9J2XpgN5cy+fNT1z0ZJ+MqTSSEhZV5MADu5B2J/hmHvVl6IQsV3MLutWWb1pZDzeVSa nYCjA7A99sqvzbeGgxa41AOea/aG4Ud+u345K6ZINZnowfepqrj36jALtIVBP6Y3XcVIpUdcTVpK HWYc6oTUg71JB/HHqyMbRUcZYKWcfCRuT16g5IhMR3Jr9ZCrGsY9UAfEg677dctsUogmVvLM6kn4 eBIRO4ptkRIMKCNQMKkmrkdB44Rup3aqz8+S/CKb+O2SBNMDsFFbaKBW9ECjHk1T3ONdQx8Syg5i lSBU92XARuy4rS6RDsw2rQrvt8sB2UG1Gp9XgCefHkNtqZXJkdwh5bZbkfvAATVW2wVfvTxU8t85 +SLbVLG4hlgVxIn7Qr47dPfKtxuzu35/+dfKd35U1maYRn6nJVGjVagCpZWG3XxycZCTrtXgo2hk 1EpH6d9Et7ZS0AKU5oTT7JNamvSuSxyvYurlsbtGQz3s3JbF5tRgiXkk0dHmgodw8f2iNx0yUx6W P2M20rXL6zm4aiizNCtDeWwaGUJSgMignkNvDbKpRZiJ6F67p/mEejBDc241KwlHJK05NsCeLD+X fagyIG6BY3ek6ZfxmHlo0w0+IoONvRgw6/3jUqQfYjBe9LZZrouu3ulyr6kQu7S5ZPWloJFicGoZ CdwT49D4Y2xnit6DKZ9dtI7ceksRWRFt3RaypKa1cr137ncZizF7MscjBR0jVNX/AC5v9MEnNdCF yZLWUkOIJR/MpJHAkbGmY5IhzciWEZok9S+g4dcg1X675itrKC1N8yRTPHxlkluFNKpxCnjxoSSD ue+TiSTxdHBnHhHD3JV5h0jTNQlieCP9G3t9EJI2eM+kRsJIXbYchvTtkz6kdQebBPMHl+fXNWM+ n+ra3WgrDaM0irSWEDkxYCoYAEgA9cEY0KLXMWyzyv5EEV6+tfVDZz3iH61bdYwp+xTsu1NswNUZ HYOBOB4qknevyQ2lpNzmVVjBVo4/iYCmxAr/ABzXnBxcy1iBunw55yin1/zKbDS74Ory8JEuEKFO RA+IkEd9t8z9JpBzRUQd3//U+/mKtHocVIt8r/nr+WZOi6x510G9+p61YRNO0sgDqAu7E8hTb3xk BLm4WYeFHiBp8G2nnz81POmkRafe65PxtqwrKirG1KkCjIoI2981M9VIEgOdp9MMoHETRQFt5V1/ lOuoeZJjJPIGnHLiNvEIBU+5zE1GrmY+blHBhid+YTGz8q6guo/V7J5LmOQVExjJrTc8fu75qzDi 6c2mQs+l9Kflt5o1HyBDerfaa2pWl5wP1fZHR1GzDkpHzy/BqIYDuGyYnAgx5pr5j/NrU78l5dFt raxj+GC2YF3A9ytB+GV5u1eI0AxHicVk7vk/8xbnWtdla6gtGWViVhiAIUV70oDjjzjIdtlOOR3L 2b8pfyRv7Ty3Bqeryyvd+aVQ8UWixQAkpQ7mtTXNrmJMfTvQZ4NOckbvk+uPyp8nwaLNqEyIVeyk Fok3dgAGO/XwzB0WA+LKXc3yzAYuGty9wtUZ5pZnXiA3GIHuB3zf4IkysuLkIEQAmWZjQ7FXYqhp Z0QE1B45EyZxgZMJ1jXBE8kQWSbghdii7KBU9SfAbbZg5ct7B2+l0ljiPJ89+bNfmuZrhn9RbL0u SMzgLErNwZxCv2mAYAAkb5rZyMjyel0+AQhtzeD3epx/WLgxK3EAoGf7TA+24H35AAuwEWPS3TyG nqUVuq9Ke+RlE9WRC13pHyHwjoD1JHfJcJYndfbyVYjqP2T0wbhB8keOLI5apag49dzkaPJO4UuD fCIwgB3O3T5ZKJrmz4rKMjiq3JqNUbKfs71O2HiMmQkmELI0YKxKHWgI26eOGIWWxTO3biQGYAsd x44RtzYFFsxSUEb7E0X9WTCLcayByFMbKdh7ZYO8oK1oiIhIoPq0AIJ7YCUcKDuYh8btTkRQeNfn kAb3SIhBArJGqk0PgfEdKZMRtMTRUQrePxRE7+1KjK5CubI1ey7jQhjUqQAajvlXF3MRul99GJY3 qOXagHjgk2Dk+e/zO8kJrNpNLAqiUq3FuP2dtgcjQjuEZIcUXxJJpI0+4uNMuY2SKNzGI2B5IQeX H8dsQKN9HR5oSiUlu49T00i60ycR3kUdHtpF5JNDX7anrUHrQ5kgbOHk5sq8v/mBbyx+nf2zRzv8 BB4upcD7I5qaGoyMgQgX0L3HRNe0W7to4oFtZ1ALOpV4zyr8XV+IPXp92UdLDYJWK6sz0q9sLaUN ZWVyUYl/qXqniRvulVqV+XTIHdkOIPTdG1F57dXtrdbaSJ+MpuY2oK9/UHw0+eAExO6TsGcaXfTW 0kyTSsskgZrdEAWjN1bkO30jIyKeSbwSWjwmC7CfV0qr2qgszgfFUM5IOY8sfGzjPgNhU03VJfLu orGtxNLpcygCLmWMLcSEDbjYVzF3hsWzKBmjsN3quiT/AKWt7lvq80huLkPEqszxRgISPSX9kE7c a71rmRjPFu642Bw8ntXlnRiILi61Fy8tyQ95ZcKrGA3xhWB3C9qjM+UYxiC4RybV1THVway/UisO nyEVjLFShA3Mm24zQ6yQmfSwI4j5h5X53tIrvSbO00yBYpmM3G7f7c8ileb07KDsoyuGEEWyjvbx z8o/KtfM2pR6ppMlyLuZ5YZAgb0kiYqHkBrVZCu3fvm67OiBHcOJl4oS23f/1fvwkiyIHjYOrAFW XcEHuMANoEgRYQt5qFtYxNNcyrHGoqzEgU/HIymI8ypkBvb55/MHzg/m2yk8v6TAj6NNLw1a4kah kRSDxA8CRucxMmq4gRFEMIykGWwHRG+Sfyk0C00dZ4bOJDcsWoAOnbtlMNMZiy5sckYmnl/nfyJp ml+ZXkQR+jIgdw/RSfbMXWQAHm04jEzN8kmivPLOl/uXv4beWFxI0yKaEAdK09uma6Nd7kccAbLC /NH5g6aTJ9QnguRTihcUNR347U9sry4xLe2ozBLA4fMkt0G5mGUH4jzWq19qHtmrzwophY5FPdAu LG8u5o7yZI6gFW4janhlUchG10mEwD6t3vWn/mGdP8vxaDo1yJHsAAbuSMH0YG2ZwagUUkDfxza4 e0ZwgY97CR3qF096/L1JE8u292moSammoqb1Z5YhC9ZTUKy9qCgzaaEyMSe8t2SAFDf4vSo+XBeX 2qDlTOgxiouGatVyaHYqhLq4eELwj58iQxPRRTrkJyI5NmOHEd0lmeRwwegUULA1yo+blxiByYrr NoskE8hb0FLI7PXfgpOwqamvgMxcsKdlpp1IDn+t8w+eJYJ0nljtZY/WnMbzTBVYCFahUjH2Qagc m8NhmtJJkQ9RpuLke54tMVcuI6CMGhQ7/LfAHJo80EIn5f3ZNRWmJNqSqc2PFVHEftkgGlMN7c2O y48lU1ofYeHjtgiDzREKjSs/ExFjWhZO5piQbZ0i7diic+NZOXwr1xG26kb0i43JPpkcVJ2I8fDf BG72TwkbomGka9DuaMp6nwpkzFEiTv5JogqGOx2oBUbEZIDvRW6IU0p8W4O3gfbJgoAVPXAejkg0 oPfElOy1mJFC3JTuFOxFMiSnhIChNykHEVFSKEjw98FEbIAQki8QCaKy9Gr+OSidkSF8kJHct6zo wGx+GvfAWF0qO/FzwANdum1cryC03shkkJMgdKBgdu+2MeTIGkiu7RJY50bfnvGp9vGuGcLOzZLI NgHxx+b/AJCZLsazp8Z5u1J4wDTxHKnttXIw3FFwdWBT56uv3dbW8PKFwfTuq09GUD9odl8adOu4 wC48t3TmNCwkz2RCt6kFJo2H1m16ErQlZYyDv0BrXfLeIHmxid070rVL7SryC4sJPrVvzDtEwDLL GSARt0ZPfKCDuByZij73s2m6+hS19OKO3t5wHtLpFqqtvyV1qQN/DfIdEmJrmy211C7srwXMjlXY KYplkLxOp/mFNqHtgmLCQej17Tdd1G6URQvzmQLKyIVk5ilNiw3+k1GU3TPhvZ6Ppd0t/ZRTs4Ex f03szQmoG7LTw75E7sNhsUdcc4z6Tvxe45GJmWoKeJp45XLGJMoSrcJ7oet3Gkej6AlaBnLTRCRl MbsvBgq/ZJp7fLMS5YzXRuOKOUb83t3lvzzaWltJO1xIgZAk0TVXiwHHoK1Bwayc8sABJ1Wp0phK 65Mtm1j1YBcSD1ISvxFWNKEVqK0/VmBDIYD1OGYm7DE9V8ypZfV7tbOHUdJtXkE03El7aiAgycWB A61AFczYS2scm2G/Lmj/ACV5msdH1vUpZ5VEN7xIMY5pwAqq70PHj8QI+WbrRZoAbhxtVCQIlzf/ 1vRn5Z/85B+bPLFtJYT3H6VtgoEUVzK6mI9uLA/gRnF4O0MsBV2GGPDw2Q950H8w5vOlvcXWpanA ssZqsZlCIq9+PInoetcsjqZ5juaDdjjjjZlu82vfM9ldefdF07SbhriF7qOO9mBpE3xDkB88RqRG QFsJESNh+k9lcWlvp0DREJCsY4R0A4inTOlxZYjHxWnhPc+aPzE+q6jf3l+k45ceDOTUUXotM5nX am58Vt+OAjHifIfmB2N45SYpDGSAyClT8s1cs4kWAj1ePeZNQt7eRhG5aQEEM3UEZdKXpTI10Qlv 5kaBOKqFPEfEpJqPHrTMKZPew8Qoix8zX9xdKtn6kk1SFRAW5e1B1zHOKctwijIvqD8pNG1rWrzW dL1G1ms31Kygkja6BijkiiuI2kTkaUB5L88zcGCZNFztLir1Ev0D06KJI7a3G0TcUSMHtH0O3sM6 rSARATmJJJZYBsM3Y5OubyStHbATSoL1o3crTka0yslt4CBaEvYQ7A8Wcf77FaE+5wEAtuKRAYb5 jVHtgssTywLUSxxvxPFiF+EkgEsdh4Zi5uTtNEaltzfPHmDSoJZLmH05Wu2dJpEArFBydlYtsqlh 0IBGa2e/J6nBM8IJ5d/efJ4zqWl+irII+AVlNWoGrvWtCRgA23cwbpKT1Nakigbw37Y0GE4ockVd thU9Ov04OEdF4b2UovVedoyAImHwECp+k4RGh5t0YARRzxNDUilQBSnU5ExKFyDkDy6A12FKe1Rj IebC0WpA+PgBxbZj3FMmBVFmLpEQkyAtUgIamnT6cIlunh4QmaBj9lSENKNTvk+aDztGBHCsG2oP g8CRvviY7Nal6Qfk0h5NGaU7dsjvTI7bOaqUCsSFqDXx8MHRbsKZYFiORBPUkbVHhkrK3SkQqMGk oV7r3xq+TEnuUZYxLJyZaemfhIO2R5HdgBapJEtOa0oDVhkDYLKMV/oIhLihLEEVOw3xBQRaBkhV zT0yoc7qw3ydepBDzPz3oP12KVJFBtbqsUvLtXbf2yVW4+SiN3xx5o8mS6X6wuI+cUoZWAoBzj+E sfmB1/hksmMgGnV5Dvs8TuLu40ieGC9Am04US0nqOUNNxyp1Su1CdjlESDs0yBrZM7nS4J1+uaeD aXjACa2beNnALB0IB2bluKe2EEUsZHkU68o3Ek/KxnRrFJZORUmgEyGoKnoK9CMrmKba2eo2NxdO V+tSHkHYPF2ZR1HAV6U275We9G3RlmjalCZeUMzw3Fm/wx1Klx1qBXfbpXfKZhs3e1+X9chlni+t xmsTgzqv7ssCfEfZrlO97cmMoWHqMxhu1+uF14StxEKgc1B/uzTptTrkgba12lI0t2YHjnhVB60h ah4pG27FSp+E9CadxkaBCTIjdm2mxXlxzpbx25Lh4rdApPp0qrVIFTtU0+7MPPhr6W4akHaT0OC4 nksXsbuI/YoZh22FN9/HwzAygSFFEtJDJyLBNdsp/L8UeoWqSX1tcyNHeW9FIkVuIKO/L4T8Ox45 fgPAK5uBk0xx7pcbe0mvNNn0u1JtRNz0u+MhWWCZAA9tIEoopXbqDmUZUNnGzSJ2f//XDQW86o7K zoTvyAP6xnHxwWKcwYxyT/StTezin5TNGo7MKEj/AG++TnpSBsx8AAsj8r3smpeYYZeTSQwUcup4 nY7UI6EZrM2HwzfItXBZoPt6fz7rNl5djM17NFaxxDkJ5PiYAbUNBXGOqzHa9m86eMQCS8HvvzHl 1EPGC3AMaoCSWoetMxctnmyEbFPLde83qyzvx9MgkBSCRlWPDK76NP0nd4VqWrz6jdOCp4ltiRTe ubWEPSgm2T6ZoV9fRgRwNQbId6ffmPPGLpAwksvtND8w6KPrUE72Ed4ArSQErIQOg5ipH0ZdDJjx jdyBi4A+ifyHl82JrJ0vQ/Xk1TV7V5ku7vlcW0cMMkasJUeq0lT1ADXqBluHUjJL0hycIBj6hUe9 +lWn6dbW0dssEfopaKY4IhsoA2JH450mnw7CR2cDLmkbHenQ6ZshycdvCqlIGZTTY5AshzQ1vaiK rNux3GCMWeTJxbIpqBasNhkzVNYthHmh4xZzVAht4oy0jcA3Km+305g6g7O37OieMdSXhvmENp6e pfQyRJqyG4S2aRWlnZW5BWCkmgahNMwC9Np5RmKjvw7e54RqzvKyyXPBRMeSxp169Kb5S7fEB0Y4 IUehRt6kAf1ydiknzaa2RXLEVBUbe+CQvkwG6xbcKGcfuifsj+H05IRIFpuhTfD96wC8tgTv02pj TLhJGy/kUG4IjQg7eHj9GR4BzUQsIwIJGUxsXU0qoqdvHGrZDuKYpAqqGHE8ug8e+WkCqYVujo41 AApUg9vEb4IijTAm0Ww/dlaFmU7HDa8JQJmqGV1+ruWFK9+gwcXemUd23NCxb4g+9fc5ExrdjSHl QcRU7k/C/gMY+aEG6SGU8iGB2BHSnywylTGnOrDZDyUijA/ryo77t0aRaKPRQJQlTRzXr88kY82F qMqcgYw1GDdR2IGxpkfJRaIbkyRlqUZuAkJoeQ6ZbYtonskesW3qO9rOo4TCjV/mB2P05bCnGybx t5J5v8uw3N9JDMitDJBFcoG6MpJicbeJX7zl5Ozqshvk+MfzJ8qx6PdT3cEJk0x3kjaGSrhSCRUV 3AoRXwOYWePUIxzvYvLNL1a6tHGnXTKsKErA1AHVaDYsamoB+kb5j89gmX2I6C4ktb/0HkaO+58n AJ4TxE1SRRXrt1GQlImOzZEPatPvhqFtFcswjmhKid1+IMw35mniNjlYJOzLg7kx4RxzK/KhcKUk WtGK068a04+JGSMtvckS6PR/L2pzx3IhuFpAwamoMQtFr+0D1G/XtmMRaTyfROgWVzeWc76bXVUt IWnvbRKNKIo92ZT3oK/D4YY4yN4tcpA7HZ63oOi2uqaTBPo148jPZ8rl5aJcwpC1fTbnQFXJBAB3 plox7NGSRhtIUyvyZZx3941rzLcWYcW3K8djuKAGvhms1+bww4mU8O56p3rGnSWdxw00m4iuGHps d3RhsylT12Ga7HKOQ1bkQzVUkVJpouLNm1CFoZYY63UYj5C5g60jFRRj0r2OZ/5aWIcR5OdDMMke HqWH2kmnaVrttBo2lPOmuh0tpJqejAKhmZkALGUU+0xp4DJSyARt02pjLGaPe//QnjaHfXJRbfkp NAE4dTnET1fA3SyE7BO9c/L+fSrF7yaXlG8RqgWprQf1yrFrpTlv3txIhDd535Xmu9N1CP6ih9WW QBeWxWp3JpTMnMI5BZLKMwRtze/ay0l1pc19dX8jxxRUELkgKfAfPNXDeVd7OWMRjcty8msZLP1g UlYNSsjcqVr1AGSnGwxBFK95pMeqLSGSscnwnY5jTy8CJGJ6Jtp35YW8csVzNBJMsfxLXoe++Wx1 u1U2jD6beh21rpWlqA7K9R8aLtxp2PhlEpknm2eIKACYjW9FtrdBATF8XFLf0frAkJNAvCoQknan fIRjxHnbE5TLan2z5B0qyW2sLqz0qLy9JMI5f0WzrbTzAxqRLcQITU8mNEB4rXuc6Xs7TAUeqcmU EEHf7ae4xhlUcjybue3yzpIkxG+7q5GzsrK1foy3HK0L8tQ7FWjQb4CVSjUdQjggL8wGHROpO9Om U5J0HJwYTKTwbzx5s9Mz28FwWZ1pCrsPhJFORUCoIA+GvzzW5p2XquztIIgEh87+YNVFxeRXIuZp phGBNNKakEncBsolu76AEY8IArmxszKzE1IkB+EHeiHAAQWcSapDuY0+EHi+5Lr0I8Tk+Fluea5T KYQKE1qCx8K48mXDTSvw4ozkqCDz9/DGQNBJjfJFn4SW9MEMftgb0r/bhax9yvKY6APEWV9gV7V8 cPRnG+aosAi+G3fghA408e+Q4a5I32J5pqscclNxQ/Z8RlpOzES3RccK0G3Hj3Pfxwea8W5VHQBg w7DZF+WACmAKFkRSjs6cl6jliYgpCCUMUco21fsdgPbIFTKlYUegpsq7j+OBqGyBuIipWRVqa7gZ Dkyj1Xxr8BLD/WA7fRhBFbpAVkVACg+E0rTxxJ5+bCYW8E4sab0BB71GIA5rdinOokDRk8RKKgjo rDcYB3NMjRpBXSPdxsrt+9Cbn5dPxy+BpxMppiXmKC2kitJAOTW6vBITszRSlZF2+Yrlt7buvykx BfKn5gae01lq5ceq0Mz3FtAw+H0mHxRjxHU75TOceTDgFinxveQR28zQq/GEuHilb7aAitCamvEi h26ZiyptFlNJWGr6VEYlC6xoDjlGpIaW2f7Yr2MZoRv0yqPVlAUaLPfJGsoyy2d19tAsM/QU6+kx 3/aoR865CVA2WwE9OrOJRLBKY45Kvao49It9qM/s026jpgxkBiRR3RthO0tIhO0htWIRm2PB+jUG x2GCZ3SH0H+W/mW84tFDL6F7Zk287RkgSihUVFf2ozSpyEJ0UZsYlVvrn/Eun3NjZWkVklkyNGuj XMdRPHHxBdXZFAZQTQV6ZlZpgh14MwavbuZFoFzcaHqK6qxN4ty5N2YKHmEAU1BGxIYE+Oc5rsX5 iBgCyyQGWO3Nll1qFlf63ayep6Vm0qpcfDwK1qOVPkd8eydLwyjxOMcc4wHeC9D1/Sbe2jCw3Lyr ZOqQ2RPMx89nC13oetM6rV4Y+GO5GmzC+4sP0DTfS1yO3aKK4iUCe3jYDdS3Fih8VPbOejH1mNXT mdoDjxib/9H1bps9rb30TSBVij+EUArz9s8wy3IblMSSbR/nDV9PntYLPiXMu5lPYGn9Msw0OTlT kJUKeLNptla38M1lynd3BPw0Ar75kSOyCOVJp5gfU7u3W1kDiA0fgNxt77Zjw3OzLJEkAlLPL/k+ W+WWd42ZVKLwUbb7n8MOSfDs3QiD7noY0K108Q+kpjbjQq3UH3zEljORJgCrXmq6gbR0t5HQBaVp Qbd8qGIR6NZjMig8c1rWtQsZJmkIPKpqNht45OY6NJkYp9pfmH/DNt5F1GW6aTW/Ol6ZjaW7BJrT So7j6rzWVg3pyTyBuLAV4j3zKwwEYE9W8RkJRHWrP49z9EfyP8mrp51bzRcapPq97q000EdxdQyw zoqS/GJBKoJoUUAqSCOlM6LsrDKc+It2skMcRjiK6nk+hriRYI2q3HaubzNPww67HDjOyG024Fz6 kgaoNKZXocnES26jHwUE2zZuK7FUvv72C0gd5XVQAdid8ryTERu3YcMskqAeOeZtYjdj6skqKvF+ MewIagAJYd69B1zW5pk8np9FpzGNgPnXzNcG7v8AU5qGIq4/dluTAsSVc06inh0zHkHcYzUYsBdQ ykuhdeNXan+fhg4ab+NTYrUsvFZDQBux8ARhGzMGlIRRzPQLUxmpG4FaY3bZxFEqoJBrQqDTfr88 lHbmyJ2UyoNCTxPQAb1Jxq2QlSrHKqssTnhU0L9BWuJFMCSF63cfqn0qTQRngzU35A9RgHkjc+SY x7/ER8K1KGvjloFM+L7UyhiLhOC9TVj4bZEhhIgJqIl4CpDEHr71rtidw1cW+y9XjcMBvQEMwHfr gZlDmElGYNzU7lSOgwFFpcnAM9V+0Dx9/lkTvszINNGOi8OjkcjvTbwyJ8mJCHlXjJTiStPib36m mV3vRUAr6KlKVNQfiFOvgcRJICmFCcjxrzO47/Rkb3Y1u0VETAofo/rkia5Ktjj9dW6rQEhR+zvQ /fjAm2vIFkBKtPG9RLFFIDUbHiOQOWxkK3dfnFvO/Muor6NkrEK1xCUmQDf1YXPDf3Awzl1cQi3z 3qrCYyR8vUaIuCrivOJiWCnxpWnyyqchTVVF8oedtFksdRmDStBaXCG6glIU0ZqnjUdAwJBys0Q2 k+mwwmwuJNCv/VnTnGVRhLTaW3kBFQw2YqKg0yqUdtmPPkmzxyaVr0LW7lraWP1bcknjcWsh+IA1 3aMkn23yo3IX3N9dHspvV1HRRrHrObrTx6Vyy0PKD9hz48OhysS6JpE2K+tJDe6dIsqOAwj2AIBI NKkHfpTJ3YpjT1jQUurLVVv4bcrb3oWO5KtsChqrGnQ0NOnbKpBsJFU+2fy7so/M9nLbiYevZwG4 eKoDiOMjdR0qOXSnzxyTAh6urq80eAvRisenzKGeKWylj9O4dakhXAAbboUI3H0ZrBIG66Ihy80m 1vVZrJLiKwf1YFNFvXX4hEPAEE1HWuXaefdzCQCzjyRqmoapFdTX1ykUkV1HHDPUtG8zJUirfEDT fN1jEp0HGuMTuGdS21xpeoRSQhPV008pFU8laKQfEK9q5gZoHHltzISGbFw9/wCA/wD/0vRflXUU 1HULyRwh9HeMOelR1zznLD0tmm2JJQ3nW8gFzHBA/rTOnxsnRR4CmY4lwhtyTufpSfSIJilux4qA /wBlqlsfFs2yB38me/Uo7uBowBx5DmTuad6ZETANtoBKc6RawWVVhkYK+3pr298qyZBTOIFVujJN AkvCXMtJXarOd9vDI48tr4dFQ1TThY2fIhHjVSPi2r92XY92z6Ru+f8AzBo813FPKOKijtyNRTuM BA4w4kdzZ70T+Z3l/wAwHzNFpek+XZxeeVIdO0nRrm3R2kkt4rWN4JECfaWWR5GDeJpWubKOIiIH Pa28Y5TlcT1/HwfqJ+T9hq+m+R9Iv/M0l0+syWw9aO+eSSeBC3Iwu8hJLK2xPtm77OkccDKWxXXC JmMcANuveWRa3qVwTFEpLXMzfBbqCSFPdvDKdTmlLm5mjwAWeg6p95bjuI4pDLGyIacC3fM/smJs kuH2jKJIospJpm8dYluoalb2NvJLJNGnEbcmoKnpXMXPnEIt2LBLJKq2eQ69510nTlCajd2N08rk HhOA0b05KG5EKo4kHc5qMuod9g08ibjca8nhvmf85fK8Om3b3cljbyXsHo2aAXF1LI6NwKMwVY1q u675jzzmRsbOdjxTidiSPsfPesfmtE9pMbWbnJagNHBLGDJFFzNfgIBdSCK8QxHtjCZJ3cjiPVhG n/mfNqUzQhYIQwZjCCE5CnI+l0rQHp+rMjjIbIzZXZa/DfNxLAbBiVNRQ9PxxE3MxysJ9b3/AKbK zEOrVXrTrhxkuQKIRgvHi4ngHiUVBJ3BJy3ibKBHNQiuFCyOsrFgxNQRQEn7O+RO7AgqN5fuqBKh vUJ+PwNPfEmhuvASksOpvFJOFZeEAT7JJFWqSTkIyopuN7on/E6pMqTXHHnT0xTlkhPdqkTzDPdI 1y1uVVRORKf2CONR4jLYGyx4rT/1RI8ZUj0+p+fyOGQDYCFfl8TjuBTwG/c0w1sxkaRUaoNup61/ hkAw4rULiBChbjxCj4SMEo7bMhMnZLgVlFKV/ZDH2yvhAZU00dIwVPI03rsR7ZUe9txndQZXVmdQ Bt9jsMpEmZAPVDNLyK0UnifiI99sbYyG2yyNWPJ2Jq5DBQe1e2Pm0nmi4GKSmqghuSVHQ1B/28nG 7acuwY9fagYJFlUUdAAxJ/nWhr8sssAOFkGzyTzHdui3ZTd4yLiI9Tx2qB75HITQ82iIFvJNanS5 SZ7BuIKgx06lwOVPpNR9GVjZp3vd5t5h0pPMGmC6t19O8iYmNAejDdo969SajBOJBZQrkXy7JItp OdPvpDBBbyl4Sy8jCWY1jodypII9sBIJoJI3sJxZzI13J5cvTSWKVrnQLtjQLIal4wwP2W79sp5e rpySJEHkzjybqi2GoS6PqUP+j3QMUsb/ALDEEFWr2YGgOVTFDibh3shWylsGudHlQokHN7OSh3SS SoYmgB2YY8fCbHVRCyyvy5rDKk9jfSPytWDywk/GqBjxdSldj9oDCdvegbW+vPyv81TabqVpPHdm S0eT05LhHKs0bbOtQRsdgRmFniZxI6tGfHxQ830vqGoxQwk/Bdw37GaSVKEkcfhKgdGFN/E5qJkx qIO7hQu+4sQu9VF1NFbQSw27S2qKzH4qtuAzbjeq70za6eNblshudyj7DzUdLUWbFredeVwshJ9A tCVjJ5DoTWgB7Zto5DH4NU8dvSdH89rqNyLGVWkuJHENzECCYi4qrE1rxI7nKddIZI3yYYrgR5P/ 0/QXlzy/Mi8hzjmaIeoaUrX3zhs2E1uNm2EDSKm8vM7mS4ryDfCx775gzxdA5kNPQsrpZY7FCsKx s8R+EnrlAx8LE1VeaZWGpyemSwVWYVJA7/LKSLOyiR5WxfU/M89pcP6NwI1VhyYgeO4y3Hh4mW56 vXtB1F2t4pVLXDSxh259B407ZiZKgdmwXw2k2salDdyBbh1CI/2B9n6aZfismmJJIspNd3GnSWss QhjErgiJyR2GwofHLzgPMsZiq7nrPkKDXZ7R7PTvOt5aLYWVvJ5f0SaaI+ujEi4giuJVMqFSPgCO KGlMycOWXIHo3QjCI333+x9U+Q9Pj0rywfrUGoQJDJIeGp3BuJ3qFrV5KNua7MevTY5vNNC8RnPY ebXqbOURiQb7glUnmC81bWk0vTIoikjut1cyoarBAaSVdT0r0OYfEcuSojZ2kdLHDi45kiuQ/pPV tKjhS0j+rtzhIrE5ruPHfOl0OPhg8/qJmUt+aVeZfM9j5esZrq5Ykw0rEtOW5C9yOlcGp1cce3Vu 0minnO3J8R/mR+e2nh7q102O5utZ9V1t+U3oW9ulXDGUijM5UA9KCuaLJlJN3zes0+jOOIO1B8a+ bfzK1f009DVE+sSB2jtYgJFo4LCUEAAOa99x4ZA7N5hewHxeE6v531u5haC5e59FZHlq05J5vSrg D7JJG+WGq3WWOurF5vON3JBFHdF/UjqyXjDatOr8acW/yl+nGMd7QIlba+YLpT6guCiSin2w29ag cq0+W9ckSwHN615V8zy3EcQeV0mtmCOuwJXtWnUYg7uVjfQGm6s8sMfqMAGUbjoSPY+OSunLizWK WOSNVUluQ6DxGwwktkW3R40kZD9uhMdN61rtiJ0k7sP1jUpbW3e49ROMleHfjXY5Mz2ZEiqDzxfN D+nLGXaGGI1mqd3UUAYn3OUyyebSR5MevvOlxDIJbEISQRFzI5HtWhGwB8cMZk9XHmJDrSZ6J+YF 9ZlmlukeXoaRcyWPWg22yQyloljlzt9B6F53/SlrGHhDy/DRk+AspHTiSR+OZEMtjdYZeE0SzW11 u2mkUSHhMoFFY/EVPTbatPllwk5XEKTqHWIgodqb126kb0xlJFdyKjvrdyI2eqkUH9uRJ2YGwqei CC0a/Aw7b1yE4FnCd7KB2X46hqAE+2USBbAUCzksKUetfoA7nKuGi2UKQDxqeS7qzNsQaV8ciI7s 7o05WCSHgDVV69QPkMJO6JRsIq24TI6QkqWow5dVZakAfPpkouLn7y8/81XJ9FpYlHCYmg/yhQgf rxMgXEMQb8nld99buyCLeVzHGUnVVLFSwBU7djTIk2HF2q76vK7mzv7a5uLMwvGhlBjLLQGOQchS vgwIP+tkRI9QxnVHzYoLqbT/ADLpWnPVdN81xSQW9KHhqERDqm5rWRCQB7ZZO5RJ6xaCAObxT81v L72V/PqwtWSOR/q2pRAD4T+w9DuBsSdu2UCzHZsBlw2HlLpPc2lxBNWPUdAI5MNmEVfglU1NQK0b 2yViNHoU7st0u8j8xWJuo5zHq+l0jvIa1LIKem++5owHfplE4mJN9W6BvZ7Rpd1Jr2gx3kVf0rpS /V9SjIAaSI/ZYU3rt08MoBINW2Cw1aTwpP8AWY3jmdURbv1JOB9IbU2HxfflpukVT2jylfS2N4rJ MBa3FJY4iaqyS/y8fClconsu0jZfSml6tc6jYxwWLepJGQPSrxJ99zsB75TLTRJ4urr8uKpWi7KC OG6b1Lv1Lxd2tk+Nbc9ePqBVV17g5l8HCAiEeFn9tcadJY8/qccxo63iyMw5NKtFY7DYstaDJA3z ZEG0v0bVrPQ9Wiv9buSXatvZo8ZFu0cnwqHkVeI4OOK1YVJzH1PEcfp3ceX1bP8A/9T2PpN7FFpi pJcRy0XZtqj55w2t1PCKt2ESIi3nnmLzenqG2gJCqaB1PXxzExzsbplkJHkw6TVYJAxFwJXenIU/ VlXBxHZqoEcmSxzxxW6t9YHFoqqnetK5bDT7WkRFB5jqlreXspd2Y8zyVadaHoclQiaDZCi9W8ve Z51sY4UV4xAixs3avSma7Ng3ZEkjhClq2oMnMupQNuad64I3A2w3CRaffW813xmkaQ8gY1Y98yJ5 7ixOTfcPqLyd5kEMdpb2PlfRb42rxzz6heLNcPbqxVZZSgJNCN6AUw6bMAeVly4y46ANW+sray1T zBFe22pSrLbWknGJokeBTcxsWrGDWsaqwANTUgnOoGnyakVL6Qxx5Y6YiQ3J+4tJax6Nc6bo2n2a i71FC2qTD4vQtI9gCfGSRgB4/Ee2XjT+ABED1H7mcs0s1zkfTHl5n+x6HBCsEKRrsqr0zbYYcEXT 5JGUiS+bfzyu7lYrRLa1e4mLOFMSM5QLQhjTYCp3rmi7QNm3r/Z/CDCW9PyY/NjznH5cnvZLp44r h2KujSCR5Cx+0EABoD7+2YGONu8zzjEcL4l8z/mNr15cfW0vWsYmNVaMcSwBPxU3Ir4dM2OPT8Yd Xl1HDzSq384azd8uN5fyqRWhWor1GwFQN98v/JGuTh/nALPNEWXmHW3qGDrFE/7xpIiV+LdTWmwy mWllXc5mLNxDY2zzTNbCSRpqFosDNRopAeUUgPSjHYVzDlhlHcG3LjOMtnrXl6+iiv43Wdog4pJG SAp8DkOLam+MhT6W8us119XPAcSSDvXenh8snE23Q3er6fbMVShBp1p4e2WOSI7JpcW7iFWjrVmP xnrgkExhu8y1iw+tPcJDuIQQ6gkCrDsOhpkDOubb4XDuXjmoaNc+nN6RLSrJyRDsKLXiPkDkAQSx lFi1/pUsXGVmaScCpToOXYV9jiTu0SxR7rYvfXlnCxW7gmnWMbxtMIlJPUcqOT+GWR83EMSASnGi +eE0yVZNLuU08o1Ujjcu8lOWxf8AhkhudnCygHmH0F5a/NLTdWjitdZESzqKC6diCtNwelR9/wBG ZHHQ83GqcdwbD060u47wt6F8s0PKkEtakVI4glTxP4HLeLZy8Oeuaf2byxtNG85IWnqV/ZGC24ZO rMtMvZRCsLyCRFpwkrUEdNj3yQltTIVz5FNvTWaOvE7b1JpUDw8crPmziaS/golkXenQdBSmUZHI BsIC4ViFAPgeR/HKtw2AA81OZmUBlJBNAcrJLEUg4LqS2uIjxPGQkA+GGMuDdo1EeIMG8xARfWo2 ciL4nRl3NakbA5MkW4kzbzCHzFeaQyz2N81CjmJOTRlSu4XZiQDXJRmA4E4XsObG/MNtZa80Oq29 zcx6oAJZbNiJFkhcKSIXUgsTStD3wE8VtcSBsXj/AJ60fUbnQ7yXSpy+p2Bh1fR6A+oJrUl2CqaG rKSKUqdsjjyEGpHmmVEd6E1XU4/PXkiW5uIuF+yfV75TUSRXUQ5jlUVo9aivjQZEEwKYgvmuaK4s JzPGpnutHHpajCakT2TinLxIXlvXtjYJIPI8mVDvQckx0nVrXX9Mh5Wt0wSZFICkGoMcgH8wBpke HjiYlRdvYNE1F9HurLX7CQy6PrEhgaJiKo4AIVu4KHatd1zDMbPLk5MJ8Q9zMtXtbeVF13RYaWd1 yhvbccaQT9CjCtN61BwiXemwead6DfTJpelSrWfgnEcQQ6lHZdiB2pTpvTbITO6Y0eT6N8kavci5 UJLwE6gSsAfhpQgt3oaiuCFONli+kdLS11Cwic8FmgAMzIBVh9nY7dDtTMuJAFnq4ABtKpFv/rsF rbWLR2t8GSKZ2IYyDc1O437ADIyFi+rKEiTSunlvUP0nS7FxLFbuZZLSY8lZVIBjZCKGjbih265Q D826cAB73//V6rcebYY7TjD+7Yr8RGxJ6DPLc8JkuV4gpgUk1/qDtcrE/UhFbbb38MzdPAEAMIcR Foexj1B7h0VG5J1amwr4HM2WnqqZxjKRevaDZveW9izLU/7valem2XTgIwZxuvcyefRrS1ikdlVi xJBPWmaPJKQkzjvyYrLqFjpnqeivNJjxqKVDA0oQOm+ZQF782cZEj0i2LTarcXrz85YwE6cd9vA+ GY+W+5q9d1X2JnpfkfzVrT/XrGza0sa0k1e7YW9otN/76UgH5CpzGEJSPJn+VnI7mn1N+UH5WS3+ rWjvqmpTx2SiS/1ixjmsrRUqP3UVxMA83OhB4oF982mg0By5AOQHNzBLHp4mfM9L7/d3edvu2G9t TcJZxyVlaISqtDulSAa+Joc7jHmxgiALpjhnRkRtdIiO0t47ia4RAJ5wolfuQgoo+QyRxjjvmUGc jER6BEyV9NqfaoaZZP6SxHN8Z/mXq97fweYobG7u9SewPoy20KsixSMKFZWJPE7VA/rnH6syMi+g 6DBEQiOEDi6/q/S/Hz86/wArfPcHmy9Ot6VdTXdwqzxCSJUZIpRzRJFRjxIA3By/BL00W6UYTI4T s858r+RNP0rU7zVfPHlufUre2slNnppVhD65kfkS4PEhQq/Qc3+jMaDou2ceQUYC/cy3yFpHkrRL yTUNR8uXXmGaYSRzetLH6CtV1DW8AKlRRhUsT07ZsgY26DJ4xAjVF9ffln+UvkHWPK15qOmaXdaa dZlEbaZfA3MchSoDLxLFR7A5TqRGTk4M04UJPn/82fyIufy0WSVWS+8s3s7kW7A84CaklfGPtXtm qz4DEWHe6PUDOaHMPEbV5dN9NJZPrWls3G3uqfFGW39Nz7eOa+WOJ3HxDsbMasPsX8nrw3ulL6z+ t6chWF2604g75XGNS2cnETT6H0W3kkdEMZqNgewr0IOZEYW54NDmzA26GEowXpQoR+NcckTFiCSb YVrWnW6JJOg4vU8gO9f65hSlbdxl4X5in+rhwFWN9yCOh+eQEDbXLJu8O8zeYTpdrNdX12sMCHkz d6U6Ab7npk+Cjs05c8YvnTVvPl9cTB7OzIjYlVlYUkcV68FqQCO5y+OA97gzz9EHbeY3mZVuYvXR yS7R1TjQ777nauXeAQLDWMsZXT1ryvrOnTLBPHKVjHEh6syFqkbk77U8KZTwlkOG6D3TR9ZvI1R7 G5WSNk5IVNVIHetf4ZGyzlprGz1XQvNt67rHcwOZF2MiHcdCAwrQjJxycLWNPPHy3eo6fr6C3r9m AmhVEYqrdCd9xv8ARlonW6RE3uzvQ7qWYLXnJAytU15KP4jCSJNpoIydSjEjYPWkpp92M6pyInkl srFY3qaleg7Eda5jEW281ATFlLBhXarUyJGzGIANFLLn1W9RuXwEgREeFKkn6cpolEhsw/XJVmR1 kjEihGoS2+/UZbA9XBybbvnm/wBTs7fUnDwkRtJ6THl0I2/DY5GZFU4kru0jihjlj1DSpaCJA8UY VuRjCgOhrHRoy0TEqQNiME9iCGsEWs0LUItdsrnQ9ekFp5g8uOYrfVllRjPEP7lpF2ZqqClRvsK9 clkA2PePta4bWOhec26Dy7ruoabqVwLnStVURSXcFGBhlJe2mII6xFihJBpksguN9yIc66vNvNGl TaXqsEMjx/WY42m064UfDcQP8M0J+R8O1MrriF+TIRAYVdW0emSGK5hM2mah8cbmh4hlqBTc1Stc hfEObaR1CbeXtTWxb9D3chfT7hvimBoI3apjcjtv0YduuCYJFhESbev2FzNo5eS7UzWF9ELXWLcg MhYcvTnXehqvU+2YstxXc5Ng8uaZyxnSbWFVaS5sJp1ktripJEbkGjdjQ1OQJBCgG3oHl+adJoo4 5UjniPqQhyVV1BpsRXrhx8mOQPqDy5eXl39ScgwIPjYr05gAfFyIqpBI23xju4eTELej2Amtby/W 1hv7q3rBeW2oxsqWlVO5ErH4QB9oAqczIxsBwjIxPJM77UxP5m1S91LVtKtYvME73cmnHUZJHEsw 2SFDHxGwrQMa4zHovu8lxzjHb3D5P//W7tpP5ZpLdGRwHRXo8bdF6U655tmzjhcvHhBlV8mX6v5S sdMgX6vGplIADdq1yjBlMd20ihUWDS2FrDDL6kqLI1QyKKV+nNpDPKYCYRJFFPNCvbazskVXAeNC APHfL8ub07sZVEJfd6jPKJCkhcKCeJOaqrlaMUTzCW+UtXufK+tDWbfSNN126ETCC11aITwxMxH7 1EJA5ClBXMqEjFyMVwBANefVmOq/npqv76J/K3ljRrmZww1Kz0i2luF7gr6wKgg9NjhnlPk1z1Eu QlL5rbf8wtR1cw3eteYNV1CYEGEKsMIWnTiEFFp2oMxOImXNh45vm+0vy6W+sPyvvPMYn1K81fVb aaS1gu5jcTkysREUqaAlKEKOgzcYpnFpMmUfUdh73P0uOGXUYscwBGxZ/X5B6R5QOp3eh+Vbu/Et vex2NvPqImiCyM80ZZ0BP2QGIr92bLQRl4OOV71ZXtbwoanPDHRjxERo7bGh8aZ9ZyPNzlYcQTRB 7ZtNMTImRdPliI0ETcGkMpKlgEYlQaE0B2qMyMv0lriLIfnZ+Y/nrVNF1bXrWwB1K1uNRF5b2t5b GWcXECAQhwrFJErx+0N6ZzhO526vokNFIwh/O4aNcqP3PSPLv5fyweS4/MnmIfpLzFqIur7zDdhQ PUuLg8vhLVVVj2Xr3NMujiHDxU66WeMcvgx5Dl+l8ledtB0SSXWLeLiRE6x29rIoXmdwxFCelD9A yMch6Ozhh5bPJZ/KlrbzvbrawNAknMXAAXmB4bVp2y+OSQ3tJwQO5FlAXUMmm8haajd2TKtYjBcy oqgVNAFYAfdk45eLa2B0sDziGF63N5l1QxBPMF1qEcPJEg1CV7iPi4+JeMjH4T7YZzI6ojgwjlEA +TziPyzqv6Tv0urC3trLU3krHb1ESMB8JSM1pv8Aa33GUZJR5jm28IA5vtX8l/yx1Py95LsrjU4i txqkkt0wKkn03akW5/yVB+nKoQs2XJiIxlQOz3zTdM+qoHdSTGK0Ow22rmVjDOQvYITU7lkCEFRR iGPQ16fryrUGg5GHHQ3edeZdZgs7B7iZgvWu+9e2YNbbNebbk+YPMms3V7I8ttC86sKxCNWPIkdK dd8tjvsHEIPV84eaG+tXqvqsyXN3bFjBZKwaGEHvL0DPt9GHhvk0SNmmA33lXVbnXRpV6sthFc2a XxaMcHCTvxj5hQeI+Go2+nNzo9LYt0Paeq4No8040T8q45724tNQ1Kx8vxvD6umzT3QaaQKDVnjW SqbjcN882UdLE89nTS10gdifkjtP8g+c01O4j8s3q65a2NvNP68bhuQiNOI4gq1RWlMwNToojkXa aHtAT2lzZNoHmy80+8WDUrO48tajND+6koPSdq1oybjtsRTNVmw8AegxZKAvk+nfJvnDTLueDT9T iitruSMNayg8VuFO5aMnZ6dfHMSwOfJ2EDxDYvfbCJwgazgBB2ck1Vh3HfG0yxXzZforTQSF3BhG 5VlJAr4EHY5OPPdx8sGXzA+mGi+JJKFwd6eNcuJBRCQOyWXaBljp9mtCgO23TKJc3IhKkpePhTbi A3xRg9a5AkhkSCVC7bnDIiDKa3YHuLy7Vp2ErguojfkAp+A1I2pUgDfx65OG3ucLORVPDPMtitvN NdzMr2ocG4DDi0VNquppsOuWzhYcITB2YJqF1qFitpe27tFdnnYS3HUNKlZbRnKg7SIaBu3TMSGx IPJJjsgPMOr3OjazpPmzSWWfRtchihvVhKtJBcKVWRDRasNh7g1yUYmQIvcNRB6dEu8zyxzQw39q WuYUl51B/fKrA+vBuBUrUNxI3oMjhlVg82UoCQvqx/V7mfUPL1zbarAi6j5buCk9xBtVFAZLhVFR R0pyApUA5OMuE+RYcO23Nhz20WqabcWfwM1SbOYUCs/GoHLr8S7/ACyMxw711TjN7FhlnayyG50w +jYajauYkDSKCOQqAOtVfqP5Ttl040OLoWMTUqL1rydrt1cWc9jqMMcl1p8RtryCdDxkQEfErHoV 70OYU6B8nLgAz3Q/9y8F/wCXTI1nf2oN3pVuxFCin4hG52ZTXod8pkB0ZEkc2aWs0eivZT3lldep DEPSCTcY2QmoDFAQafQclCVIlZ5PoryJqqX8Siw0u0tZ05urzGW5YqBVmHqsVDCor8P0ZPHESLg6 n0jd62dW1NovWurs3Nsqpyt5FV4WVqLyEYFNq9hkp5NyHEmBdhifmOA3Gmxa1ofpz3mm3Rgn0m5P pKSrB04SDaMipALZXCVmu9rnZ3D/AP/X9Mf4qit3elAxPxfHQHPK5i3O4hHYKF55vaSByY0qakBj yofnlkKgd2XEXj+r6rqOpXcgWRYEDbcO+Xy1G2zjmZJoOj1BrLis0pPEfHQ5COSWQ7pB6FCy+aoW WSKO5USFfhAINM2EcIoNwnWwQVrrUkgT1SyuTyEi7bHappk54/TszFgKvx3tzxMYJY0VyOWw75jG NNE6rzeraH5ZFvDHc3BbhGOe+wp1zGgYmbZhwk9LfaXns3Nr+U/kvSrKCWWW7tLee4gUASFTEoDE Aqeh7DJ9umUdNjxxNWLe29ksWOfaGScyKiKF8v1Mq/LLzD5l1C20vRdb0R7OwsbH6smuzl45pWcg RxxpIo5UVWqykilOmbbsnNmnjhCQoAVZ6uN7S6HS4Mk82HIJSlK+AUYjvsg952BAfQNpAltBFChJ VAAC25PuTnWYYcMaeGnMylZRJAYEHoctItgxrUPKvl2/ZrjUNJt7h+NDIyfFQDxG+2Y8sGMblzsH aOoxDhhMgMU80RXN35Vu9O0OxtdMs44GWGfUT6EQEVaBUAY9ASC3zpmJqSDjobBzNCRHOJZSTI9A L+b8ufOumm31S8X9J20hWVzyilZk60oGI7UzRy583v8AEfSCA8lutUuIi6iZ5FjGzBqg7+NNseI8 g2VEDkxqfWL6ZjEsIZaA16E1PYkGuZGOMqaZyCAQ6glWbaN6niag9cycYPVwslc2VeVdB1LzJrmk 6BbepLPqt3Fbopq3FJHHIilei1yUgAGOOPFIHkBufcN37B+ZfJmjeXvI1vGiCG506CCCI7kFqKrC nX6cy8sBDGO90vZnaOXUavh/hN/IPnm8UxryDFR0JO33g1ygy2evgAC888wu/wC6YmjpWo8QwJr+ GYmc25gAINPDPOtvdXqW682aF5PsdAB3rTfMet3Bnz3Y95k0OU6W0Ok3ENhE8RT1W3cErTr19uuW R2FONKMSd7t8z3X5ZJDcC7udUXWbiRivJgfRA35hY12NPHMoZIiLA44namUt5Qg1WVb28uZvrnpL bRXiuXkeNWBVKU+yD7bZZi1UoHZx83ZuOY3CdR/lFFfPbvNqPBlWks6wq0p5LQjkVHXvmYNeergz 7ExDoXonlHyDqn5erff4fGn3r35AkurkSRuiICeMYQ0UEnrl0tSZhYdk4xuC85/MPyZ5o81RCKTQ LKG5tZg0M1lI/qIQalixAFDmBlyA83Mw6Cv4j8nnuhaNr2jSfo/V47mCKOVZLKR1+K1kr1RwPiFR 93WuavLGjs5UITxHo+u/yp80S39mbPUqxX9m3C6RSSrMAKMoJrRhvkISo7ubKQkNnv1lcRzuODLM 6kfuK8yPEkigH05fMguNIUyeVJTEzB1UKnwgdd/HtthA82oRF2k6eo1YywenxMfb2plM5twil10O PwioYn7Q3FPfpkZHa7ZkHml0rCCKVzViBXxBHcVyIlu15JWHi3nEyi0vp4TxMDhiu5DxtXrT265e I7OuzGzTxjUvMF5baet5ZyxT/o+WODVtKvE5q9s4KEo7UIFSKEnLIi+bgzhwypKojpWo2fpRIE07 VEKafKoLi3mjYN6MoAJHptUA9lOYU40bbIyrYsC1azjGl6/5dv4yV1O19SyuafuEuLdqs6mlQw5V 67/snamSxivUEHc0DswTyf5uuJLN7TVLeS6tWRYPMGmS825NGeK3dtKBQPt8S1Brvkc8N7HI8mOM 0TdMn1LSp7W5XzNpGoLexSRyJqenShg0tuRUKU6c0/ZI8SMquxwkszw82B6hD/he+0++imN55Z1h UKxKXEsFBxKAOBUqd03rtxPjmXj9cKPMdGrIKIISfzloyTx6f5i0lqO2yXkY4idagKrVNCa7b9/H K8cyDwdG01PfuT7Q9Sm1G3TVbeIx67pip+loY6cpIV+FJlX9oH7L7ZXkxjcBljJBrveg6RcCFrWa 34SLbyfXdOkqGCpKSJI0ataA9QcwZiUW8Da+j1W6aA3NhfW8hgjBrcwsfgdKdSu4Jr0rgB2tjR6P ePy61qLTLO4k+rRpdWjdjVZFdSBxB7Mpo3TMjTyALhaqJrdnFtqqhY7qJTNASA7Bg8ahhuSg3Nfn gnuS48aD0WDyzqWuWOomD0ZJliVo/TVUiIqKmWNuIYKvWm+VxPCieMXsdn//0C+48yTxXYha4LUO wJrvnmhwW21Z5p9B5hdrc8nDPIahemUSHCd20AgI3S55LqSbkVLHpv18cYw4pbcmEQQVmtWMkkfI BnkpQxp4npmfiwE9KZjHW7yufTpra9WaUFVZ9oq/FTqa5lT9IY8JG7PbPV9NSKEceJQUk77ZVjyk ndv8WqFPVvJdlp1wy3RkSUN8UafT1J6ZLOYxFhycIhI8ntlhp2seYdU0zRvLNmt5cXE8acZInktV AIJMxAoFCgkhqV6ZhafBKcrDlAQiQSaA+fweyfn7qiQeYND090hkg0a3hLKy/u3pRypUEfCaCoFB TMb2kymOrhjH8IA+T6B7BaUy0uSYJuZP6tvNnH5QaRqGsa3d61q0ryroNI2QApB9fuo1doY46cVS 1gZEAXYMzV3GdT2Lp5TIkeg+10XtXqsWnwxw4h/edeZ4ImuInmTknxGz/DEPpwCgHtnU0+dN4qtY bH2G2Aq8i/MD8uW88QXK6hqd1HHGhFjaWc7W6KwJoZT8fMmvQimavU6OWaVy5PQdk9sQ0NRjAb/U SOI/DlT8+PO35V6t5euVOq6feW0F1JIYbqViYjwpyUMuxpWvTNecEIdN3useqhqQTikCAN65i7eW 3Xl+3tJhGqh0oQzdQaeA69csxwDjyMjzQr+XoQeaRFeYpyatQBv0y4GnHO60+WjeLT0WZTWgAPxe Hvt2wZJgMY4yej6//wCcXfymitte/wAVXlvxGmRlrcMP92uCF3p1ANcOlxHJKy6/trUjT6bgid57 fD9r6y/My4j/AEZFYMQVmJaVe5C9AfauZur3oOq9m8X70zrk+QdRuaXciCu9FUHcU5ZhSlQp9BhG hZYxrYWbjG3xAMo5HtQf25h5CSuOXN5rrWn+vJKhTiU+wxOxBGQAapw6l55rul3N7bG3h5PGaiRQ SOUfVuPTelcujASGzhmJjOzyeX6j5b1WzKT6fIxSgqrL9Pwe24rjLGabomJK/TNZOmOsd/Yu0kbA RyItdt61rmPxSDcIXyL0+x8y2LheKBzToTSlKdstjnPVRhJ3ZdYa/ZsAojDMtKqw2PyOS/NBZacn dOYZra53aAD1D/dkdK7VFcgcxlbA42N+ZtBs7myYIEa4UEQwnuaEGp27HIylxBpMN3n/AJTtYINU tri4Muna5a2y2d2otvrEF2kRJR3RWV1cV7Zj0W+EOEV0e/2EzSiJ2nvnVnPKG2sniSvSlXy2+9gd +dPS9Ot4mgAMFzsTUzcq/cdsN+TVIe5UmhWIdlp0oe2AkdUgWGPXA9R2V6elQ0PeuQJBbCSAx7UT L9Xk4/uypITuKUqK/PDAXyacuxeJa/MZUlhYsyTwuzFf2QoJP0bZlgbOnmaN+bwXW7ttA1a4jn4+ jGnG4R9keJyVdG69jUE9MBj0BaZDij8UgljnsIb+70lZBYSSiSV42IdW8GKVKGlKHocx80JRNlDz vzR5lur3T4L6w1JluzJLaSTuVkViQCnPrxZWDCvQg9sjHY8MuqSBuA+afNnm67e9SYaldxR3y0v7 P1GeOK4j2engHpUexzNx4yRVWY/pYmB6BlPkb82dRsDbadqTtcxEBbaWQ0ZVViAvLsd9q5jZtEas BljJBovRJLq3e3uksZludC1IiS40WY/DDIo3eM7gAnfbcHfMIzMJX1b5R40u8m+YLS8utR8i664e y1IOtq8hAnilpWJ2bo1DtUCpzLyxsCcfi0QkISpKIdQ1PyZqNybtQ13oF4Y7tH+ItAfhfiNqqwIN K08MAjxUDyLIB7/Y3+lNpK6vplLjy9qfC5mKj47W5Gz1XcpWvUbEZh5BzHVthIyL06TTJb7TbTUN OT6wGj4uTvyFQRQbbilO2Y5hdNpq66vXfJYdY7l3ja+draON14gyH01rRq8RtuO+MSYycbPGubL3 uZrAacumTXNjaXs8kY+q8gtWKkoygb060zIjDrbrZDm9F06w1TUNNks7rU3sdTmhaKHUPUkWNmcE IOJP7QA2qanwwTC8Nxp//9GHano0yziYqaFiP7c89jIBu2iXW9tNE46sq9u345GUbLbw2yzSL8W8 wp8IBFJG6e4yyOMRDIjZmVxrFu8YLyBlIoSvWn0YiUhzOybDAtYe0nTja19RWJLUPfvvkJS3Rd8k rsLBvjd141P2icvxwsLGJu3sflTVW0+FY7b0pLkj4KxiUilTRVNR75g6kkcnIxzEQ+jPyvXzN5u/ MTyv5utNbEHljSr+1GoxXUzLbpezoY2s4LaP4XkkPxqQoAHxEjMvQwlKUSOdhtAHBKUue+3Xl9j0 v86lUfme11PZvd2OlaYNUurUgAz/AFcBYYh4+tMUiHzOUdr4Bk7Rvu3fT/Y2VdkcIkBKc+AH+bxc z/mx4pfAPpLyRZHyboXlPytdOLrzFqKSXmsyUClriUme7mcVJ+25VeudZpJjTRhi/ilv8HzftfKe 0M+bUx2xQqMf6o9MB8gC9THQZunnm8VcemKqMtFR2PQKfwwSNBIFl86+bOWuXn1G/WGa3uxJHFFI gYpERSRwp3UkLseuc7mHrO73vZ0I4cfFG7FXvzPQPEtQ/Ie+1BbiXy7fW886GkmnXdYJFqCdmBI6 UJBphx4zI1bn5O1sMCDlBAPUbjo8gXyfdx3R0++tJI7+Bys0Uu3Bh7nqP865IQ3ondyTAbTjuDu9 h8s/ljJfCwUWrVPE/V0Q1p0DGp2zLGEEOvyayOOzI1T7T8r+Xrby1pMVlAo5H95cMNquR/DM7Dj4 A8P2hrDqsvF05B8++e/MU2qa3eQx19CBvSh37DqcwJkymXvuxtBHBp4kn1Hd4bqkYW4duRoDTkNz mPMF35HFFJZVLRNUiQOT8fSnh45jyi0kUbSO9taASKq7rSQHepxEbWMgSlEujrKjkMOEkfLiBvX2 ywCmqYBLG7vRh8S9FAqYmoeuxC77ZdGQA3cWeHdiN95bs7h3VoGgKNRq/EAD/acmYwmGrilBJl8p 3tnM7WKepHyJ9JviYV8BtWuYuTTHo2x1Fc0+sJpYiEv7J7VY9mn9Isg9iyjY/MZR4RHRu8YdDbPL S3ivYYpdOvY45PfjPEfmqkOMnHH15IEz1GzI7aG6tiBqOiRzRL/x/WzCWtBvyBAZdsmBwjYWwlGz sU9Pl/Tb5RPDZxTxU2EiAkb7ivUfTkhHiHJqJmDuUVb6La2ij0oJrcdxHK/AAGvQtlM8fCy4idtm Y2LPHHzZHKivAsRUjtueuVcRCZhB3wZq0Wld227e+QnInoygx+cIXLKKcN1HvkCabOjFtckkFrIy qFEbVqK9PoyzATu4Way+ffMMrxvbOrBFBaMvuwHMGgJ8R1zPiQRu6vJ3F5d5s0tNZY31oVW3mguI XSpYsocIQT3I3yuUQEQF7MIS41TR2jmtFaV3URSxKn7uRCojMbodmWoJ3+jKZT4tlOOywPV/IVj5 2Gq3OjXcnlO9V1kvLdmMtjdNulFKksh7fEDTxyyGUACxbdi042M7ryZp5T/IKN4mtNS022aSZURr h1jlZrhAPjjdgdiD9kj6cgckgbGzscMMcdujONd/5xh07U9Nii9KexjVWNtc27BRHISCWI6dumUj VyjLnbny0OnyRuhb5w8xeTrzyFrTaFr15JdSTCseo+lVZ9qBwK8U49D8sry8E/WHU6nTnAb6PGPO NtDZ6ha38BlW6tpBxZiA1Aemx7HYe2ZGA+gjo63MK3ej3GprrOmadq93brfGBVsdYSQUd7elYZOQ 3qFBU/LKIkgkHpySY8Q7mU/lxqVhpl61jBfejaiSa3uNLv19SC4jpVU5qNlZT1IrleahsnHZ2PN9 keULeK2tnfR1+s2siGT9HAl/TKmhSu3IAdCMxjsdmyR4jvzeo+Xbi0uHeSO1fT7mRCrI0RUq+9Cd vuwE3za8gkR3p5YR6vcW0NvJMLhJRxe7YCOPkPsyDaq7ChIGS5cnAMdmb2WmSWK6eFAiDFVu4YD6 rxuf7t0dTxZQaE17YeOzbUZbP//SN7g2txJJHRQFNRQ/1zgDipziASkt99W5KkbUcHegr9+ShFMv S3Pp1IgUUrsKVHWvU5KSMhAjaP8A0WYbP12dQEUcloB8z0zF4iSyiIxjZ6sRKzyTsEi+A1o1dyPl g8UXu1nL3BO2tnitWCo/JhUE7fLNhilsDWyeMoLyxq91oXmGw1G4tpZ7K2lJubeFgJGhkUpIIy5C 8uLHjXvk54RkNowC5erk/Sz/AJxstPy6trDQ7DTL9L7WNO1GeC11K8tHt7u7uTA1zLGsMlVQwwsg d0dwaAKVrTMvRYowygH7+rnaichjqIoV9nv9/J6N5l0861+b+k2skHqRXeo2azs4qv1TR7eS/I4n qGuXh6dxlWaInrzt5fJ6rs7P4HYspg/TGX+mzSGMH4QEvmm9lqGoax+bHr2zrLb2ReNEZuFbeIiO QpUVPFmBp3ODDOWbW8UfxFx82HHpuxgJ7SlXn6juL94D6FHQZ1o5PBt4VdiqQ67q9ppVhPNdzxRV UrGrvw5MRsK7nf5ZjajIIxcrR6aefIIxF9/k+TvMPmt4pWt4JIP0jK5P19XHCMkfsULbKD1bfNJM 8Z2fR9LpBw2fpFbd583onke2me3t3kvlEmqNGJblKAstVCKVoKFlFSSKmvXLMI6Xu6btbJAEgR+m /t63+h7PdeW9Ev51ub/TLe6mjJEU0iAsAe1e+bcYYB5LHr8+McMJkBNbXT7OyULaW6QADiOIpQDt Xrl4iGnJnnkPrJKQectXj0fQb6YycJJI2ji7GrKf1DKdTPgi5vZGmOo1ERWwNl8bpcJPNNL6hYlg SrEnr3Fc1mPc2+qSlQAS6/iRf3oHjyP05PIOrKM72S/6tA6gIBuPjj9/EZQY21SslI7/AEsXLILY kMvKop9qnTvld70sKDHI1lt3MNyjLKhPBiaNQ9stibRPZXMcI/eSDmoFCG36998s4QWkGyxa+smV la1RSsgJB6vSla9++Vn0llKIIrkkircJOUcUb9og12NaHY7dMfElaPyncUShn24l0lc/G9K1p8sM siY6WjYTeDRbe6aL1bNPW519VAY2B7brSpyBFt8cPCLt6JpNleQBIxK86L8RhlJ5UA/Zb28Dlg9L TMR6svitopqTW1Irgj4wBx5UO4Za4ycQ+k77ouAF1CvDSRa1Qb1p3p4e+VS82BjSu0MScSV49A21 PpymYFM4mkmvY6F1DEqfs098oydzOJtjc/23UAqQQd+tB1ynrTYCxvVUZ7KdC1DMhVl70INMvxgF x8lW+ePNGmE20TAFlpuoFOUnQOfvy/kKDrjH1ElB6ZoLXGm2oDh/TaTnINwys3Jj02qGyrKSY+dt 2LDciOiqvkqGGRzcQv6buZLcqaOjUND8soM6cuOEVRRmlfl9a+p8KfFKwYpGAF5V6t/n1yJykcm8 YogUC9AbyxPa+ikDNGkQBUrXlWnjt9+VSySPJyMGnje7yzzbqXmnyXeR6npGo3M9nGf9N06d2lga M9RxboT4jplMccpc+ruMGnxy2piH/OQGm6d5l/LPSvOloqFrO4tp+VAapc0R06diRjp5eqj5ut7U wk4zfR8HeetPe50xrhXQzR2/qoFHVogBt81FfpzYaaY4qLyOcbIbyZO19aX9jE7GWS1aaGLxkhBm Vad6hWH046kVIJhLiiL5sh0GJV+rXLkhYrmFFkrVKcvg5D/VOY2XeTKGx3fXnkW/ltGsA0jIHAUF SwY8TStfChFMwomgXJIEt30z5W1aSO6jE7C6YgIJmUFwimnIkEVA71GWWDs4Mwa25PYdDsdH1ySa GLTg9zp4MkkPr+igUsEJoWq3xMNhiJOPPlbNobGG3/cWlk31m341tEcwMFrV1LF6kb128aYAC4xh ez//0+Y3/m1LKcQrIVkei/Edt9x861GcKIEebb4pT/R9RfUHjLgNKSpVRlkY2abRez1fT7YTvE0z BokA6Gu/hjlxVHYtkoDmU8vorOWIRoV+1Q++YJjRpsERI10YvcQWlq0gVFJPT2+nGGIEbndEoRug hvUaVSpm/dqB8Gx2H0YicoGraZQIPNKriQ8qjjI2wZVXdgPDMvHmIbMcuHfufY3/ADjNBf3/AJo8 k6potus0GlXutRebkahe3S9t4DayFQCeLmIhWG1QwJzO0uQnNXcQ5eQg4TvXp/Sf7X1N5gvra1/O zylFLecLwXNwtvDNzKyRXlgI2SLihWqvECQT364dXIR1Y77en0GCc+wM5EduGNkVsYTuz7wSGT/l 3pVgvmTzFemUvrNhLJaXfE8o2heRmjdSa8QeJFAd6Vy/svEBnlXR1vb+ryHTYsf+TkBId4NDY/f8 XtedG8g0SAK4qxvWfMEGlr8TRoQCXklbiqgdT47Zh59UMbnaXQyzfsfGn5gfmNf+Zb5lkpa2EAZY Yo1IBQmpbkTU1pmoy5JZJWeT6P2X2Xj0GPbeZ3P6nkN7q6PRyacTUuTU7bCmV8nZixzdp35n+YNH miubXVpobqBWS2d2DDgD2VgVHXwyJkY7scmhxZ4mMo2Dze7fk55q85/mX5nhS51y6h8vaGpu7+3h fj6rPIxjVjuTzatQT06UzI0ZnlyCzsHQduabRaDSylHGOOZ4Y307yPd977OuJ47WB5pSAka1JJ7D rm/JAD53CBySocy+P/zV/MCTU7o6dbACBKrCwNd+R5OQD4CgzU6jIchroH0jsPswaaHGeZeX2LyC Mp3dQU5bZDEHdk8Uk72nibkaxsvUdQw7Ee+Xy5MeRSK7Ekbn0m+KP7PuMxurOQ2SC4mlGykq4b4v Eb1O2EwBTGqRjXdtM3pX0HMBKRsuzU6Ftu+VyuDVw7WEFNpkMkavaXVUrT0jSpr2OGOUFquuYYvL aSxzTyPGVK0CsfskCgAph5t5AHmi7azWZABU8/h9HjRj9B7b4kbKZUE1ttHV3jHAI3I79CtPlgrZ kZ7WGTwWAjNI4gwU/ADvUn3PSuXxAMba+PbcpxbEgCOVDDJIa+mSOviKYasW1yjfmjeBasopHITx JNKsD9GVG7aSHPIrcI2crMg3YAg/P5ZTkO7UYkb9ESk3NSsrDiB/mPvyic0DnaU3LopXc06rX5Vy mW+4bWNTkyPUkmhIpsNj9GV9WR5JRNbc2aPl8chBamxqB0HUUycBezXkqnlmsaaLmVYArModyx93 oBSnhl0jQcUY+I0yTSNJtbSGcel8PFFiBHRQoBzFySc/Hi3R0NivHiaEsoV+Q8BSuV8XEREc3Mww 4RZ6J9pXl6W1uTcRwCeGQhVbjTcb0FRXLZ6eUWEjGR5swn0YSRCaRAjGihWAqP8AbyyGLvRDKIvI fzE8qRXmnSjjQ8SqVHUHYDf3zJGIADyc/TZCZB84fnDokvlX/nH3WYboEyQX9gkMbH9lrqNyFpQD 4QaZgYcf7z5tXa+W4EjuIfFV7Z/WoLexUrNb3kXq20y0YNGg4SEdOisPuwiwbPR476hXV5p+Xks1 r5itLVNpfrIjQU3PVf45layNQvuasJ3MS9UsLOMWlxGE5tVZYuI7Ql6DrStDT5jMOZBcjGN93vfk ppZY7XjwM0RBip8TMqkVoNu29M1shduRXye7aDqhW/a1aP0JS5nt5AQKkGho2x38K4eLhFtJFPoL ydrl79YFxFDbXk9ldJIguLaOQMsf7PIBT36cuuTgLcHKBu+hbDWtK1Oa2T9Fx3ct1Qia05RXUUxG 7xOHlVOJOwPQZmwxbbOJcuV7eb//1PP+pQQ3NyZ1ZaBgYyd6Dr3zjIbcurbtafeXtaTTroNMrTRq OMhWlQKdR8st9I3bRKt6ekW/mUXsixWYlijr8Tn4cjqKMdkymZmqTG61t7dlf1f3bUNK/ftmqlHd kZ8KTvevfyqwkkJDVUgeHbGNcVljLJEkAc08hW8ENSnE9C3f7ss+psu0BdXa2rbggkV+mvhlsY0x lIA7vev+cZNUZ/zn8kmdplR5riImFWPIvbScBJxI+CtCSdhTLtHGs0bHUfe3RPFjn7r+0Pvv8y9P v7b80vIfmKxtBcxWM1b2QiiQRSD0mkkdmVVABzN7RxkamM3svZzUYpdkarT5JUZDbvkRuAAN+b1X yZ5fm0fUNavH1Oa+i1do7mKHjS2iDlj8D/tMe+2wpmx0GmMMhne0g8v2v2hHUwxwEBEwFX/EfeOj 0bNw6JKdW1CKwtZZJZBEqozF/AAbnMXUZhByNNgllkABe747/MjzbDc6q0cst0bFUf0+BVnZuFVI A2ADEVrmkyz45PonZmm8HEKA4vufN99qwYM3KjHpUdB4CuV3TuBEg/Bg+oeYoYzNwoIgvF6nuPam QlOmwbDd5beeYnvr4pGS8VSDvt1yri4kxzCAp+sv/OMPl610b8p9E1jgq3nmfnqd5MepRmKwLXrQ RqNvc5vuzoCGMnzL517UaqWbWeHe0ABX9Ii5H5n7Ez8//mDBbNdaXDPGjken9ocgGBq3EGtKYM2q BPCHL7J7JoDJJ8g6pqsE2oXEnq8wjOFNe/WuYYygmns4Q2FImx1GCaNBXfowOxFelT3yfEI7twiW V217EEKyFWqPgkHt2w/mAGMoWVOVIbqrK42+IV7e2DjEizvokV3p/pyVVfiYUB98kDTOMb2Y/d84 GiNELcaEmm2+T4hIbp8HZ5zrPmSbTb2V4ZhE9uUElsR9tWBq6fIjNbnqJsNkNPY3ZVpvmvTtWgVH lT1nqRH0DUIHUZdhzxcOcDEsvthDSNlr0o0goSte1cvjK+bXIMjs1iDGpNV61ANK+4yQDAk0n9nC R8KqKMaqSNjkx3Ikdk6awj2qASrVT2ybT41Cg21ogBC0LUrQ9qZVM21GSQX1tyXnC4WSKlW61Fem YmTvTCdSopfKxMZkQ13Na++Y8p22jml7yMw58uZA3XwoOgyoMkmeQuxZR8UfwnsfHEp6JdLcLHIn q0kkiBcqRsrfsk+PfJxBG7RJIRbLzDsQZOTJzpQDgOwGSmdmWPmizzLIo+EFQCB33zAyyp2GMIHR dZ0rWPNOqeVBdKmq2VtFK0PIAKZCSKnxoOg6ZLDIRILbmuGPi6PYLG2u7SP05gWEdOHLf50+ebeM hOLrJASlY5KuoykwyTAU9NOTKO9MqyCot2Eb08p81eZbV4oI1CuyyJz36UavjlBmeG3Z6bCTI+58 +f8AOUPmdrD8rLJvqNvfXGpanDNLZXSkxzW8VZJgeNOPw0ow6HI4LMwfJ1/bAEMfCC+LLez0x9J0 7W9Dmll0N7hhHFLvPpkk4Kvb3IAqIyNlelDt8snljZI73loyv3vIrjS7jQPzDt4xFxD3cU8BGwKe rXb55PJc8ZtGPeReiLxtbnUYLdCDbHmsZoOSPOWNARuByIPtmCNwD37/ACcgEPaPJESehcOvJJ7M owIPIgV4gqdvh+WYB5/FyQdnrtuYrfUIL24doIJIeTgluS134hVBofA4gWGs09+0nlcaXHHZwT3U 4nLLY2wB5q5HFavT4vfMjBMXRcTPz8nqUWpa3DDp9rJ5evfrUBaXdPTjuoo2PwCZFRUlVV2rsczQ fk4fATu//9XjumaC1yKTLzB3A602pnCyNcjsyjG2QDQ7W1VmZfiO1O2+xyUJ8TYJkbFH2zw2qu5o OOwX/ayRyAMuIncJHeaklxeCFmqQtEWvSvQ5AxsWGF9Cy3SriCzRZZCCoA269zmJLGSWZAjv1ZEu rWxpwJbmNttsN8LKOS0kbT7vWr5LS1jeaV3CxIg+0T0H9cysNzU77v0s/wCcbvyRm8sSaV5mvGdN SiBafh8Ioy09Peu2+/jm30enuYrpu33wYyTzIfVfnPyRoHmttKuNcCenpdwkoEhHBwGDcGDAggke GbDXaWOUiUjQDk9kds6jQRyQxb8YI93mzmONURFRQqIAERaAADsKZsIARFDk6Ukk2eZ5qjNQH2yE 50l4T+ZPmWOCYW0YkmW1Kz3BVTJGI4jViyLSo5EA1Irmi1WcSlT1vYujrGZna9vP4PhHzX5svbzU bmWaR5JX5D6zQKXBJqAF2WoJ2zBMgS9XixRhEAPLNU1RkAbnRQN996dgTkoAuRGfe8f1/W5riY2t tMrF25PLQGi+G1N8hVp8SIBO7tGs2WQFmGxBKU6mvXLseMuN4tvszRP+cj/MHln8o9H8o6Ho73Pm Hy5zt/V2CT2auzw8P8sIQrrTYbjLMmTMI8I5c3Dw9j6bPrJ5csqBqvf1fPbf85C6pf6y8/nvytqf l17sqsWpxD6zZfEQKS0CyRjeleJGVY4yPN22o0BxR/d0Ysv1DXDbzszOjpKvO3kQ1V0O/IHuMZnh K6eQIrqnGja1HKUcSKi9ORbr8wTkZTc2JAR3mHz9oHl22a71XXbfTrdVrymehoOtFAJP0DImQpiT vs8si/5yz/KqwvFspvM5jqaGeW0uBEd/5vT99slETqw1jJGUqo2+hfLf5j+WPOFnDeaTrVrqVu9W WW2lWQUA6bdD7YYaq9js5PBwjYFT8wX0AKRQsJHkqEC7k+GXjJfJnVCyxK/0lLy2YzW6ytItRyFD 02q3Xb55Zkx7buJLMejwrWJb7ynqQlErCylNPslSv+tT3zAMeE7MYzEti9n8r+bxPFGW4yIwX4u5 8Kjvl0c6DEF7FpepRE8gVKsSH2rXatdsyceVpO4Zla3gooDVCdOXcd6fLL+O2kxZOk8RjBccAwoD Wta4ePZxzA960yRyJQPVh1ZhscjKYKCCeaR3r8eJrwJcKDSgPhTMPIaO6KtjJkAEquhKybDid9+p 9sx+INt2BXRAiQIZIzUnt7d+uAGpM+HqlpYCRinwB+3j/blZNlAKSzRs8k0a/ERF6zvUAkD4vwC5 eIHk1cQKVaYJp5YYXcPIzyclpt2YMD9OEignGACmXmGVtEsbm9WPlJFFWBKVDOSAv4muYs8XEXPw yBfFVm2taL+YUXmGS7c6hdzSPdzb/GHJJruBtQAYM2Kq7nZ4hCcKL9APKvnRdZtbRLpgkrIoZz7D sMs08yDu6vJo/DJI5Mm8xAQ6bdXMPENFG1a7BgwzIySBjuxwi5bvkJ5r/Vtcsre3rKb64fnHWgWK P4ifpO2OSAGPd6HDERkSeQDxX/nLDXLeXzr+XHkOORABol7cXdqQKc7ikMZJG/SNiMsxYiIyl3U8 b23msgd5fK+g3epaNp31qwlMMltcfV5oSoaKWGR3R4Z0NOS1Bqp6dRlMvTP4OjragyPT7HRvPc2n S6ey6TrVuhaDRJm5SJ6JKPHEzU9WMMKgfbTuCN8lZlEimMJEE2FS703Urdba81KD6oRJf6ZqgcfZ QjlbyiorsVPffwyjw5Do3WOY3ei+SpGt7ZCzFGML28y02DqQGrTYirVzWZdpObjuQ2D1kC4ubRby 2BkuIUiinslBJYJXdaV3rkTuaDIEHYvdvJhghGnfXGYW9yU9W3chW3p17ihNNx2yY9LRMXA2+hdB v7q1W4stMV1gtKQrd3bGeRmTZiiEhV8AczcZiY7utmKO7//W5FpmpTtO0cautCeoIoM4eUAIszKz snN5cycJA/Jhupr+GVgUVqubF2v7397FbqR7nfp4Zbw9Vjd7IWz06/mu0ldTy/aPb78lMEDZSC9C 07R7i5VVowVwACdqGvh9OURhK92eOBkd3omk+U6qvqkEjanXI8IMqc3HgD7X/Ij8lbdrmHXNTtla UMrQxkbIBvWh7mubbS4QTwhkcYjZL7+sLCLT4I44EEaRqFCqNqZvsePgDg5cnGUm8w2c2rXOnafF zEaSie6anwcFINCffMXWYzmnGI5dXM0GaOCM5nuoMtUUUAdh26ZsYx4RTrCbQOoS+lazOOoU/qzX 62dRLfgjxTAfBP5ualfxalqMEty/AycpIgCtVFOCkj3Nd857j3t9E0ogMcfcHyVrN/Ibh+bcEUbA 1IIrvvgAs27KG4eP+ZfMNHjtbcMbmVirIT0Hc7HoOuWxF7BJyCMSeqUWNiVKOFIaQ0c/5Q37/rzI xxrYuFLMZF6Fp9iok4MgIp/eMa0psa0ywRpqlmpnuixQQTepyqASrRAVJPbele2ZMYxHJxsme3o3 mjWfK82i6ROlpbXgihEOq2NygYrcxf7tiamyyKQaDoQcqkeE7t+LUTlH6v7Hj+veZPK9/bGyEMln NAzGydB/dDcgkdCpJzGynicjDKcJ3exYlousLFcCK7uP9HXrKOtOvQZgkbu1Mxw2OaYvo3lnVnuX ublrpJSWMky82PLegqNgRtkxIA02Y8vCL6pJP+Rn5bazJc313ap6pasQQlaL4EZkiUiKtyIZaO4D JtH/ACq0Xy+TP5b+sWc8gqpiYxDj/lDofllf5fiLdPWgDenr/lzSpLf/AEi+uvr1wBQlqnhTwrmz 0+nGMWebrcurjLZlt3LEIOKSrxI5DbanvXpjkNtUcgJeb+atFt7+0lDqrHcqppuPn70zEliRz583 g1nd3flPUxDO7CwnbjCxqODbUBJ+eY8o8Ivo2ie1Povy35iE0UPCQkgbN44ITC0HrOk6sxEbBjxb s/8An3y4SrmWrJFmMOpF+KcqLIRxB8fbJnLTQIIiS5EHNpJAUFKN0oTlEsnVaQsl0s8bciSpB+Kt SKZXKXExOzGzOTecCaBKU7A1HbKCTdJjHYlRuJV5TlCCoFPiNBWvjkozAO7MBJnfkHJIeo+zWhr7 ZMGyjIe5iNrqpF3cer9i4eeO35DYc0K1J223pmRjNblx5ConyTHys5dknuAVuPUKPCWFU4BQo28e uSlyZA3yegeZrSG78taiZIwHhVGjfrxPNf4ZGJpyscCCPN8o+edCe3fTdWWNRGtASF7nt9+XZsfF BzNHMWYlnvkO/H1i1iZuBQV5Dw6Vp4npmFGLkzOxe9eZ7j0vLUzilLiFl5NWtSDvSnbLq9NOJp98 m/R4h+X+jp9Z1HzBMax2ienHI+wIjAZioAqKk7nITlxSA7naZp+HCj1flX+c/mzVfNn59zecixl0 f62LTRZVNYxZW5MSMGUkFSanr1PbNlGNYCHzntDUeNqB5WGSaXDFPLqts9FMl7c0iB4mQsySqCK9 Vbv75rZm6Pk1xJG1MY0O1+uW9rdW8jC80nVZ2RlPGRVf4m4sOnxKp6jv2yeaRj8QnHIcVF6l5e/M S08z2l5o3ni3M/CdoI/MVnGE1CB1YqhmQ/BcJQdSA48cMtqLECieHfyen6Joms6TYG7sb+LXNBe3 n+ra5aRrLH8Q+H1I3BeJkp0I+nNdnx0bDm4jGQ22Z1p1/f3CaaonaOGQq1ytuvGN6sASzIAaHlWu YhJvlTfwjm9csbSaWNZ1gkliZuXCMMTxJJFTQ7ZIxoc2ANvRodA87yXOm31hBNp+lSOUvLmYAQKz HkCVk4mp9suxnZ1efCeIkP8A/9cLBo2mWrSISjMwFDtXPPMmUlyTwg0x7V7eJ2K8ggi2BHeviMsx yYGixYSQK6jj6lW4ghaGuZcA28cQ9G8s6Ml1KPVRmRV2QjamDLk4QzjUnp8OiwW6RsUUFTuuYnjE tnBbI9DRZ9VsreCLmDKhkCiu1RXBIEC+9yMQNgc36m+QdNSz0mzVI+B9NSfmQM6XsyHoBa9dKtno /E0PyzcgOqQJf0JiZCFjlAPPtyHjlQPBLyLaYmcRXMLE1W2k1A6dE3qzoheYrQqgFNmNeprgGpiZ CI3SdPMY/EIoFT1cFrf0w3H1GVa+FTmu1++zZpdpW+E/zTRbvUBHFVzeNNczOAxoCaIGJFKKq/fm hxizT32GJGMbcgA+MvNUsFgl7O53VSxd6UNPDLIizs58ZHheAWdhNe6lc6tLN64k+G3QbKqBt6dN 8z4RHc4GbNZoPVdL00pHbwhGmkPJw3Xqa075cIhqjb0+08uxpDbzSiQpMN6bDYGpNCKjfLYCmmUi rXGjy2kMyIsrGRSFZaBiAKHevU9sSQgDip5xq1pf0QKbllTn6QXflXtxBp0rvXKJGwGyGI3y2eeX Vlf+tI0bME5UaJyGAI6Ee58MpMRWxc2MCAirbTdVdEDWbCQ9HWoX5/L55inHu3xyHkitNm1CGeW3 ljaKStKjccQff2y7whFkZ1yel6NaTXPqsOR5fFIabe/hk4xJ5J8aRPNmtvp8wVCJGkYAtsxoDWgr 03OZOOviwyyJZDYR3gEgd19RTzjjqQSF6nLhItQIBTtpYBIBJw4sgkdXIoCCOtfDJbdWUc3Njmpx li7wx+pG7FvUYbl2G9AtRTbKpCJciEwd3j3m/S0uzJDOOR4kxChA3FOp98xstWmR7mF+UfMNxo1+ NGuZ6yD44SxqGjrtv4j2zCyx4dwyjlBfVegaj9YggIagcALU1JJ7ZGMgG0yHVndtdivpM3xp9lSa A4znbEG04e5MkUZc+5j9x+vKzPoWBQ5vCJGjFQ1aU7EH5ZWJboI2Sq8nIuVZXohB5CgrtgKIDakv nlpyZ3J3PwU69++AmmfOKV3MklAIQSxqXQbkAjahrtmVjkAGB3Y9aW0bxJHeXCrPDzmICH4m5Egb 16Vrl/1DZxztIx7078p2Ukurm5UBUlk9NEY0ZghJJO3vk9yWcBdl6Pr96ht/0UFIN3Qy+1OgP3DK 6uWznY9gD3PMPOOlOPL81vMyyGIcounUbnr7Zl16WMJjxLDzTyJDJNqNvwPqMXA5b7kdjTMOVE7B 25jERL3nzhqIGlmxQVkCKixgdCdvbpk/NxdLD95fR4P+eXmU/lp+RXmCWzk+qajfQx2VvODRxNeu Iwyk9KKSfow4oXIBo7W1XDCUu4Gn5K2etahBPbSQMl3ouq87mTT5UDpb3CGlwsQJqjcqmqkdd82U 4mtnzyUiZbHzfRVoui6jHa6ggmsZr2AXTSqQ8btxjLOVrzjNF9wfEZqZUdnOxk1ukGg6PcWOo6sb VEuYLTVKPQhllt7hCG5EE8SNwd/fJZaMY/1WOOrNsMXSdX0bzDrQs4Xntrk+taNH8YcE81qF2FB4 jJT3AbAI2+iPy28ySww1iuyh9LjVTxdqht2WoFaniVbNfku3JAse59O+V9Q0fUreNtStYxKYuMd5 b0R14ruWQbCnelflmMfUd2ZsDZ7HY6dqsljx0/UtRS2oOF9p8UNzKtG5cZAnpyce1OFffCYBjGXe mt35W/SqaI0vnJLO+hVZYUubaZ2ndGDGNhNRgSFOwrUdMsENnEzDfkX/0DK40x0g9au5GzDsc83l XE5PW3n15aXElweddju36suxm9mAFG0ZZaVbMEeQB27gZmRDdARIer6DbxwcCq7OPhzHzevZyYYt rZbb2j6rf2mnRsRJcSCMb+PU7ZXwmKJGjT7v/LD8nNJ06ytLu4thLcbNVtzXxJzb6TRHMLPJt8QY R7305ZWiWsaRooUKNgM6LT4fDjTrMuXjKYZktKHnhjmRo5FqrDfISiCGUJmBsPMNE8m6xpPnebWX 1BL7SJbaVI1kP75HkdSABSlABTNZi0M8efiB2ei1va+DUaCOEQ4cgI92zOtYfhayy9TGruo91Ukf jlOvNg06fSC5DzfH/miEcNWnvao1tp6UR/iHKUKFCgg9S+/sM0UBwl70EGgO8vz8/MaGSW3dS/wy yqDFQLsxrxHtmTiBBsN+U0GD6TZRQKn2QEFJ1UA0JNRXwoDtmddRcCZt6b5OAN5QsGYOCkbUPwnb ao65GOSyu9Peol0m3jBupYoECGivxoKdRU1G+XcQahEjzSXUdf8AKBd+WpW/wEMeLChp2FAT92Hj BciGGZ3piN9qmgyP6NtdQy1FY1U0qp7/ABdKDKZVHm50NOe5K4NMsLmZZI0jdC1Qvsvfr45EUZbB zRiBjTIoNLiUKBaqweoVey+HLLTR6NcdL5uuPK1tcOv7lBIAfjUDYbDelPvyJiEflynmneXYYCig CFQeLeFW/Xk4jauSfAtmNp5XSqcUrGORaP2O30ZIY2iceHmjZfLtvFL6whdnIIP7Xwk7V+WSNxay GOXuhSGR5YKOrihiX7Q5bV6YiVndRG0kk0+UQNE8vpvb7yOB1+QPtkDMBkQw7WNKhliZNpRuex2p 3NMrsEebIZKfOXmvy9eQXDahbqE+rH1IWXYxgMBRvDftXKJgFq46NvXPyq80/pS2S3kciaLaZTuK juOua02JOWJCQe/M8qKHX94AoNQB0rvkSa97MSTe0ui8DhX5vHGW4+O2345G75sSd10sy+tbNzBY 0Egr0BqRkQeqOLekNePWZZFVZArVVa0BDdfuwnvSBfNB3pRxGAxLEUY+FPAHrvkhsN0g0KQcKu9w 3HZCDz6dPcZfE7LVpNqcUi3KiIEkIx5EGhNKUHhlsJUgxBLIfJshivysxoyP6ke/7LihHfJmRjzQ YGqTjWr6wgvrzUb69W1t42FGbqStBRR1P0Zm48Y4LLZcjUALYj5k1hPMHl++OlWF0wWKqzslCQB8 R2JK7HuMmMkeTkYdLPGbkk35T2HpBr24Ajjt1YlnHf5nptmKIWSQ5uunUaHVmFnz8w6lPqsoUWFr IwhZj9od28OgyOQjl3M4wOGAB5kPzs/5zt/MuLUJfL/5eaRIZf0fdJqHmEKfsSUpbxMPFVJYj3GZ OjiSZT7g8j25qhXAOb468iR/Wden0WVuX6QIutFPVfrBQho22O0gHGnjTMmZAiCPc83A2d3uNi7j QtFmh+FrA3kKkAggBH4r0H7VBTNRkIjOnYiO3NTsTKnmjzG0lvEjQUuWkiZopPThm4qC6EVoAQdi cE9scSVgN9vxshTcy6dqNlJLPILW/s43Ms8SzmK4iJ4sWThIAQBvXLOOMo8+TEwINvVvLuq3SztD cLaXBjhEkFw4+IoaM1S1OaU78qg5h5JAHdyoR26vozy00F1HCFs5QJUqrRSx8HBqeIEgoPnXMbYy bQSNnu3lRLVWhmi1bUdJlILSW6JHKgqtEVlQk1A/HBKweYYl7tDfSL9WkubyDU7aNU9L6zZo0sbk AB60qNj0GWRJpxJj3v8A/9E5t/MNrdRLDDxZWJ96/Rnnso05A7kFe20blSu5LCtB44Ix3bCO5i8q Pb3Cqm3N/s+2ZNnhRfCaemaZeLb2I9RgF4ghuvzzCNxNuSMlBkv5e6ib38wfLtsnxRGZue2x+E0B OZOnl4kt3FyZeKQrvfsD5bgCadb1FPgGxPtnYaMAQC6mW4DJe22ZzirDIq9WAwGQCQCVKS4iUVLg U71yPEGQgVGO4hkm4I6s1CQK16Hf7shxbpMTVpP5gkMdnc8achDIRXcdCflmm1u1uZoI3MX3h8g6 whttH803ksVby74wiZmpwQxotQKkCnE0zSb3T338QA5X+t8L+dLSC4t3dl9YiRRc0O6UoamlPDM7 ESAzzV02eX6ldjTbeRlrWlWdPAbb+OWykXC6vPIfzlj8tCWS4Bi9MssRehJ/ygO+QETLcM8YBsHk 8un/AOcjb/zNro06wjudQuWJRGEnFfAAAmmXSxTjG3MwZYSlwx6Ppq58kfmJpOh6ZrNzpsNxJqFv BdfUzcmORRcFfTVeUZ5khh0+jKsM5TvaqcjBqYZMhiDyVtU8rebvL8aTa9pM1hHX4J4XWVd15D4f hOx26YcU+MHbdvwagZDUUYLTz3ZwDVYNPvoYLmL1YGaFl2YVrwYAitPCmGcgHIhnwSPDYBBVNE/M zW4itofTvXjNdpFDL1r4k18DjxGPVzvCwnrVsrTzz5imKNIjQRRuefJeK07EsevTInJfVkMWHlaW P56u1uOdzfzBlMrJEA571AAUHoMIl1O7YcEeQCmPzdksbgevrFzBJxHISR3A9Qhtqjh0r0xOo97E 6HiH0WzTSfz3dfS9TVLfUQqlSXZVYbbfu/hb8CcRqacXP2YK+kx+D0nSvza8v6qA08gsbmX7KtuP CtdwBkhm7w6+WilDbmzC4ksb61E1vNG5C8fUVgASdxTIk24kgYGiHl+rwJaXquKiJWO5OwPfIyyU UUCxy9tbHVIbuFbdWd5HDtKtV5GnxAdN6bbZOMgXEyweM+S0fy/55uNPA2ldWhjjJAJ6H4SB3zE1 WLqG3CbfbdpDHf6cPgIJShlpTjUdRvvlAiOZbCTaXaUGtvV9UCkTsobr8O+xHh4ZAR3ZTIPJGukL yvOoYPcBQ602+CtD7dcgYhHFsh7gPwQB1+ECh8KGv44BC22CDdm9IGP7fIUTxoeh/Xkhz4WczYpR tnYXHP8Aaoyso7nsfuyUJVaRHZWkhH1gkymOMLX0zuC9fHLQbQo2cvoTGW3UEqKDahG/Tpk5xsVb ZCPEWRxeXtI1t4by8i5zIa+kxqnvt03y7HIiNFyIk4zbOp4NLttOkSK2jiqlOKqACVG+WDfk4uSc id3kFvBf36jTbeIWtkz0mZNiVpQ9PHLDID0xdjp8Y2lM2wX86fzK0v8AKrytBa2rRHXNXrb6NYEB yzg7yMux4IKknudsxcgJ2HLq4mu1ghE3z6Pxc/M+HUZNaurvUbiS4vLvWLh5bqY8mkclSWEm4PWl O3TNxpSDH4PB63JKc+I96zymJv0yqoDBd6RKLi1njahC7UNemzb4MgAgWqP1EdH1HZ+jcaVJqUBR LK/vJJnhAqIZzGvrw0Unv8Q/yWGafOKN9zscJsKJtI5de1aRJ1ki1fQb9YFVCzCT0WYHegqHWo9z kJTsDyIZwAvZIL36tE3lqcWU9zH9SgKiWQRq0dAd1SrV5Db4snCXCJb9fuKakGf+WNRdNZtLX0Us 7SO3MU/1VQCkjNyCurVahBXoQMwMk6HxcmANWHtPlyCKaG8iluzL6TySK0quhWlQTQc+x7Zjkth2 L6F8ji4tTaObqK5DRKa+uepA6VAbfwIyuJ3phMh7TYa/Kgt2mvJIS8noWjwxiYMD+zyNIySBtyOZ kAQadfMwt//S4/5c1S4kvbaNXdF5bqD2JzzuUyDuziSS9mursR2pfj8TEBd+hp7ZZj5V3uXP0Dko T2ksVsbm5AEwHOSTwNK0+jM7FDp0R4ZA4jyYe3mtrhjbwhigPAdumxpkcsB1aTktn/kDXbfy9r2m 67M542kqyFT4U3ymEYwNhAj1fph5V/5yS8rXVnDFFMZZlAUqPGn9c6DTaoCAZznx8hbMp/zlaVOV ramhBI5H39szBqL5NYjK+TGbv81NcnZvRQRrvSlTglkJZiMu+krXzv5p1GaK1imJmnbjFCm7EntQ A/hgOQgM44jLq+gPJejy6cn1jUJZLnVZ4h67yyVMak1CrH+zX33w4jfNGcCIqJukx8wyMqOA1CY3 AHjVSBmn1h3Lm6CNke8PmbzVD6eiazbPKwknspGooHxtCQe+9SKZrRuXsYTuQL4g1yztmiu3AP70 B5Au9SexHyGZcDQpsyz4turx3UrG2kjuHuGRoyoARzvTpSg65YYElxxG3xp+cXka9Mh1WzSRrGB2 iaNa/CvVSd8zdMANmWXEZR9L0T/nDb8mdH83arcatqaLNc23114IpahPTtbd2oKdWdtgMlrLlQHJ 1UcxwddzX3v3FtPK+j+ZfNvlkNElxpegfUpVtmrwMOmWqqsbKeoDeOY2IGUhHp1ao6mWHHM3vIH/ AGRQnnz8v7HXdT8rw3McQiXXhJNEEASSKHm8kfsCF+jJmHCQR1bNBrTijM9TGviySHy9pNynO4tQ 0ciFo0XZRU0C/IAeOTjjBLijPK76l8+2H5IeXW8+6vPJYwTaXbTJLYW5j5EyzLyJJI34UrkcuIGV PQy7Yl+ViBsX0zY/lj5Uax9G5023eKRCjxsg48elKU98uxaaNcnSS7UzCQIk8D8p/lBb6n5m161n tuOnaHeS2UM1KGbjuApp0VSKkeOY2XefBF6zU9tCGmiQd5AFC+cvydstH1vTLG2tRNDqstdOMqh/ SkSnMVIrQA1Fa45YDFHfmXM7L7a8bEZXvEbpz55/ITQF8pXN9NBBdTWFuZTHLGpVgq1Zegp7UOYX hnYlxdF7QSnqOEk0S/Onzt+X9z5dm1HUfL2oSWkEblrayqXi6VFR067ChyXhi3qcuWBoHm858t/8 5D3/AJTvI7LzAr2qkgSzsGlicDaoHVcnLBLo6bPwk0eb3ay/Obyv5jjDfpKKINThMPijZyRUVFaU 8chuPqdVlBHIMu07W9PmhF9BcJIsg2ZWqCDsDtWvywQybuLlJkGGwaWbnzzb6pHK8qjirjr8QoeR 6U7dMsyy4tgjTGrt9aWlwI7SOL0yfhUsSNm23YfLMWW2zkhCo/75ygCIgBdSOvjXfIcVFY1SIeRT IkdSN+QK9cqEtizgBSXSOZHkCkFeNAf5SPHHiZRNKRDsCeYJBHJq7170yBNt5FBSBKMHFIzVhyPT xoMRubTHfmtkcSKYySGJJY96dajLYDvRW6M0aSJ7h4JKGRoiwHXcGgNPc5m4IWWYgatnFgViK1j6 bMOlT7ZlGNnk27kbq+szCW3+rwqecg2I2ApjL08l0uG53LkGD+Z9f0X8uvKl75k1mQrDYijxKQZJ ZGrxjjXarEg7ZRdenqXI1uYQFitn5L+Y/wAxL783PM0/my+X0Z2nuINMslYsIrWAAqgqftL1alK9 RlmSAgCHi82pOWdnveJfmKnHVXa2cS289368dpIwIb1FG4HY5m6Q3Dl0dTqrB5pfodr9U11Lu2DC OSOjxsTVWDAFCQPeuHMCcd9bWFykX0L5L9WVdV0iQlINSlgubN/2VuRGUCV23kpxP+xzV6gbB2GI VzT7RRE9zp1yIwyUngWNwahamo3NOqk5iSNAtsfJ1w8lvdWlqlnbBLaOOzKiFQSEqakmvSmIyGj3 FmYgyNd6E0bULtPMeuyyTkG0+OJU4qApfvt2GYeoJ4A2iL6N8myNNfXDM9FulLwipoFYKSQBT8Mw Z5KIHRvAsW91t/VtbWKKCOWVL2ShnG/pqgJYmvSoGWYxvbj5eVNm6soLnVdS1O3eLTre3tLjStQF qrWrzu5to1jaE8xwBrVlFag5ng7Ajcl1JuyCH//TCfkX+Snm780PNkWm6ZCljZwj1r7VZ6cbaLs7 xclchjsKd84zDo/GNDZzMMY8PHLaI+/uD7q8x/8AOHOp6LHHeaB5mh8w3EbfDZXkX1RzQVARlLoz V6A0rmyl2OYx2LZ40Mh3sB8L/mjqWoeWdUPlXVtKu9I1ieqy2d5C0MnEEglQ4HIVFRT55UdNLGKp OfLxERjyeWQokEQapDK3IkCtAe5plOXEaotOTDQRbatwZoy3JGHwD38cxvC4eixiRsWWeT/Oa+XZ 1aSP1YpJKk1rx/HK4ajwzugSMDs+zfJPnO88yQxi0hFNgCN/u8c2uHUmXJsEjI86ekyWuqqD6hZS NyKb/dmwjxkNR8068vyanZ6jYJBcPYxySKJ7xNpGqCOPqHdV9gR74Z4Tw23YuEmu99EeQPK+vaZq bX2q3kwjaFpDA8gk9WScftEE1KKPow48ZM7HcnNOEcZiBvbKfNcjxRBjsg5FmoT0XwHzzT68HdzO ywJF4T5wt4pNIuL6VA7XEipw5hOIaBggAp1JpmBB6TEeEmPd+t8Gayqwvdqxr6RY1U9QK/gMy8e7 fMjk8gMTXMlxCYebv/u39keAPhvmTyRE1yVh5Tt9Usrq0vYgwuUIm5D7gD+rBCRBtyI5KYN5O0/W /wAo/MFxJa201zoF6Xb90tXR26lKAE1HWgrmRk4jDbctOo0EcxE4bSD7C1//AJzC8gflv5hhe/uJ ZLXzFazQ3E2nWkk50+J1QiaUEKQSV40HxV/ZzDxzyAn07upPZuTJGgOX6FnlD/nNH8vPzN85W+mf pYeU9B8t6TeS6VrPmErZfpjUr2VYh6YZmCJBCpNXKsxbp2y8znGI4hytA7PyYocZF8VbDeq3fVnl /wA1eX9VsbaTT/MmnaqqPyV7K7iulKE9P3TuOmRhniDZLiyxkH9ic6PqNl9enuqPPykarKjMoNSK VA7ADtiNTDju0yB4QGXya4qwytEknwKzfYboNztTtl41I6Folirmo+TtVs10qwueam41WBL2oPKg uB6gNR1qD1/zFWPKAdurfqsc5Gug/Q3rj2+o+Y9AklYN+jI7mWp6fFwUn8Kb5DUz4uG27RyOLHkA 60Ej/Mu/lvfKV/Y2DLFcX0a28DSGgrI6r8W4oKE5SMnHMRDf2bWLLGcum/yfPH5s+UNHvfJ+i+T9 IdIby7v7Zby7iX1JCeYaVwFHvQfjmyhgBNcy5g7WmM0ss+XR+a352/kppVx58sPLnlhLm+W3tJhr jWyCQrcqQIgTXYMSeVT0G2XyxjGGWHU59TAy4as/Yt8hf844SeXbiO68wTCaeUhm06Ek26BWrxqD 8Zoo7U+eYecxI2dliiIY9+b2m/8AKlrbPbx6dG8BgZXf03pRhuRTwp9GYvh1u4/I2XoflfRF9AzR kiaTfkSKkjcmvh2ymQpMIi3r9pxW0RJWYyxIFBr0J7bb75US2SNckMsodrlUkAoVVvap361yjJsV iLcWlMqux+BTQf1rlbYBSFO4b4uEYUcm7ljvQ5Am22I722YBRwP2t0pv061pkYnbzZoaYs8fL1KA bstPHLBXVkNilskwijajFnOykbH4ttsI3ZiW7HPL3mJG82avEzkJp6w2ypQih4827+L5nYsog7XH hBwA97363u4GgEm9aAqwodh1O/vmYc9NIxm6SfW/NujeX9NvNY1u/ttL0zT42mu7+5kEcKKBU8mP sOg3PauVTzXy3RkIxCzs/Kn85fz8P5ya7cny+72/kbyql02ko+z3k5hZDdyoagdTwXsN9zlZxShI A8y81r9f4wIj3PnL8url4bby7Meh1MAgMQSGUqQPmpIzL1ERxkeToYD0g9Uw8/aQl3LpbBgVuFW4 tbwt8DINuLUrQqcyNKTwnfv+5p1AF7sc8rPqWnazfpcTmRIzAUjbjKlHILKOVR29slnNRHmwwQub 3XQLq3+suGhEUjQpcBrf4WUxTEA8fiB4gjpmqnIH6nNhGnpTWaSy215YOiRXOrSNPAQx9F3DrPGQ oqByNelKEZiZI25OOW19yH1rT5bjzFdRQMklI7ST04zQiRoyxIBIr17ZXwmOMM4EfJiVhayWfmLU IXRj9eu5FPqDcjflUbbbUzHyCouVHbfo+nvJFvFJdu5rxt7KCQGlFXmPsg+G1PvzBnzpkZVF7ReX LW6oLRzInpKWCElTyFKgUqa17HJwiQdnX5J3aIs9A1S+gs4ba4vLxrm5DCyiPqTKroDx50osZKrz 5kKFrShzPwk8XLo4MxEDiL//1PsV+UH5ZaT+VXlRLd0STW9UP1nWNQSIiRv2kipVzSNdqV675haL TjDG+9zdRnOQiMfpH397Nb7V7OaT07yOQWjloBb3PBIGZiCpep35H4Vr9AzJB3YRxkbvlj87vLXm SztdO13SvJOlfnJ5K8thn1H8ttbT65q1u8rms2m3jVdEhU0KuzAL2NBhIjMV1ZRgL3NE8j+t8ez6 d/zit5o055I9Z1/8ndfveRjtL6OXWNPhVqqCeChgCZB8If4QvTMTJo4y5im4mUdiLHkwPU/+cVPz HnjfWPy/1LQ/zP8ALbrWzvtB1GF7mZOINRZuyvyB2ZRuOua/LoD0LXxRPM08I1Dyf598vavFonmL yhrugT3Eoj5X2n3CKgFOTM/p8aIpqTWmYM+zpncjZEsMiCRWz9lv+cePyr8s+WvJtnwiGoXkqrLL qMxDEkgH4eoA+RzP0eA+4Mhi8MCR5lmfnL9AW1wEjCBl2YIR/bm4xxADjzIJ5sTt9S8t2s8Js/rl zOOLR27BFUydQBwZiRU18cZb7NmOQ4nufke5u9YkutWvI5YvQAtrWF6qtD8TEKdxtQCoyrFCpbG2 WokBADqeaJ85wsbV5SSVUN8IJHavbqTTNJ2jtZc/siY46eSrCdQspLe4hQpNFHNEr0NDGqni25IJ BpmoF83pJERlfmb+L4a/Mjy7Lo+o6nFNE8cSu/GUUCtT4iA3gAa065m4t3JlEVYeL6WIxdSsXoZ1 HpgAUIH81OuZJBA8mvYcmcaTZyvOzmISJtRQSo67HfGEb6pI2t65Y+VdM1aFLe7tI2gYcmLKCQK0 DDw8MzMJ6FEc8omwwrzR+UlnNFPa3VtDqliSaGWMNsNhUGtBQdMunihIebtdNmjKt6L5y1f/AJx5 8ozXUkkCPpEsjFktIKmBQTuAj8h8hlU8du1jwkXw796RX/5FwcgNM1W1tZECqjxxfVm5CikUhKgf dvlUsQlsUjGOZH2BJbD8o/Nulzg6V5gurRmZz61nqFzbEHkfiPpuCScr/Kx7m86fDMEGArzDN28g fm9fWxgX8zteRJFcPbHWr9lYdKECQbFeuQOkrkx/IaQb+HH5M88gf9DGfl5p2n+XdB/Mu1by5pEI i0rR9U02PUY44V+xGkkhWUKtTQcqUwR0JNbkONqextJqDx0RInoael+V/Nv5yQfmHN5o87eaIvNu j3ulrp9zoVjYxWMNj6LtJFLZxqaVLMwkDMWcEGu2Oo0GSgY704GTsPBixVj+q73ejfmJ5u8y+a7f RtP8pzT6NFDewXd7eTxq7zJCx5QKpqOMhIDGtQOmDS6KQuU9nCwdlAEmfcWMXGg6/qRS41bXLoSo CqfV3aCgkWjgemQaEbdc2PFHENm4aTBH+G/eiLHy7pWkQyR2ECxRkcnUKC7VPUk1JzGyZTJGWZND oEp1C1ijiMiRmZ3J4tXiRQb0HgPDKK3YTmKYYIFmv7ST1Wmjb4BQbfCe9O4OM+Lq45PFyem6fFCY VEcYjoCQ/XjTtmLMnqkcl08dwInkiajOQXeu9B0r88x5MohTiReFK/3hEjjepbuK+GVmV83IEaFq 0srAKqjagYEGoB7intkOib2QgMjSGSQMfUQGhNAKVNfnvlczs3ROyHlllU0jWvWp7UptQnxxre22 PmpyHjWjkrxq1N6V3yQQTZYtqF4fUb1KAqp4+yjvTJgXukVb4z89fndbfl3+aKWE1k17bz2MU2sv bkc0ndmZX3IBolNvxzOjpJTx8Q5sY9tw08vDlyZVqn/ObXlPR9Mjh0Sw1HWNRmQtBbzItvF8I35y MzkivWi5OOkyE/tYZu38IBrm/Pz86fzu8+/mndxS+YtYlOm152eh25aK0hBPaOvxNTqxqc2el00M YsDd5LX9q5c+10Ex/L9nj8savyQsG02aQgDYMW4qOnWpOY+qIOQf1gFw/wB3v3I3yfBNHZaIAQBb 3ttJHXrVndaD7sGc7yl3griFnyAZH+YXPTdS0ZImK2slmpZI/hoyyOagfPYjJ6T+7J82vUm5BLPK k0hluJYlh1KKS4jieF0+KP4C30ivQ5bqJekDoGGnBMnqWkw6deSxH1ptNP1afaVVkBeO4Qn02T4u /dc1U5jh3c+ANjryen6LemS9l0p5VklWl5ZeoD+8aFfTmUSruCQoNCBlEz6dmyAINEK8qiXzZrSy h0VfRWG+i4spkit4wQxpQ0JOzb5VKVYw3RjRV9EgfUPMNmkkTXEaGSRmESq4C03bqBU7+HyzHy8q tPV9P+QdBgm02UW5Fu9yf7xFJaNBUAUf4ajqBXrmIau1yyNhnuuJPodtZxWGmzXV+Yljs7FHBd2U +mAXKBK0IJ3AHyy8R4pOHM7HZLTda1ZWFnFbWl5q11IblWnkRzDEIOUbsJGVTKrM4CsSK9ulczhA 7U4UTZov/9X7xXs0xBhtgHev7xiaBB/MduvhkTs3Y4gbpDeyR21nSdiyn++nVVHxCprRtwfYAnwG Vm27d5VcyrLcq0l/NZT3SlXSZZG5KGNSifCIvU6moO23fJSrps2UATYunxJ+dP8AzjxpXmK1vPOf 5U2EumWVtBc3Wt+UbP1YJZAqkfXbKJxwZJK/HGoFKVHtKJ49mwkgjj27v1PibS7ueya1vdOv00+6 sDRdQ/eWVwOYCNIktuVYHc9R0yFkGmZF7vX0/wCckvzx8nC6tIPO1xqGnOiW7WWsRjWLd6sS9HkS Q8WDCtV6bVwSALQcMTyD0Pyh/wA5v69YkW3nD8vdH1OIhlN1oMsujyl12H7tPUiNWoKcQaZDgrdB wEj6vgd3r3lr/nIb8p/zO8waRoVp5b852HmDWmEVvZWsUOqxNL3UHlC9FoSWIoBuaZIS2RDRTmCQ BXO/J9o2P5WrZ6eyWLJa39zVZdSmB+trGd/TQqWVK9yDU9K4Yw4tzyazOA2H2PUvL2iW3l/SbPTL dQBApMrdecjnk7EnrVjk4x4Rs05Z8crSzzSJWsuMahizAOKV3Ow2zRa7cOx7MIGTd5HYo66oPVX9 3FN+5JFBxlDKQNq1FM0oJEnqc1HEa5kfdReNfnx5OieCW/kSVo5I/Tt7Y8CkkzuOZZFVmIK0BJp2 3zOxx4D710mp8XFQ5j7A+JINNmjaOCCIQmRikQO/ECo96V+XbMyLKRo13vU/L9jSNRKwdnUAUrQg AdRvSvtjEAllZe5+TtNj1M2enOIxdSS+jUyhKSMpYKSTXrt4ZeB6bcXLIws9AjfOHkfV9H0+4u/T vZDCn722AjCrIycnMaFubiNVbkSBSnuMqlkII/a5Wm1kJTAFcuf473zXfpL66ySpHxmjLlFepAqR SSlArHsMj40yXosWpEYkWgoEtY3FYaPKVdm8GG4IO+SjMszqSduYTOO20xTGEVlZOQBJH7X0b9cs OUhlHVy68kztVtS45MwdX2AFBTj4g74jNTlDUDZlFtBaSFZTBJI0L8WWgowIpWp7ZM52uc65J9FZ wVqkPCu1ASeXhX5YDqJVs4ZzA2mKQwxKzlQWAGwpQUHTplJnMjcuPPITySW9uJIUNVq6ErxWhND2 G3bxyA82iciTzSG7kgjgWWd1QtUoeh4r0JGCO5YkMXvb6B4jbkp6yHkGGxYEbNvkhCi42bIAkGnR taTyQswYJLRVTqa1arV/hleY8Q2aY7S2Z3aRNDG0rsRE0NI4h0Bruw+YO+a3KehcyEb96DivEYTe lIJHjqGINVDn9knsaZSTTYYFVhd5AOQJZDt32behIyGx5tp22bvJQo41qVHVdqFvDocRFhIjolst 1EpQc25MOJUjfK5C3IAoLjNsOgVBQ06Hav4UyPFSUturkKX50UNvWtKUP45d0tgZEMA13VYbW3vL q5kEdvbo0s8xOyRoCSSfCg3yeON8uqzlwiz3PyA8z67cecta8xeapndpNVvpmgY/swI3GMewAoM6 IQ8MCPkHkNTMzJPmwnUmH122RhVYYnDAnYkiuTx2Ye+nHlG9wxXV2DJatQcitQOvSlMyMVBxcxJL 2zy1/o3lrUUmU8ksYoo26ANMzEg+9M1OSP70e8u0xk8ID0DyVaJcLaRujfVLV1WcqV5MyLLKoFfl TI5p70eoTgHP8dy38xLlNV0zQ9RA+J2miQA7Ag8yp+YYd8t0pNGIa9QLIpjfk5WSS2lX/d+qiNVr 8JCrxK0PbIamRF33MsINW9g0LleTJIHK3MNpfTyKakOvrxigY9KU2GavUECwHPxbEBnGm2zt5p06 70+sge7lrUUEiczyU1BruKbZRx1BujjBN+TPpNNgj1vXr2INGLu5EzLUsrqao21Q1QVIO2QnuAmN hP8AydbWM0eoWsVxObi6kktrOGGHmqB/tFCSpUinjlUyLCiy+otD0qLTbK109Y2uI4FPKZgeQZAC SCG3r75SIjnTTKVkllujarbajcX3lrTrfTGvxYXVwz3kxaY7fu4I7cyxlmZh9nv0IpvmZjPI11Di TkeKjyKlqVteFbGwk1LTSltp0UEPC0llP18F+c6RNNHCilhxA3336ZlxlZobfqcaqonq/wD/1vu1 calBbyiAxtLNKD8IoFCrv8bNQCnWvh92V8TeIEvH9Z1S+vp1TTLSeWFryQXWtCNJVjWMBVS2jdmD NIerEV49gSMgST1crHGxvttyQNvBeX12klvaXVxf6Z61taw303opShRpmDRkULGiih9ulcJNsgav zXSXmp6e/KKN73UYGCi49NbaL1pG4lonUMgBWoBIJO5pviSxHdyD4P8Az9/ITTdKj1r80PJtzLco Jnm88+VOCztYyT1NxdQTRgK0avX1AAOB+zttlgkJ7cj97OOTp06HvfIVxqKqLSytmLn6i6y8Sdga jjy8SOm5yFbW2E866MZudNhu7mFfqLpLdQB5JI68SY6U336HbxJyF3uVxR4th+Lfrz/zht+Q915B 0Kbzz5p09bfzD5ighXQ7OZCJ9OsONWUqQODzEgt+1QAE9cMY8Rslhr8sYDwYH+t5nu+D7m4jL3VN 098SrG9aSR7edUAduPIV8Vzn9Xe7n6MgSBLydI3TURcsxKSKsiR1rvyLgfF24sc08SSbL1JlE4zH u/s+8Jh5605prYan6DzSW6KLSNHEdeTqxUkpJ9sihNPs12zYSgdi6/s3Id8YI3u/0Pn/APLfyBos riTzbpMJvZri+v7y2c20aRrGXUMsat9YCqta1SNanLozHI8gXN1eYgHg6V9v2ff7mVRfkXoV7qUp 8vahPYUtUlnQIXthLccpR+0oQBaKEBJzIx4xOt9i1HtLwYfvI9T1322+PvV7v8v77yilvqjavYTX NmQbaNkrEtxXioIZhWhNR7jI5SICrtuw6qGqPCIkd5L1jzXoa31lbGGzOveZLqFbKxiv9re2Z0Ak uLiKKisFpUg15fZGxyOSMTESAsuo0epMSYkiGMeo0N5Afwi+/o+H/wAz9A0ny5rdnYWVleXVhNfv psskHCa+v52Ucnt4Iy4o0hO/FQBRACanMaOQHbq9NgyTyQEpbGr8gPP3D5+T5oudZmglkgmJeWyt pPXtkryUwtSooRuG+Ej8cvF25UM4ifK6R9t5hmgW8DkmeEFn5bpRXCBVYnYkb75IEt2TJZ8mRaXr k97LaksIWZuKA0UV3NN9zUChyuJ33YxzVzZ1pOvUvxbBhG7KA0ch32Faj3w2Gcs0pDyZ1FqDFh6B +OXpXanauREuZQBxBCyanJHBMKeoA4Jqd6V3Ip4ZMyFNksRsUlbXy+ifh4xd2ZurVqKkbjIGVsZY iGM32ox3FyGaVQS/pyWwUsKdFG4rvlnDQcWcjFJrezWSX1GmQyJIQ8TgtyA24AHwrhAoODkFlFKW hljleGqzMY1ZQCNgd2ABpTMTLk7nJxYuqefXONtHGkqrGRSvLt3FNjmtnIXbmQ70ijX0pmhijCo7 mZpo60Z2P7XHKubPnumcbMZ5QKkcdyvifHJArW9lCyyGEo0hrIKn4j26DtjbM1SHmmjkINAzMCVb qd96fRlfCbsMoHvUopWeFQV/duSGYVJFB1yRHVZHdJNQuAofmwKRisYINQa9On45Ic6HViSHyt/z kf5qk0H8t9TSOUx3nmGT9HWcamh9MgvN0/yBQ/PM/RY+LIB0HNwO0cnBiPm/P9LQQaNZJES/ONXk QDc83rv9AzbzJs285DcWWGajKfr7SgAIkhFD7gDLOQFdzj5JHiY1c1kdIyPsMQDloHDbUTu9rs2j GhaiKkyj6nFGOW1TuxNe1Cc1Jl+8HnbtOQL3PyhpT2flqPUCaS38srRk70NGjWi+IjV8w8+QTnQ6 NkI1Hdgfms8vJ2h8FCOt3ychdgrwp8PLt0zMw7ZJDya8u8bXeSYml/w9HxMY+sTXZIJOzOqAke59 8hq5byPubcUeg6vU/LsfDWJeKs0UUCW0xNKf6RfRjpsNhmnyE0T3k/c5URvfUMr8g3Ru5o7hPiOm a1czCJmDMYpLmZytDtspptkdTtH4MsYenpbvdy3NpJ/u6Uz2UxPFkkYFipY02b2PUZUDyZSJAfQX kTybNFaC8uLRDeytX1XAih+xXjy+EqWpuzDY9MERxkhx8mWhtzZ/plhdyXSSNA8YkiKTxLN6qQni TUmNSCKA7kgeJyzgFU4oyWN3WA8t3eqjWLK01PzRqDM4gn9H6vbWu396JrkwsFANDIevQZkQE4Ch sGJPEbe56Bd+UdFle8nuJPMeswrFGdI8tQ/pEwTSUpE8lwSiBmI3+yO21cvA4j1tonYFRF13v//X +2d1pr6nM7STO0Z5SegOQV1oVRJOxQ918crIc6JEQ1NpXpUlllhSMM6m0ReCRxnfghSh+Hr88iAg S2pASXEAR0ELLbXB4RUI4rxUn4hUk7L4dzTGmdW8+80zS6c9tPbSw2hlf1QksLEww/ACVUyhFKki hO56UGCke8PIR5x1CeSCeHSXvU0e5vLe9uXmQt6EfMtJOHLRy+ssgqKbDlXfIHuDaIbb7W+Lfzq/ KKLS7W5/NL8sopdU8h6iaa9bSsUm0y+nkCIEh7W7khUIrQ9cv4xP4MoxkDR5nk+lP+cVv+cbRrJ0 f8z/AD3Z8dKiiin8p+XJkThcGgZLuUVNYwfsKVHL7R94QjbZqc408eGP1n/Y/t+5+mYXj7f2ZbdB 0rYNTkBOyq45YrG9WYgqqmlD8Z9jnPaujMxdhpQxL6jJDFVIw8cU7+iDTcMfg3NdgDmvGMgEO08c SO+2wv4IrU056VbmQTMS0SRwp8ZMhIUFtj8NTuSNhmaTcBbRgPDllVcjv5eXmxny7pLWrTySi3mt 4BfsguFKzN6swZVdj8JUmvRfs06nDhhvbmavNsIgmzw8vIbvREsLhILVoxbxyBmkdI4yi1YbfZI6 LtWmZ8cRjEbOklniSeKyOW5eDeZ9Tk0W80rTtOsopfq8v2rektwJbgtX0FbjEtCD8Tb165qslDJX R67R6YZYSySJAPTkKHf1+T1Hy/qhutKvrNSvLTrVYb3U5JFjdrl4wxDNThyUGrsppXMiGW4kDued 1en4MsSeUjsOewP3HoHx9591Kw8p6bqeveWr57jzZqVwdM0TVo4SkNlaryWa8tg9S0oL+kkrACpY oNi2YIAjud3qYQnqCITjwwrikOpv6YnuHX79tnzhr/k/yV5c8uX2q+YRqejeaPM2niDyPpnNLiYW 9kYWutWuWBA9K5ckQhQdgSWJJpZHMfeW6ZMp8IAIifUe7nUB/SHOXdyeJzRy2dusYLSi6kEjMx+0 NwFNDUqS22ZINgubGIkT5Mv8sanLbTvDLxjtzF6Vuy7uJUI5SMWJIJANdqdsoGxcacKIJ5vYhbxQ 3aTuiyTERETU3YMoJau1NjiSbtthc4/Nm6uqyu/qqI+IWNQOgPauXQ5bt3EOGkour1LaRJG4LboS rFdyRXY0yA5sxMkJRcXayitnOZ4WIMzk0AB3FB38MsIaZyNc0qLrNcObhjzmUxK2zVY9K0BIphlf ycDLMl0CQQsgkiVZQQC4DDlxp9qo8fvyEpXya+qJMk3C4ZmDxivCIVB377CmYGT6tnNx7BDQXKyn iUVI+BPEA1IGx37b5jTFMozs13IhZAFcKiyKpCMtaHcV65WIktviAKEssXJ4o3Klx+/Vd+op1rhr h5rE2gHcxLKXrJxADRkkn4zRQAPv3wXbIyCizAnk5pxBRe9GPbbx74b3ZQKx7xLOGSOn7ujAlaE7 gHEkWpNsK1HUFuGMUS0p9tR4dQCd6DLIkXbGMd9n5/f85R66+pebNN8vxScrbQNPeSVFbb6zcHk1 R4hQBm50GKsfF/OdB2rl4pcA6PAo7hYrqS2kHKNLWILxP2SELZfKW1nz+x10zRv3PP7uWN1nevxJ OQ4Pfw/VmTw3Vdzik3ZSoVku1CjczqAP9Yjxx5sSN6e6w28aadZoqljfX8hYAciscPBdzX/W2zUw sn3D73bPdLq5/RnlW0BYKHgnl0+JexlARqA/yhiPmcwIXKbkSFRtgXmq2aTyDZSwE/6PeHkK16lA tR4gZm45/vSfJomBKNfjqr/l5xN9YqpPC3id3BBZQttFJIfvamY2qlsYnvZ4RtdvRvIsbzqb2dAx m1fT42YmoPFGuWFPAsmYOYbgDpf6nKsUfinP5UR+hZwanKf3l1c3SSqTsEMjCoBIpRq75HVT9VM4 R50+n/J+hveTXk7xqyO8TwxoPh/cxD1Nz1AqPnmOASKY5pgPZtK8y2Vrqsej3cX1+41L4dKtnDH1 lC8uACEux61CjqMycUL5Osyz35PoKxs4fL8Gn3ur6nH5Xurxo4dH0OwZ2u5HkYMvrQxGRm51J+0D t8VMyDjDj+IBY5qlx5a1vzbqeoabY+Zhc2/poNQTU5Y7m5tW+J4nlWR2ZUk40Ebkgr0CnLYwsWGw GI3Zp5e8raH+Xlvf69rHmS41jWtYPqzX0rCkCOpURWaqoS2tx24gud6GuZsOEAADdxZgE3Wz/9D7 lySPdRIkbmOGQKZJQqhhQgivMUWvTpkHL4a3QVx9Vt0koFVUiJdyOR41q4FDUk/PAtl5j5i82RR3 ktlpt1BHdKkA080gYTczQ/BKS6tDVSTwIyJZB86ebPzBfT1W6fWRbaTcwyottOa+jJbuC/8AosSO 8qyuKKxHJmrRQtMjJsERtXNIdA86ToL6CO90m7RJIEl0a1geGOeW+kQR+uZKMiKfidahyftcVwDv Ueqvxyetx3uqySyp5xgt7jS2WJdb0CWL64/pzyF1kkuoBKSqhQPSoOJpvkZVzDk4z3c315oOraRr GmW19ok0c2nsvCERjiIymxjKinEr0pTL8cgRs6jLGUZkS5rfMfmbQ/Kely615j1ODR9JgZVuNQuW 4RRlzReTdqk0yGoyxxxstmn02TUT4MY4pdyl5d81aJ5qgku9Avo9SsE4cL+E8on5ryojd9qZVpNT DNfDyDZq9Fl0pAyjhJ6MlzMcRh3mC4ECmUMAFBDse3v9Gc52hPhJIdtoMfGaSK01Rbp3t3mRZkhM kcSEFqKKK9DSoJzDx5eOTm5tP4YEgNiaTULJPZenFMQ7IYxIaVNflmdAWHFJEZ2Qm+k6PZ2cPGJO SvJz4kfCpAAAC9O22Z+l0wju4Wp1U8ku5Pii7E1JUbZsacNi+oaDYSy/WGs1kuSCsDKicY6VNdx3 J65r9Rp477bl2ODW5Ijhs113Ld75a0+8s0sJrWL6gp5zW5AHM7NUkDxGQno7h5IxdoZITMwTxdC+ bPPn5Z6Y/BoraTXoLV4Em0GS5EBl4n06s4AJr8Xw96mhFc0+XDw8qsPY6DtSWQXKgdyDXX+z4eT5 N876Lceb/NfmbXddt7TT5vL1jEdKisuIhW05JZ2VtCH5HirUrQDYuaYIysADk5sMQwQjEni4ib7+ Lckn3/qeMHSHFyLK59HlZ+oskIH2GDKysW6biu3bbLBIht4qs9Cm9vFp8EsMcYjKxSLItyOoJ2IL Ab18DkzEyKL4gZHqz6IBfqypJ9uMGEkkgU2owP0ZIA0uIgGhyCdR8TbD1/jLqtUQnly6VHTJcNsz IWp8o2kEQQxqYypDbjnSlTsTXJ8PLZrlOhaSlZgNMjFv6kCkCUCgIYirepWg64ZUN3GlMk7JpIbc wyo8BikWTiEFKgkbED6cpkd2q0C8cQjjW3PqLBUmWUAk8a9K/wBcqma3DKJsqFwOYEpf0Id+NByF K7kgEd9sxo7OUeSFKARukcazyrxA4mhp8jQAilcoyeoWGzGL5tXEcbSCT1JCYlAMdaCpB3PjTK+L amG5KGldQlY39MuQvNfE777VyNW3cdBJbiaUzQSWkRcs3GaQU+HYmpJNadsmJABHM30R31j0gHlY HkpaStK77igysmy2xYtrGpckaOFx8YCrUAEnx2yUIEnyYkbsdkeDT7C61C9cJBBE89y5PEURSx3+ Qy2G5A6lRLgiSX5W+adffzT5m13XJCryaneyyA704sSABXsBQZ0UY8GOMejyOomZyMh3pTeRrDqL U2D28QHiT6e+UXcfn97KYo/J5dczkG7VmpxuAT3J6jM8xsj3OtlLc+9F6W8b6naJ6YZmuY6u3Tbf pgynhgabcIub3S1ma91by9prKZQsdwyRCgHKXlxqNhszA5pDYjI3zoO0jfFEB6X581L/AHI6PoEf ALpmnW9msampozGeV/bZR+GY2liTEy7y35zvSX6mWm8k3tso/cWUrXfPofjCsFO/bJ4pDj8zs1SG yC8pXH6P8t3N7X03Wykiirt8crfFQ7fzUyGrheWvP7mzFECPJ6Lo93Fo/k+xmP7o3g1HUhIN6+lA bOBjXwLNSmYojxZD+Ou7eCKeifltah7XQ1gjpN9XLzIp+FXIaRqih/abMfUm5H3s8dgEvr3ypp1w +nQadCGkZkE8UKJWbkCq8lQfE1SBSuQhu4+SiXq9+/kr8uFhn1LUY9Eg1eRYtV1qIz3Gs3+pSBR+ irGOGOWSGKQfC7RspJqo3Nc2Gm9Q83XZ5Xsfx70VpuqaR5h86HQv0pJ5m80y2rw+YYLGARaT5YtQ AGsVuAWYTkEeosT8qniaktTJOMjmCHHE72iNu979b2Om+V9FXUDYz6fYPcUgjvkjt5b6aNOLTLEt SRX9pgzHouTjCgk7yobrrKTU9Zt7q1g8u/prWiv1u0n1UslooqKNcuyqKITURqB060yW4Oy1Yomg /wD/0fsTq3ma4sI44ZVlNtcyMtsZhSdipUlpGk4LGKsQKjw3rlRLm0+ePP3/ADkB5Z0bTtVsZpmE 1g88Vw8kyxuttEgDXEciB1KM2woDUg74YxKnZ8c+evzUsdYNn5ltdYOi2Udu1xc6bdXbWt1cSlzx iNuKziMKVZHJqeXUYY7mvNFjqwLQbtJb/RNd1O+treTWSgktEuJ2urpAPR2miZ3gAPEKOTNTfici TtXcWYG+276J8paNp2nrap5r0afStXs7hm1zVHj9W2RLh+KJAZ1Dl+CqYqsXZiW40pkJWSe78W39 BVeX4+969frZWGkywanrF9pjXtmbq91CS4INuqgvMVkuI0SR3pxU0AjqSWGwyJrop5dEn/K/81Z/ Iuv6fZ2mor5g0m9Dx61HbWskQuZ24CFmkZ5SZlPIfCtKDf7QoKrcNkoRzxIkdxyfWn5w3/l7zb+T mtyrJFqGla1BClvyUMPUMqMoZTXiyFaEEbHMTtPIDgI6uX7MY8kO0oVsRZ+FJ1+R+lNpX5d6LEbd bcTmSeONSpBjLcYj8OwqijbIdh4uDT+8sParN4uvn/RAD1p5KAgbnoR4Zsc2bhDzwFsJ8wxG4tZu TUQqSVY0FBsajrTfNBrI8QdzoJiEx3vnvUfMyeX5LfWJ+arbyRAsB6qyW78kkHIEUpT5V7ZphMxl 7nrp6fxIcA3G/wA9i970nU7e7ggureUzWd9DHPZ3SvyRlcClNhTYdM2+nyW8nnwkEjqCQWew1CAk 1NBXN/gunSz5qpbY5kWxKHeaNCindnJVKCorQk1Pbp3yuWWIAsi2UYkg0wrzZ5y0ny9bc7+eivD6 y2iNSaVOQQ8VNO7DvmBrM9Cg7Ts/s7JqJekdefQPkzzx+aF47z3Gm28drPqHCSUFkuJCqhljDfaU 1BqVpsc0YgZyJ73uNN2bjxQjGR4q+Tw/zPrl1rMSyaPCYAWWS4Rl/fKYlIo3BQnps7MVA398shAi 7cvFgF0fx+153e+XEk1G5ml9VqiFp+JZR6ixpyahNSeWZHBxAUpx8IKHi0L1Ue2lHqMHDUB3CGvH agzJjDq0EiKc0W19Hkok4UjdlNSNwpK165IQ22aZ5Ntl5vRzZIpZE4rw4nYMSCagGpOw7ZYIhoOS 1aCQy27yvcFI3qyFm5FiVC14mnUnpgonZhKZPVuJg8bwemI9zWYsKORTcb9TlMoAlPF1VnSEmS6Z jDO4UIxoVqgNRQbmnfMaR+aJcxTpGWeNF+ysS1AFDUgglQPevhmNkB5uTCNBQijuLu2kkuABDzMY hoADSh2pvTuTkY0FEtrKvxjit42ZiBXijbleXY7b1yiR3cgSsCkNPyKSiMH94tGd2PFQNqgGu+Vx AJY8OzF5LmYTghlWAoTzbdq7AUG21MEpApiN0vlulhUs0oWuz8Rt4mu/tlfXZuHKkm1HXEVBxrx6 RigHPbem5IywAE0osGkDYWs1/IbuZKJ149+NO++SPcGyMdy8S/5yS83R+Wfy/u7W3fjqPmM/ULNK 9I9jMxHX7O305maDCZTBPRwO0M4hCn596FCJYoRK1EZ1+PegV6gg0+/NvkGxeaAX+YRNZa1PaSle Sx+nyH88akAj5jKcMdvx1bMkxxX3vGrpnFxcn9ppASPctm1jyt0xJBPvT3y+hl1q1ptx+JvnSgP4 5j5x+7Ll6eNzBe0eWme7/MHSbeM8hbhA/L7NOS8wT22BzUZQRgJ7y7THKsteSnr+u3F15i1zUJGC S3V9JbxIDUCMt6dR/sBTbDix8MAPJrnIyk9NMkE/l7VtMlkT1dSkSOyShFWjALL1/aAYD6Mw8YqY LlTI4QBzYlNdiy0O10VwyvczhFofi/dsSxHiCSBloHHMyWBIL1TzAi2ehrZxgyxx2dlp0Uq9F+L1 ZA3GtOZJzDwbzvkRbaT6fi+j/wAqdHkgmKSUWB7NDDEu9WmANBvuTypT2zC1Fg7bshI8Pm+0oPLv mzQ9Kutc0X1Lm0srSWGWzljnhKXnptwWduKggtunE9qd8sx4tw4U58XkSs8meQvzR1qW3g0K7kt5 Xt66j5tubQR3CMgLKtjFJGIYSJacppGaR1rSmbKIHLk4EgRsTt1831j5Q8qad+WugxaLp2oXevea jxn8wauLeNwkpIMgXhGkUMauanxO5qcsHDHYIiDPntHoGdTQSQumq38yDTYUCK85aa9lkYk/H+zE nYAAk+IG2SHLdAO9AbvKvzA/5yc/Kz8p9Me5luYNTubl/wDR9K05lq/PrPcTmqRJXt8Tn+UYeKuX Nx8pN7v/0vZ/m7Vdd1fT5XudeeNppEnuYJYJJYYoYkE00CrcASOzkbER0HamU33OxIjHq/PT80/N 0TeY9c/RjyaVcXNsunzXKl7WOKG6PKf/AEZh+7BahChTtuNzmRHkCejjHYbcub5vm8zW1vb3STma DVwzJdahAQwu4RtBySQtShQEnnUg9BkgPkxMgXo/5bahfa9rmjacqqmo2c76joyO3wJJawMWWNIp IxEG2PStBWtcryAV3Buxm32HoPnibQ5tA1+2u7zVWW/uriOwEsENtJHp8CRXE97EQZmjNzP6aCoJ UAuWymQ57N0SBv5fK/1sJ/Mj/nIGaEXmiz6vJNfaLNJHeeqgUSxWJBkThBEUuP3hXipAiAptsclG AHfu1+Idvc8i8hfmh5na/wBWudMu54BeQXN5rNklvHcpDbemJpJHuEaORa9HKEFegwygCRbLFQqy +2/yq806hfNfWU8V3e6XKGvvNmmwRPcW11bsqOtysrSyMJY6qwK1qNmO+YGo04yxMe922i1YwTE4 8wKB/W/Sv8qm0yP8uvKS6TqMGq2KadFS+tpPUSRiAzmtAa1Y1BFR0yWljHDhoHk6rtbJ4uryT5Ay LLLi7b95xoCu7DrQb99qH55h5MvFdNWPE8q82aw0drMJLhvSmcRiJJCG49Tsqmuw3zUamZI5vT9m 6YcQNct+T5Z816pb3WoQWFtOZNPS3mFxpaSKirwkWZSzFWP2mfbwzGjDaw9EDw30Pf8ACk9/5xx/ MVri5uvI2p3Et3FayzXHl25LAKsYFZLZ1J5f5afSO2ZWM8MrvZ0Xamn4rnEAVQl+v9Bfc1hdCWFJ QDxf4lH+TQZ0Ony7W8fmxmMiGL+ZtceztNRm0+ZUntrd2uLwKZhDXZaICKnqd9tt8qzZ6J4XN0el 4zHjGxOw73zd+a3n2c6TpmnWDXtpJFzae6NVheQRMsKvMjDiz/E4rt9nMSZ468vvd/oNLGE5SkAb 6fafhyfJ93+YerX2rSakdXkubmUcJLuaheWIp6Z4gjiKAUqB75T4Q6u6x5IxjwRjQUV1SOQ0os8C HkWFCSo6Gu+5ywQpyTl4o1aFfWHExht5Zo4LpkW6iU/A1D8NR/k4ZizbOEgUbLMYXjMrKbZlLyPQ sSQKj7Jrko7MJ5LCTalPM1JUiWJS9eaEBwKkAipHXLozcLLOuanb3cMs1ubyUzMzMXhqApfjQsSo Wpoe3cbZYC4xsC75ql1zdpl5oLNiS4P95RDvxYHsKjpkSQWtUlYTWcMcf7p40NY0qqkjeoqP2gR3 yG4QaI3Vba1LhfrjlokVmSNVbZjsdwKnbbKsmStmQFinW8UwvJBcRlygLW8J3baopsSd/wDKymch JsiGQQwPbxRNwSNqfvEoA/KmwrtU5jDqS5BvkHOPhZpJY45Y1ICqtSB2qAfGmVzIBbIR2ShZUEDF mIL1oidCT7ZjZTu5EYMWv9ZFnN6V5cKjOPThU15MN2JA6UAwUK2O7EmxTCL3XYVMrrMCGJPrVqVB 2IT3PTARVBlw7MWfVJL12t4k5V+woNQKb7n3yfADzSSdgE4tdMmumZnlKzOp/eU5ekPalKkZEm+T PHjJO7LriOGzto7aH+7iAaSUn4mboBiNx5twFC35jf8AOSvnGTzH5+i0eKTlYeXo/q6gEkNM9Gl7 nodvoze6LHwY+I9Xlu1colkphXkW1fWLPW9GiUC/htnuLUAb+nF+9kC13qOIb5A5dkut+rhxIAST zb6d9x1CGE/WbdPT1BFJ+E02kFT0bv4HHAKFFhk5U8dvEs3nEyvKnqU5CgajL1BpTNhC6p1uXndJ 75e9Jb27nQsREijk23U7/hmNqj6QHJ0gsyPQPSfy4uGk8zXuoseCrBOqMQW+IowH68wtXGsQj3lz 9NzJKVagjvqek/BRbiVQ9P2mjI3PzrXLBUYk9waiLkGealeyxWUIhDcze+rC5pVvTkK1BPTMHHAC XwcqR2ZXb6ZF5jv9I1y0kWSwsgkOoooAMUib1deqh2PXpglLhBRCdyt6r5b8vX3mfzBp2nwz/UbA 3f1jUdT9QcYLeIceJUMeRIB41Ga+Q4A38VDd91+UvLcMzLb+W3MlrbFptOuZwsU0yAhYmYqwCliO ittXvmJk5suKhZfWPkLQ203QddeTzZqsdjc2i3evafcubwQRRMoHoG4YhCGXiASxqTue2VGzXk4U xGweoej6Lptu89lb+Rpn0m11P/SPNerB47iZQrUWC5uDzoV6CNKLvucvx2SRycfIY85DdknmHUvL WiCLUNf1qS20rTg08NZfRsohCN5JiCJLiTl0RQQPbrlvFEdbLAyke79L4b/Nn/nMmxm0rU9O/Lq5 a2u5ElWOe9sUYXYYFRyHM8UYmtCu/fARx7cmqWYR36vgKPVG/NG9WHXfLi3fm1xSwS1ubi3tbnf+ 6EILxwOexCBD0NMsIMJcxThHN4l3zf/Tmfnn809T85aDY69pnmJdKv7aFrXzRDaQo6yR3aNHziii ieeQ9So5cQx3A64Rj2oOUaGz4G88X8msapczm/ub4ERmGe4eQTU/YRwQOXpitRx2oe+W/TzQAfg8 7aWaaJbpw1YWBbjRgxU7Uqd6Cp6ZESs8mBjStovmmTTrp54p75BKxinjhlMQeNwRJG7CpKuNiO/y ychY5KDwF6nd/mv5r1vSp7C3vJn1CGO2iuJDbxzFoY/UQyLMOPohVcD4R8VN8oGIMuK2C3vmvUru zhsJ7qaeS1Mj2s7vUzGXkkpk4gdeXTuOtcmRQRxsl8jeYtRs2ns7W5k+raokFipuXItYGupFVxMQ vpiNyCtDRVrWpORMQOTbCVPrLyG2qr5saaz1S80uxMr/AOI20yaY2cVoUE1pC9+8roolcEMCPSUb M3QZTk33bonmeb6o/K7/AJyF1/8AL/zJfeT77VrPWtBWZ5rCKP0LVTCpo4guQTHMYCFBenxqQQdj mLmw2Ljs5MODL9fN+hkutrfaXaaiRLb2sx9RfU4IhoC7L6nIq3IA0IqDmk1USBvs36fAOKhRJ+Pu NDk+d/OXmqSa7ubCzne0ulWNkECcmQP8aIjpQVNeJJO2asG5c3rtLhjixA83yB5y8zGSWP6ukazR QOs86StKD6wowL1Ub1NcyIYyeRZ5De55PNY/MV75f1a21XQb2W3msJobqxvqelIrwsH3BLUBNVO/ QnbMrhEo/Y4Zon1Cwdvfb9Zvyg/NbRvzP8srrGlI1r6qiDWLV6/6HesAZIS7gcwAaqwADDfMjTZe A8J2eY1ujOMgnfu8wGP/AJl+aFsE1q31OeDRoUERhv8A1ALhCrfumRHdCzFQSAKliaHbGdm3L0cI RiCDZ7vvfm15+8/3WrXUd/PLZ/WbhGtbyzto+BVLdVEM7vydXa4+JzQtQ/RlgFknuqnZXvt06+/o xLSNZcWaQudpCzbsagk7qtfYdK0yMy5MSQd+qcLqFVQxuY1q4CLRuw2qOlPDBcu5mCQL6uOrRTTW 0q3BR1XjKg33Ip8VMmDsmGSUTunH6bkKpHbTySvAhV5EoeINNyBWvTYZWDtbaDxIceYoW9QxsHEM nFbdCGLLXdq1NN61BGSGWQ6uLm32K+PUYL24EUayW8zuksk7iici3Lj2NfCm2WGVhx4imUWbiT4J ikKIQV6FlrU1PStR7YggBkSr3N5AHlikKCW3UEk7M61NKAe2RjLdrotWl06soa4BRnZjGCWIUPtx 6dOQrlU/Vu2wDI1is1ngmSYqsoRpnK0X1KkcKnr1rUZDiEbbIxtkBSKKNJJpIwUBEdKn4j3/ABzD nIAFzscWJX9/ZwzOjNHzbdmOx9xX2zGlO24QYDrXmSKBW4OjFgFADDjuab7ZXV7o4uHm8p1TW5rx uETgua+pMOxOwA/szIAA5hqJMj6eSXw2lxeSDm/JkCr6aL8K8u61P31yY4SExBLO9N0JLVFJjo8n 22qK7H+3KpHoOTfGLKYbaOPj6UdWSrBq8aVA2yvm3xFbsN89+YIvL3lvUtVdhG1pA3pE7AysKLQH cksfHtl+OHFMBxtVm8OBfkVqzT3eqXdzMzPd+u80sr9XLE8jv/lZ0ANR8njZyMpEo3y75mufK/mf SdetVo2mXlveSRdVliO0sbDwZag/PDGJlH4FE5+rhrZkf5jaYdE8w3Fxp7ltJ1BI7zT0PSWyux6k Ddv2TxPgwwYpcXvphk3HF1ePXFvazuyFxA8o5Wzn+7c9g38p7HMyJ2cMmrW2kc2n6ZP68fCa5k4x +4G1QR1yrLDjyiuQb8J4cR8y9F8s3J0jS47xf753X1CO4IqT9wzB1EDOfDbmYTwwtNrOyN1qlrp8 /wC5kQrPpNy4IDqTy4mg7qdsgcgEDfLl7mcR6wE88wQXFtbw8oWjLp6UMm9DxdnZ+X0jKsA4hbPJ Igc2X/lT5d8xTX0cmiWsst1cuicVBMfDssvHoDlWqyAeTLFE86fop5N/K/SPL9l9elsFhvLx4/Vu 5XLWrsxBEX7LEISOjGu+anJIzF225JAAWdnolv5c8xeaZ9O8qaF5gubSTWbqCORLa0AeKyEhAEQZ /ST1KGR3c7JxpxG+ZOIRiLol1+TMZS25B9Aat5o8r/llHcxalcC40pLWe4lseDS3Gr3RpG1xHZ/E y28J4ohfiGPJgCTllGXJr8UxFlijfm95h84+S0v/ACcsnl610XX7ltW1CaOJSbGO2hlLJESqtIWO 4VSQCK1OVyEhd80eMDcur5r11tW8x6Xcrrmpr5k1jzU0l3fX7XAhlt7dmIt7Nm2CjiNwUpvvkIzA qhuGnJksPE4/ytspJ4q6hPdRPMEk0q1VHnjb9oSS09IDatVB+WZ2ImRPpcGYiDfV715N/L2FZI9M 0uzj0m3joZzGOU8xrUGWZqs2++1Bl+PCZc0y4YjZ/9Ty75B81LBqklle3EraFcP6OoWiMYpWSShf 0pFAIINOJptTc5efTyDdE8XwSDzpoFxol0sGnLFc6Pd/7kNOmVQWdZGNI2mYkl0CUkU96nocTudm QlxbMIa1ahe7kS3hLkopIVDG45fDUCtG22FMZA1sVkAxi8hiEitGHhVvtyE0f2A6g5M2Q1yCAuNQ Fu3+jRNawsCjxGQhjQ1+NlIqGIrTIEd6xBtCtK8SCeKTjG/wGrCrfIDpkSLZFOdHvit5wN3H9RvG U3kFxI0UEgUhuDlDUj8fDIkWgToUX1D5J/N6H9CeYrbRfK8dnreqm1tjLZX91IzRKX9eOC1kWRHL LuzSN8KjbKOEXuXIsyHm921rybrl15d07VNcuPLdxq1ro7z3MUM0kUrXZhFtES8MIpwWbg8G4apO 1MjGRJoktu0TY8v2sH8if85H/mL+XQSO01261fT7m3lNp5U1D1bm1SOI8ZLWc/30TpTiHrUCjbrm PqtJGceE05WHUeHMSjsbew6l+dWmedNFtbrSrKaG6vkafULPUxMhIkJRI6AlXcfEVYcQAM5o6U45 kEbB7jFqhlxiR3DCZtXhvbdoqypfRz+m1uzgxiNAaA1HIkHuTSmTjHdqlvLySiW6WQ8HCtyXaWOo 8a8iDQ5dYDi5Y9zI/wAsvzU1D8s/McWqwPI2k380MXmCwPJxJFFJRHSnKkkQ6Gm42yOWJO45hpjw 8PCRu+t/zs8+aV+Y/k+81DyteJqk9pHaXN81pE8npCOKTkI1JWb0XUghiux3NNzmRhkJEXzpw4g6 fbpZ+1+ek2pw81ktF5qAgcmgHKv0cfpzInsGyOQ2U3tNaeCUB2EUXPeAtUFSdita0IOY5j1LliQT ddajcSmKclql5I4hUjYVJNKDp1yIO/Js46C6LXwY5viCFavOw+Elad/YZbTETrc2n1tqwSAwGckz b+opILAjdhWuVX5dW3xO5DtLFbEzAsXkBaIMpKspNPi6iu++2EbsDK00sr5yZYmLI6SAkLQLxcAi hNeo6ZOUqGzUADuyqwv3fmWZIWg4qrk/EQrbFSQAfoOQ4qpQhop5b+7Waa4+syTsoeQhhRBUAiu1 K+JxlOywAZvpj21qi8QHeOsf1ggLU04UA3FKV+nKzOm0DZEnWIY/3MiiL0+Sw1YKFbtXpX55j5Z9 W+I6hiup+cWsneV7wTvMf3S14qFHdQ253ygxsORGYAeY33mu/wBRdvQD8mBBZlNAO2U8DcTtsgV0 2+vQZLl2PJaJvt9JJx4gGqXmmNpo0Np/dx+ozAci/YjMgy4t0AdzLdK05ljWSSBUdKkInQgdKk0y uR22ciEWRJEQvUqpALgfZr8/bKbbY9Qul4iMhV4txo+9aU613x4WfIPhn/nLXzm1tpui+V7GdVlu phd3pGxKqf3Xeo3qc3XZ2GyZHuec7X1O4iHyTK9vPc2GpD4Y72Fo37gu44mvuG3zMiLjwnofudLx Ditil8PTgkqQty4MSjoVKvU7e/bMjENvc05J0bZ5qEs+u/lro2vW8YnufJl22ia1GT/eWc6+rbGn gDzX2yMDWTgPXcJlL0X5vIbuE3ECtCfUimP7h+6u23Fvnl8ZcJLjyiZCwjbeSaV7bT4W5+gArioP I13pXKyeGy3VdR7npqaeZ4LXTre3k9aYk8IULkkAKi8SDWuYd2TIuQYnhAfS35efk95l1W50+wmt BqM5mS00+3tIzcXdpcyDmqMF2AC1YhjtTrmBnrpyLl4oGrfbX5ff8+7/ADZ5lulOu+ZoLHQ7eZpL rS1hBui5AJjdZSyx1r2FR1wRzA7QG7Tnywxby6vubyL/AM4d6L5Mt/qEen6fBpduhEZt43a6dm6m rOw3+j2IyE9JklvJxv5SiSyS5/5xzttf1DSxrtpqMtjpAaPTXMlpZpbxg1VFjjknJBG1TlMdDIGi GjLqsc9yWU6H+UNl5BnutYuNZsYNQ1RpI5b17cyR2dpGpK2lnboUVQAtXkkZmalDttls8fhRommr Hls3EE/Y8C8w+R/KnnjUZ/KNn5o1LWdUvpDNc+a7uxhS2gKAmKJpfVHCIMSeNPianHK8MyTQ5NmQ iRuQ+39jF/zC8n6T5Q8lr+XGnX1dVgY3LSTURJLZKNLM3EtV72Ujgo6Iqg+OTnIAsZR9Jra3hGhe StR1m9h0+C3qGNJpDuqgnfp9+DHiEzZDgT4hsOb6n0z8qLPStHtEKAyGQPNPJTk7EbknNhDALsNk MYjHilzVD5dS1vlbTkj5BeMzqOtPDM3hoBrlDijdv//V+cGh+YJ7WSX0HlEyKJLsq5DekGUGnc1o BmVIn5shb6F0Lzjba3psmg+YPqaWN8KeX9SfiZ9OnLDlNyLF1qBwfehHauQvh6MyeIWOjy3WNOv/ AC9qk9tqasjx8ltpVUSRzRNTi8bvyHGmwIpvhIoX0SPuYvcsJ+ccZEKFCEkYb0H2qmpNK74Cdlss Qu7R7cvC3Cd3oI7gsfiXehA9+mRs35MTzQtvJMts8MkPJXYmtdxToDTtXCQnnspr+7T96nNFbkFr SgwmNC0EEnk90/I29tI/O2gwXMH1t9Sv47WwtraRIZjI3wxB3mYRpFyb4u56VplGUbFvwjeg/UYa OPLuqtbWmmC+OjfWXke3nIiiu3aMoUZoFhZweRLsxqNydt8cWRv3hvESY2Nr/a+WfzB8n6nZSJq7 3UVy0jRNrkukEpLHc3S8rV55XY+qENVkYUB+GtcmKLAk1QB/s5vIdJ88ecrPWLny7eWzX1417bx6 0iCP6xDFUKhS8ijdl5JtyCmoPeuVZ8HEN3J0uplild7dz0Ge+j0+8lSPklveN6lvGXd5Ig1Xjguv UReMoRgdwK1r8tPnwHHzeqwZ/HjY6c0Sl9TkQ1UkAdQaEAbCvU5iyJHc3Wgr2e1t0ZwvBZKcyOgr 3I3rvkpEyN+TA4jdqUXmK9sbY28VwRCyyRrTYKsob1YyKbq3Ik1w4pULppyQ4o0XnWrX7LczfVwx hVqrbmnALTffsB0pmZLJcXC8OY3Ww+ZYIYuAfjM4K/C1SW3KirAilfbKxbOMpHZN7XV7x47cxwet KFIM4YANQ8gAB2GDiALOMvNHvq7UmiuEKJNxSZW2Y03pWhp4YxycUSerbxnqm+n6/Ha+gykPDUl7 Zl5NGux2JKnYdcjRIpl4ncyCTzJpF2zSBZJl3P1Z5GAqRQUI3FD4HK+GmZkaCdQ32myIkaXX1fgh ZncgFipBoy1PSm1cBka2U5KFMks761WyKyyK6qzeiiGhINSBUHwyicjbaCKsJxBrRCRxwyrHHGF9 aWRqq3HpQ7UyUpitmJgeZQ7edLO1aSKC29QfaHJSrAf63QnK7tsjDhFlIL/zXqWpNIkFujuSE9Sh aiE9CemAgIjI2hIdBu9QY3eoStNKx+Aua0Hh8sqlk6ByscL5sitNL+qBn9JdvgRj0r2OVGpFvFRG /NFehJLIyEsf2eQ2X3G+EwAFsDAE2nlnpvJo+yKByStanxqcibLZAMiW0jKkh+KDqUIP0dcQW0SP cvQA8jyKinwoRQfdvjIg8meyR6hcCCGQ+qF6mR2bpQVJ+gZKEOM005MlRsvx+/NPz0vnfztr11Iw WMXLRaU56elH8CJ7Cn451WHD4UAPm8PqtSMmQsN0sXUtvNZem6ozFrdSekg68T4HJzgOYcWE+YRl 1o+s6pcxi106SaWZY0lUKah2PEDbxIxx9yJGxu9v8s/lZ5n0/wAs+adM1OBZJ/MtkDBp8TBmWW1Y Oknw9WG6/DXrlWoxESjIdC2YpiUeF5Fa/lv568vy3aXWhyXFuxIe2kUgum/7wA0K0zJyY+MAjm04 vSdzzZZon5Y6pFA+vRaZNdpAGZ7Wg9Vdq0I2LEdNhmPMS2BckSiOR3fQXk2e1NvLp+tabBpz0jAk uuEdwBSqlkk4civ+ScvjjjVU4+TJMG7foR+R/wCfN/8AlgdG0Z7Kwn8lSvHHc6pDaRC+tA9VaRpY QHlC1r8R/DNfruzBkjeOVHuZY9QP8p6h3dX6V32oXNibfV4kt9QstSjS70/VrFzHJcQyKGDFTsTu OprnK5Rl05dtpRj1EKBryKOtvzCanCI3TsgZnhkiBdVUD4pKV49PDMjBq587+DTl7LHUD5sC1f8A 5yI0exmutF1a0uLK/wDTke1WeF7fmsVGLx3H7yClDSpYCu2Zh1cpRo724Z0UcU7G32sN83a3qtl5 V0fzHomnXeoeXNVtNSvvMmmR3Re/dZWjYRRwEzRzSbGrK6hQSTttgjjjLZEhRNAbPLta1bS9N8wN axaeJv0AI77SfLFtdGO3qyCSObUCqj1ZKsBRmNKdhmPy5FF83m36cufOvmG7u72ZBq08lLhlPONV QUAWtdgOmRieI0XEnks11fTnkvy3Z2NvFL6aVIBkfapPiTm600Nk7YxZ5pt551RU0tobFlUR9ZFo Knwrmw4QGnJLiDxLTvMV0H9SUHgCRtU7d8kYXu04zs//1vlfMJLWYO9aoeDsNmUdAKHqCBl5UJ/Z X0t1NCQ/oQBgvGqgKEoPbem+TsigkSAG73TS4LbzfoI0Ge4ji1LTkKeXrybivNG3a2mlPIKsgbba obvkRGvSeVs+tvLDzglnsbmL6t6RaiSDi7cagrv3NDiBv8WWxSm9Ec0LQqY1p9grXkq7niW9shsC QxPNLo3tgQpUgKfjoOlO+N0vEh5EDSNyULWhCEb0OO45olI0yDyNqb6B5k0zWLa4FodMuo7qG5eN JlVkYGrJJ8LKFG9cjljxRptxT4Zgl+u5816dq/li8v5/MdtbaZ5qt7RbATJLcyyWDvJLOGWPhVZO NXXueNARmHEWRsfk5Jka3vbnt8lfRv05rHla6vRpdn5Z8qQ6bNZvbpztrnWUWP1fQ+ryB2CKgqoJ Va7k7YBLh2HMlnI3EcXM9Hxn+bOk+ZdCuBoenaA2jXOkWTXPljWo5Ab670ngZI0mPprIZYQpYSNu R0AFMvjvRvn97ikgy5vCdPvvO95dL6stxqlter9YuZUkknWVok58y5Jq6CoO5p0yrPh44ufotT4M vJ6ToGvreJHbySNUbpNutaimwIFf1ZoskOE1T1cMoyRBDKnlieMCT02Vz8NOwr3+eVSJHJNlKb22 LvG0YXiDRqg1KLvTqN698N+mmAOxvmx7ULXnV4aFGQhnAqa71BrtvjCVc2EzcQD0YTew/VmLmMqK 0PHeoI36dMtHqcaQI3HJCwzSQlA0kiyR7jvQ7dK9qZCcSzjwHyTdb24K8frRlRhQxltmJ6/TXI7j ybRAFEwXsyMH4tz7Fj0P8cZSKnHfJPodRuSqvGqBkoShHH4a9utfbKwTfevB0TmHUCwEbsWRm5SA jv74LIOzZGIHNNxqk4iCw1IQA1psT47UpgAr3N8eFO7S9vrlAH2R1o3EkdAKd/HIAbsuIAbpxDZR xRG6vbtRAg5STFzt4A77174koiL3ejaXoyhEcVCn4gBQAg04knvXKMk72boRZELRFHxMAFArx6Cp 6CmVRG7eNm5LVwKyMqKCGRDSnfcmvT6MlE2VJBK0xwqYjGqsztzVePxVHh4e5wy25rHuT+ytX4ys 9ClF2I2Wnc/P54BY3LdEUj1MQkdAFEkJFakdPkK9e1cjzZC6F9ULcSmINwHGNSKNyoOR3O9MANc2 Ive3zb/zkB51h8reSL23S/MWpa6GsrHg/FwWAMj1p4Dj9ObPs7Fc76Op7V1fh4iOpflXLpsrtJxt 68mJMlfHeoNc6Ub83iZSBlae6PqYsWS3vEE6lqqx+0vyOPh1yYjKAXvfl64sporOT6wfSPw+pRiY 2NTRwlTTfqemQhhNlPj2HpFrr11pEojCSyRtCT60xLkKBQslf2fDp75d4RqijxORGz1ixubTzFbt IbZZklj5LA4CuhO3xFdlbaopk6tqM5RYkhv9Ekh9aOC50xH5RTrK1r6MdBUHksiyPtQqKEnoO2GW MDlukTkeqbS/mJ5T1aKOw1+KXU4rZoiss8MUciEnZR8Xy40p75Uccucdm7xBW7PfLep+T0vdHia/ 1bTEuLnhd2v1Nbub0QPiKNHI6A8duTrxHfGslcrQJQvbm+79Y/5yGj0bynpHl7yNaya3pvlCwWWL 9IxwvczqlSYQkVA7KtKlVHSgGa/H2dxknLW5bhqBivw+Z5pb5V/5yEg8yc9R1byzJEJRUPYxyxOs pWpVjKaAbHqMhm9nsM/VD0lsh2vmjtIcQ7not9rn5ceeNJ/Q+q3Nv9bv2ikj0r6wiXNuY1BMkUkZ INNuSmnIZi5Oxc0DcN/g3x7Qxy2OzxzWNC8x/l3d3qWGoLFpsMK3llNDPODJGxSMyBm5hDRiCor7 1zBljI77DbOIIMoboDz7r91oWh2HleS+m8ya5qVnFfeZfN1wiRXyyTL6kNqrcAzxquzFtz02zHyb m65OvyyEY+bDPJDzwX9tcrGCNhIT4V2+7HDxE78nBlxc31/p3mWI6ci28g4lR6y13Jpm9xSFBlxS MdxumUVuNZs5wyMIU3J69MyOHiRj3R2jeQbG8jARgvNjwA+eZUY7NQAsh//X8BazoUE88qwxhPUf lNGsiSqvKpjq60HTb+mZRAUhjln5cuYHKxlFMy+ozcq8AD0oAQad8JHVbtmukpeWU1rbIvJbeRvS l9M1lNasCGHuKfhjK+rYTfJmHmqyh8z+W/0rHZXFx5isJq3MtvCoWS2jFGeRmepaPkFPBfc98qB5 hnIGNdzwYu0VwwUBQw3YqK+G4w7fFiD1KHUTSMyMCXkJIl6dO2DYqaKEvEmKxmJ1YMQryE7so6ih xA3QO5qCVI3hERKivKIuKBSvXZqg/SMQefei7L9JPyM853f5jWmj6XGQz+XYAr2IW3gFwIIjGfRE qPHHHxc+oTQAIO5rmEY8HeHPjuCe59GaJ+Vem/mPf3FjNruoWvlNLpLvU3M0AjgjdEVop5SYyEkU r6UaEl2J2K1IgZiJvqyiRHciyPN5z/zlSPyK0kvdW82uprGmXMUmki3eWXSkmiUqwEmouwk/dx8G 9CL00Zju2W49huNvJp4ufm8P0T8tR518q6RrOiavN+XtnqOvLZ2OiXUclxeaVLcQCRC0iCBpIpqB Y3dQnFieopiMlWCOl/ayMK261bzrzZ+UP5leQY31zWbfT5rSxgiN9PZXSMHHxkyqQf2QhrWle1cx 9ThGSNh2eg1gxyEDyKU6fqbahZrG0g5AIwkrRuzUIzT1wyIeiibPvT6E0DhC3CQUPI8qFunXfKyd 1mDdpY8BARCgZVJYkih5eO2BrICVXVhPK0M8aKI4zz+MlOa9PhNCKjrk9gwogIC600RKHSPkjrQ8 RuU715b7dvHD4nc0ygDzSw2Q4GWAbGoCUpxO+xHUHbbDMg1acczHmrRckMasjJKQKKDSlfEe2UmN uQCSmtqZOXHdiKndQVoOgr1ruMiduTOMrTy0jjZzSgBqXahoNvfK+Kmw0yOztGIDjjKpFOQrQg9K 79chHJ0ZcAZvp8EQWONEJLUHMAkA7dxiQWyhzZ9p9hEycGVHaFgQNiOQ+ySO9DlMiWURfJmNpbOy fGKswqxFQTXsPbIHdujEgImQLGp9SSgHXiaACtBXpXLRHZd1kMJnikCH16EC4Y/3ZFK8OtO+JFck TolGafpsqIzXC85mJ4tXipH8o+jtkQRI03CqpN4oisQchVJUEBakr9ND/HGW2zOMTzQpjMXJuKme feQKT8RHQmu5p2rkAKZHZI7249Li0ob1T0RSCB2FegGTsFqnLZ+XH/OSHnT/ABT52u9MhmEun+Xf 9Fioa8pGNZT0H7Q6eAzp+ztL4WME9Xhe2NX4mQxB5PCoUdY0ZJPTRmPwDqK5s/DoW6QyJ2TGxtY2 lKvCHhf7R6sP8rfJ1spNbM10XUrzQzHKq+vbmb+6LUV6dAaj4Tg4aHmgvoXSZ9P836S1rYIkN78P pxvxR6KKtx9qg7YI+aJGhsm3lq+u7eZ7VZmjaORVRUBaMtSkikVBBA3IyfCBzUnq9Skgt9djaaC4 inMQDtDOQGJPwj4ZAW4n36ZKAqSN3nXmLRbNOFu0X6MulJ9D0no3xjixBoykEeIphlDvZxnw+bEt N/xNoD3EthrH1uJR6atdFox6YIpArxGgVz12pkeADkpPVn+mX3my6Rb++039JRtMJbaS3uYygNAo jD1RgCewXfc1wk8I2KxNbvoXyBffmX521WLSIdB8x2NkZo+FvpoSRzHBRZOB9Xl8XKgDGn6srIER ZLLGOKW279RoZPI3lHy/ommeYNLGmJpoEbz67payPcsRWZvrEsSxhqn7Zf5UAzEE5E7W3CHRKNCm 8p+dJ9YstE8t3B0iKJkk8zysJdE9ZAC0axSuWYo1RyialRWlMsn6ojjpnGU8Z2+Tx38w/wAn72C3 vNY0sJ5hsI5SmovZubuZJq1d3VRyQEU2O/uc0es0GxMG0Thku+b4+t/Mx0XWGghEl1aM5jDWlHlh atAWjalQCDyFQQMwMZ4JUQ4UwRLZ6J5e8+SPez6fdXMJKEN9YtmLIynYUqAa+I7Zt41ICmszldl9 M+X/ADnYW+llYrkT8k+NSRyFevjmRGPDuygQTan5F/Ni2ufNsWgFwiBvtE+/XMgS2toN8W3V/9Dk vn78uxaS3F9olnHaWgcm4sVkL8aLzYNKoC9TtuaD2zJiRV9W6Qp826pHd6NLLHe2nqFkaVKjkrqT vuOlKbkZZEWGikNBrt1eN+5f9xI4eXkPhjrt8TcdloNvE4JDi2SDRt6JpWrQhJbyFkWSPkiKtXZ4 z8Lo9SQVFKVpvtt3yoNw9Qp5j5r8v2mlXzXmnL6+jagTLGHpWJ6/HFTtx6VA+7JUCLYy3LCb6WSW IRMvOKXbYUAYdOm+QpBSgtRXtlNWVQVFaEEnvjG9kg0LQUgHDmzs0itsBvUHainpg3r4sAXpPkHz 1rfleZrLTooUtdZpaa/zSjSWj09S39QEFA9AfhIJIG9Mqyx4t+5thM8u9+wv/OL35b3V1+T3nDWt XZrzW5NYvLqSzku7g2kdtBExtI4bz1m4xEMA8i70Wi8anMOUry+QDsJHhiHhPmfyL5a8/wCqazq1 6dU85ax5RdIb2+EVxc2Gp399AjwW8FOJ+qW6DlWSjN9kKBvmRHJwGh7w1cP8TIfzW/NvSfy18rWu v+dNJ1PVdWuSui6FcaZcWtjbfVkjjaa2aGRJJOEDgIFclw1SSooMrhAkGIogVzYmdHhHXf4vLb7W P8d2Wm/mBOknmfQbaJin5T+V1u7u7trSaHgwvHuVKfu3Hqk8SOJLEdMEedDn9iTKN0Nz3vlW113Q P0t9X0S31K006ZQ8MGqGMzxk7FVeMAOuxoabdMwtVpj9bv8As/WcQ4J/V0ehWs0k0YJozbiNm9ge pHfNdKIBdyDaYxskwPMmNmBVqg/LcU2yLGgFSC0ZOAIAReiA0XrsaGo/DFrEQLaeykLGMEm2lSnA gMQ/vXtjyYmNIFtKL0CxoHaoJG24Nd++MQDswPuQC6I3FY0cl2YsVINT22PfJSNGlEiETaaI0bvx biygEopIJB6EE7E9jlMpAc2UIderKrDTRv6il+7hgQykePYjMckuV0DKba0NaR/BHGSvHiOJrSm/ 9mAmm8RtlNvYzUjdE9L0hzaVTVjSgpShxtfDZZpdpcBojAQ3D7crEAhTuSyha18ATkJc92yMK5sv hEkjROjhbeImOQ8SzOx269vfG4huiLtUu7CtwsLKChIKRCpJIIIpsRse9clxWw+nzTVdPiiH1ZYO KCjinQHwwlAF7JmbZVhHqvv415MfkBQDI3TeIqNxcra+nGzKAFqGY7kEU6LsoHyyJ3bgKCQXlx6h Lo5FQFEi1Csev2djSnXIE1zaZS3eGfm752Xyn5T1S9t3U6jIptdNjIDcrh12JFQfhFTt4ZnaLT+L kEfj8HXdoZ/Bxk978lJbqaW6le9rJdTzGS4kapNSSdya9868DoHz/KQQe+06soBNsp+L9gn/AGsl Gzs0SPpsJkUltpFuaUZNnirQ06EnLTHZB7000+VLuaT1AZI2WhA6D2Hv7480V1ZJa3NzoklrPp00 jzRElgtSyGnVqV+/ISgWJL2/y75k0vzJaGz1mVLPVkYehccmjDmlAr8ampp9oVyXqQ9Ihj1fSgk0 NNOIjC2JnQSxsq7vEHMdKN1BPjkxEEc2cZUyaNl1q25y6asZnjJ5f3TJIDQqtAeXyGIukWw248n+ pdBGT11jYSWltMjtGtDsTWlQT4jHh3VLZ9N1q1urkw6bdG4gdYI/iItvTc7OKNQAEn7PTKzHlsyB DO/IH5i/mt+WWrW195Y1K0WSQPbXl5BGjpJAzkvzF0DQDtQ5GeMSZ3Rsv0+8kf8AOWNpr3knVL/z doq6dc6JbudXt4oWnsryIMIouEfJxxk5U4mnfttmJkhIEN0eveyzy7q3/K0PKGl3/lvy3qH5XxXc ouvLt5o0tuLSUSt6iyPaTEpJGGozgR79jtkhsfVukA0Sd0da6f5m/KLSZbzyv5dk/MPWZbWWTzF5 805zPckr+9bhYuVjAKggAV367ZO/E26dGJh3vljzn5b8rfn/AKFHrmraZo35Za7cs/6E83RmKBLt lrWDV7SAuUYjeoUMCd65ianQQI82mVnZ5Jb/AJX+aPKVdG1fTVN3EnO1vbdhLa3Kb8Jredaq6sBs RlEcJjs1i47MU1Mec9IcpHdS2odyI1UkBh3GW/SNt2FcJspAl95w0bVINY0wTNfwgM87Bm+Edj0y JJl5N9CgbD//0eJ+XvOBhMOneYr6glBhS5RvWQFQUImjKgg+yGlOpzJI8mwStBea/I8uo28txaTp qOlSo31O8SQQuX68TEKbE+BPXDGXRZQ7nzDqlnPpc8sUSvakELcRAtxYoa1f9k0+WT4KF21kgbJx ol/LNGJhGwlt1DQ0BULJyA58lK706ZHhDZGQZbFaWus2jQX8ojmlUqlTxQOoqJFfhyoT1qd8qGxT Mh47qkb2c81lcAeqrkMm9VI7A0Fa+OAmigckkkEUh9aT4VoQx/a26CuI5hgXRqbi4gtpHWKDiWVu hCqKkZM+eyGUWVjwhRnkC2shVw0fEslNxQVBJY7UPTIUkGt365eRfN1xpn/OCeq38d3c3F5ey3tv cMvptMsccXpiORi4CiRnCV2alBtyzAgazSG1bOxzmxDzAYnceefKv5J/l3+X+geUZLTUfOtjoH6R 1+x1OYF9QvJYUuZy4Efw+k/FY057hN6gmoxjju+pXPOyR0HJ+RX5/wD5oeYvPvmc3GsX3qzIWl+r Q1jggLsWdYYhRUDMSx4jc5kygIinD4ggPy2/N3zBoCDSf0vdWRt2aTQ9Tt5pI5bOd6cyhRhtMoCs CDX6BgNE2VB22etyaomtyW2pXOoSnULMxLNYq7HlAvIvNE/7IqalR3P2cJjfmG3DnMDxdz6v/KTy v5B84+T9dl1/8wF8j+cbKdp9CXVYh+hb/ToaKwjuIw88l07FlEYAA2rXNRk08Ykg/Po9Tg1/EI0L GwPeCfLu7yxNoTFK0ckLIwJBEilXU9SGzCMadqaq1WKVoZBE29KDp1HanjkSxBBT5IjIomU0IpUk V8KHEAKI0SijacjzBCnjykWm/gdx44kNRNla9ivFCImkUHqBuPEK2/T54nzZiIKbQ6D9YMMkU6AL HUgjd1p032FMolRbIhH2eiSzOPSuEnELN9YTkV5U6UApuPCuCYADbDYbstsNImjkZXtDsAUkZQAR 277nKJDickGgym30x5WjMRnijV6OIxxLbeLCv3YQCjnzDJ4dKEhgYjgq0K85T8ZH2iwFSdu1MqAP NsiEziiVbgVWkaqAOIC/ETv1H3mmTA33SQm9pAR6jzgF0J4xilAtdt8tMRzDE7clkjtFcUDKI0+J 03FSaBaHAQGcIjn1Vg8jrRivFCWUsByIHucrA33ZFJ7tYm9T4FIP+7uB+Kh6mvTJSG2zPhNMM1We OIDiKEkqCAK9dqjKzZFBqnOg+Dvzi1y78x+YUsYlP6M0kP6Xw0LSGnM9TtnS9n6bw4CXUvE9qazx Z8I5B8leYbD6neSyxBSlx08Qa5tAerpJGi3Y3DpFEscRaZN3PXj92WglpMbKd3zExQylAqSKPVJO +3c5ZRIRW1KFWSJvqSsW68l8PowURyQfcr6dqM1jIWLukj7OF2J2oa+NffHiN7pkL2eoabd6fcxB ItOgW641eNmcmWI9Qjlvgdd9h1yRphye1eTvM4ggSwaJdQ0lyIjFdTSHkhFWiQODwkFQKVr0OMVt 73pMGmXemxy+XbRjYqAJLWZmeVADxdCG367VwwIK33Lr21nVHiFvcK4VZBCFHFkG6p6lKnj4E4Sk BILnUrfRiW1iwa8Vx6lx6kZ+EgkqvEElia02NMgI8qVK9a87eSp7W2Z7A6aLot6a2EweVmB+BT6l VFARXbJUQkS6Jdp/mG91a+ttL8m3GpukEim4sJLVoYkruv1iaKQx8SpJIYbD3yJiCN2Up78XJ+of k7QvMfn/AMtXLad+YWh6Vo8FpFJqUXlC6WW7sU4NHQWy1ZCqNx4DiKjr1Oa2QjE7ndyYTHIMYfyn +WflmOC51D88fO7ylhcyXhuoIoLeRm4WxkWJi8eycfhrWpDZkxyCQrgtEwbuTepeY/yx89yq8vnv /B/mnTVaXTfOF1p1ogu4I0oJLi3gZEu/8hXDP4HGMjHpfkwM4kbppaedL3ybYNp/mbV/Ln5ieUr5 +OntokX6Pa3M1WWdbWVfUhYhvsr8HY4Tijk+nm1mYe6eUPyi8m+aorfXYYl1axugJLO5kQr8BJ2Z T0ZSCDmEYyBoc1EYz3LNdb/JHyqsM7Q6NAp9MqAVBr3yE4StvxwxEv8A/9Lwtpd8NQgVRUxsgaN4 2AdE/ZM0i149amn3ZnWyt6D5c83TaYbfS7nje2zyCORQwROJ3BQgAk9t99sqmK3DKMqTbzn5R07V 7b9N6XGWgcsWsoubKDUty33CnocYytj5vG206ayugJysDg1W1ib1BQDkocgFQfbLeHZA9KYtLdWQ W/CsbpSxUEVjBfY/Cep22B2yg78m2xYCUeZtJt9Qj/TFs7epaopu5nK1CEEL8KjqvTBtXq2R1p5h P6YUuxojArzHj2JGEgiiEV6qSt2kDBgjFDRlY7Fh7DGyRZYSDKba9lNuYIl9YRgcGTein7QAHf3O JsC0g1Rp9wflL+a3kqHyZ+Xv5Ya3pbXsFlruo+afOeqai4gtGNsgfT7N39Vi0PqAMxZRU0G+YWXH OMpS2ranPxzBF90RXxLA/wA6PN2ged49W8xCze3856jqF28uncKWcOlQqiwy21yyRggfDsuxNRxy zHYHucbIKFPzP1q4N7qd3c15rJIeDE7hQaKPuwHmwpKwHjIZSVYGqkbGvjXARspsPffIus2+vWZ0 +eRYdctlH1ZmIVZ17gA7c6bfryAmcZ35MuESek2F9qGl3npJ6iTAeqLaQ8Y0NTVQprxJ8BSuW5YD JGuduRh1MsRu97ev+W/McWr2sbKQtwjETw8tw/sD17nNHm08sUvJ6rR67HmAHVlfKN+cbMFYAE1P EdunatTlEue/JztgnGnXDwuEclhsQoqae2QSQzmKCK8iCyco3UAwzLVWU+9Nj9OEbo4Qm1jYJFCF rTiwBqPhrWpOQksIi06srK3JNAfVi+HkBUH32HTIOQOTI9O0qOhlC/HLTlxJ3+g7ZXKyyDIfqShA Pq5YGgBIFPx9siQ3WTyZJDaCsdFRk2AFagbeHX8cgWUbKYQaYW4h2I4fEHChOO/4e2SrZNlG3VvE jpEqKURS0jcqnkOhZvE+2SFMUNNOsVvwBLMaAkAbEGu3c4CVPNQgiYAyS8DKxDUc1AX8PHIEW2gb qWoTyTfu4TQCgklIAFa7bUPI+AxvZIIjzSC+nVAY3laQxEj1KEFidyTWnT5ZGUuVMjMvMNfaa+ku I7UHhCnKRipND2BYUFTmy7O0nizvoHSdq6wYMR7y+b9Z8qr6uoTCMlo46s4HdjXf7jnTmPC8QJGy T1fGHnhPS1F7dFpwJLk9QKnemCEUZCBTHbJpYCJU3VhRj0r88nVlxybJpNJpkkicqWaSMc+I3GWA 3sx7mrGG8ty0tsPVqoeVCegP0b5GiGWxTCa1+uj6zvGx3YDYeFNvfJi5c14haZWcktvC5LkpEQGk G7U+nCDQLGVWyWz1yOzaC5uS2p6dcuo13SjtyToJEYH4ZB1B8aVxmoAT+bz/AOYPyn1aw1HS9Ym1 Ly9r8ZbR7yR/WjMRILRTqd1kXb7NPHKiWNcVVz6vpjyp+fflzXrbTf02q6beTRelPLA5MTMtAJlb pxp9pW3yYyBTb0u6uvLvmNpIYNRivJIUWW40W1lt3gvE3KtFc8GZa032UjuO+TEgDskSYc9r5XgF 3e+XdM0/ULyEmLUPL+uLDMPTTdks5f7ogU2Zl5VyW55p5JNN+ZGj25kvfLiXHlq7MYgTyzYRC4s5 gh29VE+CorQgg/RlcvMseexY5e/mj5g0Ge2866HYN5Nt409Ce+s7kwtdsy8ipijUEVffidiNjgn6 t5UWRkeiE138/fNvnqwgi1TzLHdW8AVnsINPCvPI7l2mlmbiC2wAHT2yMI1yTxkh2ny32s6NpsR8 7axLYwmcWGlymALavMyyNxHEmhYfRl0RZJOzC2VOPzN8vWL+ZdE1BfN+ixyBZ7dxS6t1UivqwRAL MpHQgfRhlxIq33b/AM4Qf85MomoeYPImt6xa/o+456vafXpmRrWcsiSo5IpCsm32tgw8K5j5IcRs c0AUd36wjUrHVrNCr+gZV5fVp6JJQjYgE/ECNwQaEdDmPMdGyOz/AP/T+Z9nqH1FWWJzFIsgf0kI 77GjUr07dMyiKHNILP7O9iv9PgJVZLkKpMiAgo26/ZoFI3rXtlkfVt0VnnlvzPNpY+rmQPaR/Az3 LAqXYE0jUCo4keGCWIDkm1bXtHs9UtpL/RYYGZnpeFXUScCK+pGJKE7ilKUxB2oqQGCTyR2mnzW0 IcIGMrXUlPVLUDHryrShFBkdrNJO26XNF6MEszma4hBAmiAFDyHJa15AdcqqvJIkwi4sxDdSCWN3 ic/uwRSta7muw+dMle+yDxHfqkl7ZySxeoEP7s0VDuU6UocQAQRaBIxW2c7wxS2SSGKR0DXVB147 gVHj7ZEXyQSS9b/Kzz9D+Xl9e61qvlaLzJZavam0n0+RzGTGrh1o4qQpdRzB6r0od8rnjlPYFshP hHCxz82vN+m6lFqmu2FnDYpqo421rbKyQQSXI9SaKGP7MaqSahQN998d480SNl8o7GvwkA9/DK+q Y7loohH81diD45JejdvI9tKssBMcsR5Kw/hgMQRRZQlw7vV/+Vjm8srX9J27TanagQtONknhH2ed OrL2OU44yhY6LIh6P5W802epKskNLG/J+J1oFPVQpAX7VTsRscvlATG4bMOSWGXFF7pousfpP91d xyW+oW/7q4tnHw8jtUg9AadffNHq9PLCe8PWaHWx1EfMM2sblGLLMCJa8eQ3oa/L2pmNQp2Qq3oW lt60S8XBDdHrUhgehyvlyRyLLLVZvUb95Q9a7FMiSW+JACe200ayAMQrE05HYmnYDBKPVgbZdYFo yvEVUfCwBrXbwxIoNkTfRk0AoR8CudyGrSlf8nIS+bfEhMYndFCrDGtPiIXanz2yB7mQITATxei5 ZOUuy0G4r8j/ABwWzIopBcaiZJOIU0r0IrQ+wWmRMmv3KcNXkaVmcBCQHqAa7/D06++RkU8keA7E ytCSvHgjn7Rp1oD+vAbIbOlIO6b0E/dcHULVihDCp8SCdx4ZKABY1vuwrXtQ/cy1aRiw/ZqXJ6AD xJPbBiuZA6okQAfJP4fKMmn6KIbqMNfXCCa+J2pIw+x81BpnbaHTnDjHm+f9p6s6nMT0Gzx3zToy WuialdBeK/GpPQEgEDMsxPNwH5X+bJUn8zamDvGimNa16k9/45QQL2YSopBBzeQqQNvHoqjCAbYD fZH2pnWQxIBVwaKR1B8fbEMPJWsLyDStSlhvg8to/wANwsJHqUI/YqOow9U3bIoJbVY5Ynb1LR2p aai5EcijcBZU8d9ziTumrVVhkR5I5gvEiqyA1UrsAQw8ckAx5jdSsION7dRF1WCWIghj2pSpwnmp 5KPmW1n1D8r7+G5uGf8AwxfxtY1XdkmJRhUdKVGxyM4swbPveBaXqWqaZOtxYXc1tMv2XQkUHfKO aD3PRNP/ADH8y2vqidLe+9UD4pYVDBgKBwVC7jDyNrScW/5i69c3EKiC1hjXiVjRCU+Eg7hi3Wm4 6ZIStaAZP5z1rWZ7XQdetryW3t2BtNRS0pDH61S/90lACw6kdaYnZAGz1jybcxeffKt75bmkeTUm h9bR1KhU9eMfAvqM3Vhtlt2GINPP/LhS31CWC9PC4ti6fViKgSK3GjVI26+JGS5FJ5c30X5emtrK 3crN9XUjmpNBRG3I9x9GWRNbsHrPkO+uDd3MdmBc2158IWWRl5rsV+JaUo3zOTAB3LG9028uedL/ AELUryzvfL1hcR6rcCON1VORaI0NtOQqkggkqTTCKWRIfR/k38+vMGhv5cOk2Ta7pFrNdxT+XtTl nZtOaNQrwRTAGq1PIABl9sqy4xIWzxz33f/U+XMdv9YcXBdeXD94j12IFenWhzJO43TtTJNJuUgm cmdWjkAD/EaDfYcRTJRNbI6MzhufXAknJlZHVBFGFQkKpArJtvsDt1yXEatY7p7Y6++nyyW8MPH6 tJ6b13jIcgqU4nkepqT9GSl3eTIdU9urC0ubV7+O09a6uNmmjclVqNwE5Cvg22Q2G6y5PPRaXM87 LLGLf1SIo5EqI1p1YrSg+EZXXFzUckNcae8i/V2tvV9H4o5nqy8TXfY1H04TGiKUne2B3NIS8iSN NyqsgUggU2oR7YOGJ2PNjaVpZC9uISpFuHPAsTQDfqadsb7+aplBPf2l99SaP1iB6cYO4Kfyge+C iNwm2D/mhfRjULPQbaRWg0hP9IVKgCaUBmU1pUr/AGZXk3G6Y83nQhZACWPQEjtvlfIM47c0RHbo wkflUJTr38aY80ClFbdi0nFQV6LXqa+GSO+yLXG0YsKrQ9xXw6e2PDsyTnSr6WwuVKyBONAwY7MP CnjgGzIGn0b5O83x3Mxi1OSsrIfRvVp6hUUADAUqcjKAmK6FlizyxS4o8/se66ZdwzScUlKryANQ QWYDlt77jrmh1OA4j3h7HQ6uOeFjmz7TL2VHQOBQAfvFoDXxp0zHraw7AcvNnFrfiMHjKwk3AIIo ymg3Hj9GV7nqxkyG2vkbikgDBjXmR0rvt1yRFjZnCFsq0ueKIlBJ6QcV9Ru/45Ge4bbI2ZxDMjFW EvIqAKqtA1ciNmwC0YZPRQMWYnajDc1rtWuVzN8mwAEUkUl0TK0ayMwJqyvspP68hVthIHMqYuFR Hbkdq0oKb+FBUnHYbI5JpZu8/wDeIjIg5KhqNvfAgit00YpwV2CoE3qp328crkbFsY2x7Ubkxeow X02G/FQAAKVJr3I64AWwkAJh+U+gR+bPNF1q93G8uieVLcXfBvsyXshpbRkCv2TV6EU2zedjaUzn xEcnQ9uaw4sXCOctv1vYdb0oCC7mpukTknxNP4nbOvILxnN8ufn3EfLv5a312w4SShIoz0+OQ7/R SuQnsiRfiRqesG58wTueJjklcSjs3LbbwzDI9TXe6bSuoTlE3JWAog+0or+17jJ1Zq2JIEtkZYAz ScjWYq1V4E1JHbxw9UmJRt7YwXKfWgxinUEoDsS1ageOEjZiDRbsL2KBTa6lVogNyAAans1e2RHm yITJNSFrFLF6Ly2719JR8QVaUFP14ZGjsxondW0W7iYRSTRl5ujv1opPT5gYwKyBIpPtVt/rPkHz m8TFrdJIyvUHkHjJqo8PGuSl+hkNpUHzpploZgTSvxHbKALK3bIfqQhABqKDqd/oyXCi65JnpFhu 0hX4QN2HWpyQiWJPe9w8s6Kuu6Jq/l28hjb61DzsZFO6zqpeFqCtATVT88sEL5rxUWI+SGk03VFt RMYZLeUpJEDQKwJFaDqRh8MVzWQejebdDk03zHaa1Bb25i1mMupJAX1D/echuF5dd8NAigUVxB6X pdrJNZRzXM0cIjgRnt1HGnIE1JrU0IHTbLeVselMy8i3MqgvMzRwxq0ihjxCsSakU7Hv0wiiEF6j feUrXWtJN+bWbTdfmkLR3kUjSW8zLuOYBKo5HQ71Gxy2IB2QlXl3zBZz3v6PZxHrVvQXBjP7yYxM EEhUUDFadRQeOMogbWpD/9WJfnz/AM4Tf4ZXU/O35Mag+s+UrW3kur3yVqJmfW7JVI+KLjGVuYz1 UgCgzLx5o5KjLaX2Fnkjw7H4Pz6hsTeyVtkKPHUSoRRgw6/Dt07jqMNXtW4YEkJiou4rm2+uTuFi BESRkcTQfCNjtv1wk1skxTv6y1ObiMsycSiyEekBsK8qjen7OSqz8WICeWWsvCaOzRiIKtuwI+Pc 8q7Cp+WQnQZbhlEGoxazAbZ7NYJgzbinHiBQH4TtUHucjeyZCmO3sc9hKqGQIZiYTLCrtxbcfF/N WlDhOy1cXl/mWzezeO7jUxJdUdIuhLbctgSPvyHPyYjdJ7GC31FpYfrPpyuKwkmgoelQO9duuEHq VO0bT1L2XRbO5Oqwhm0sGWxunWpL/sKSK8uR8T0rgmTHmu1e986Xkst3fXFzckvLcuzysT3JLHMa XezJoUqhCyqeVacaAdxXJEbbsibHJNLGCOcOOFaVp2A+nG+iBuFNIxHMwqSaUHHt2x6rsN0QXCMf 3Q+H4ix707ZIJB6rZrdJ+MoQb0VfbBTEKthJNE7iO7eKV1Iod+ncE9MiBuyMuj3X8o9cntLp9E1G 7L294xlhuJSXcTcTxFewJoDlOowceM05/Z2p8LKD37V0fVmmzsGWF/3bkfHHIOlN9s5wg2Q9tGdk GmXQyoSQWYUFPGtew/pg5MpjZPba4eNVJ5OFPwBduPscF0nGE/hu+SrKauVG3MUIPt44CbbqI2ZV Z65KEUcmFTQBKHbx3IyiQIbACAmw1G6uKoCJKHoGDdtq+GRO4Utm8aNpBxcuuyiOle2xHfANtmJI RdukkshmkYp3UIKkHxbIcQOzZFkNtRVXrv1NBU03q1OmCRbKV7mX4fsJIoFXbpt8tqnAByvqiIYP rVxxLV5swA5JUGjnoAB1rsKZdjhxGhztryT2t9nfl75Pbyh5M0/Rpk/3K6oV1TzHJUktcSKPTi36 CJaLTO67P0wxYw8B2lq/zGaUr2Gw/Sqa5pokMFmgo07hpAP5V8fmd8zRzdfE0/Oj/n4B5k/w15P0 LRIPgvNVuZSiV+LiiBa08By+/BmoBqJJPN+LwjZJRMwq4YNU771rmATuykQzaDT572F7yymAYp6v H3HUH7skAOiCR8Xadd3DESJGbe4DUE0e1Kd+ORJUlHyXDCSKVqyIxPqypvQe4PTJE7hga70RSK/M yxtVKg8R1YgdzkiL2SNlG2jidGhYP6bkqhB/aPTp0piRuyJJTrSbLggWOZecUgYV2rXrkgK7mBtk OoScPy619DJIkss7epCrAKwDpSoxEeEUV4vU8g8u2izLyb4UqSBT9ZyEedJlbIL+CJApj2DAVHv7 ZLhYh1kZByUKSZKVWlKU7jDHdBei+Wdau7TV7WS0b0Cm7FhtxIoSSemThIHY9ES3Rv5gaI8lxH5+ 04+pZ6jctHrUUacPq9wtACSNuMg3B6ZKUK5c2YlYZvoGoDzboMmieunrWoS406ArRg8aj4Q9Qfio BjC2F8Jtk2iXWpajYwW91cW4j3t4UuZkhFRX7ZLDjsOtcMTWyDzZD5auzaW14J7j6tdBGW1gDrIh Yn7LVB5AjcZOI6per+VNZe0e1iF9Bb2fNojpzOWjdSxB+ECoZiSRTCKI82K78zNBpLpvmXQYEls7 lxaX0qSOJImi+OMowIqHBK0oMlQPvCIl/9aa/l5+dY1a5tPL+teZ7lrLT1+q6Rriw/6Xp/ELGOHp k1iJ2ZSTSlRl08QiBw/Jt8S+b52/5yC/J+a78zz61ocdnpl1q4klstSsKjTdV9PgWmqopHO37agD 4syI1IA35ed+bUduT42WNorifTZrd9Pv4m43K3B4uJF7EGlK9qYmHRBsBfHazw3M6iNVRqCaSgNP iNaV6VJxlQCKtCTTrBN6zt6rl6oGNQKUqD3Nfnkfcz6Mp0vVbjUyotSbN4X/AHjrQBk71JPQHIXc fNU8F0t1dXNuhPMh3Z2Yk8unECtACd/DJAnkxLGNT0832nXELWzx3difgVgF5EgGu9B0+dcPCZe9 lEhg9pZHWYuQpY6rpwqQvwrInUlqUA7ZUB/D1QfJBeerm4nsYvL8blZrLhNfQrsDIFpwPeq1NcjI kmimETdvG2iBKcozVPt/fTbIWyPNpQ4AQKBw3+iuNpslNtPkBeQ8AeP2BTYjDW6DFqZR68hei0Wp BNBtjLZAO6b20UckBcAcgBQDff3wmSyO6kighkenxHxpTApaGnhhX4eS71Pv88NKCmWiax+idSt5 edTAxCh9wD2Kn2O+QG2yetvuDybqUPmiwt7q2YzzW6r9ZUbyAn9oeIP680naGLwpX0L2fZOpOXFR O8WfQRSRBlMbcYGrITUMvUiv3ZrSXaRB69WU6dIjlW9SklfjjPQg967jIyNNsIkHdli2oZUCFeL0 O42B+eViTOJJCd2VnGaDiikiig0IoP1ZXe5bDadxQ0CkH4SSAU7069DgtbsJjHbqGKCMFzU16MQT vXc4yl6mEYlMYaAqqoIx+01a/wDC0GRkapu5C0Qq1b4FEIY1IPVh3rgEt92QPRB6hc/BXknEEgDo 22Sq0Ei7Z9+Rvkq386+djqWqRibRPKNs+pXCvULPdHa3iJ6bbuR7Zu+yNMMk+Lo6LtrWnFiqOxk+ xorcSma4YH94xbc1+EHbrnYfSHhyCxs2X1jVn3+JI2kb/JqaKPuyQjxMidn4R/8APwTzd/iX88ZP KtncGS18j2Mdo9DUfWZf302/tyAOUZz0ax3l8DTR0cCQ0Hf55ipMdmZaNWGGCOOKRxIC5kB+FV8K ZKIKk7snuNOt44o4Y0CTXBqvfeleo36eGWGO3mwBtDXflxx6QR3WaJOTilCBSp+HoQMEsY708VsZ aOaxlaF14yJT95GaowO9SOx+nKiTHklF2976ccwlVRJIftKKimPEtUGVaNDHcXCUHMEJzVPt0G/w jpuPHJUKSZbMi8z2v1b8s7gRwAPfyPLyC1dQZiaEnpsoyc47FgKt5X5ataRwkCnIAUJ35V3FMECb +CNyyTVoSEYxxn91RuQAG46Urkpx2tQxyGRiiysT6pBGxp3yuLI10Zno6NGktweUbFeMTE9u9ctC C9K8t+Yjb2gsrlIry1uAYru2YgRSK+wWQGv0eGTEwRXX9DEh6VoXk/ypaTR6lol5LYh/ifT51Sbl 3KIwpsGG3tkpAVaCl3mWyS1lm5RBA8y3YVxujOSCeI6qxFKdMQLCb33Try9Y3M1tbLayWcV9Mvrx IJIwHJNUDKxBIXotPpw7sQQr+Y7rzJpsml6pCrRz2nBLpbaIL68gp2XdqV7HDQSJPQbDVbXUPVi1 OIyxm1jkurJuUau0zFonKP8AysOoycT0Y8i//9fhP6GNveWt5YtMYzGwltpG5KjJUEq3JeQoKkbd eh65sZxB5IJrm9J0LzDFLa3Whazf26aTelZWtIWKPbXDyUilV2SgB25AHw5bZXKFb9Wdg7B5b558 nz31vd2uu21tb61b+sNE1y0kSVZLcORGZivx1rt8XSpFSMnCRJo8ixkOEWHzXJNc2Ej6RrNtLDdx OAGJHMEkMrKenEjcVOCII5oULvTluYEkeY1DEmQnsQAOvX6BgOPa1HekVlfTaVObaV+cBJ4yFaMU PWg6D6crIMdyyu2YxPdx3dte2amQXArHIKfCSNq7UBFPlhG4tiWS3M0lxcG5luUhR6NPP8UjKOlf AmvSnTDwhkHn/mS60TyjaXWrmYTXsjmHTrcipZ3U1Yg9VTrkZgRFhbvZ5Jo1/PfTtcTyGWe5Y+tK 3xci9SWOUA8RZG6b1rSZLTnMoUwyCqP/AAwgIBYapk2JHfj07YOHvUAFM9L9USERrVlX4VOAblSd kZNC0s6SOqc3qHHWnhUZIhSAutYHeNuEqg+FeJIr0pgKCNtkwazcRxOUHIH4iepH0YQvDXNMLf6v xKSqqchSrb4QbXZJ761jlblBu8XRQOIOMopiN93un5Mebm0XWbW0lnEcd5xguG3+FC1Qad6E7b5h 6nTjNjPk7TsvUeFmj3Hm+6RbrcjnRFkNNwBUk1pTrUeOc0evk9tGVi0ZDp0aoeTL8UgJAFAKfwOQ mTTfEEp9awLGxkkAljNFWLkVANBuNjtmPxCrZQjvt0ZTb+ioQRoqgAcxUV38KnIebZwdU4t4q8uy nckHb7umGMrRKQCuxHxEREch0AptXemHiDCAV43RYwS5ZU2J7g02GVC97bN1jXXLYL8XZzXt3ycB 3sfNJr+fmADEzs4KqiAc9+lBv1O2ZGPGZbDm1ylQ3fef5YeTv8EeR7Swmr+ntaYXmtV29N5VUiKn /Fa0X51zt+ztN4cA8J2pq/HykjkNg9DMSJCzSNxjiXnLTsBvTNpQdXIsRjv7bTNL8w+ab1vTtLKO e6mkanFYbWMsTv22JwAWdk5NgH8tP5jeapvPPnnzf5yuyxn8xatc3qcuvCWRii9TSi0GYOo+qmJ5 U89mQNIqMtR1cZWLUGnpnl6JY7eMstSzKFWoIp3r7ZMDzQTtTJmjF7dsypSCEhbYkiqUNSwpTqMt G55seTp4ntyZePH6ySDEwJrGOlOvXAAL3W0lv7G1uEcqqI7qCIwN+nXrtlZHMFlFgjpNYSNKoH1U GjMdxU9ARlZB7tmyPq2Zb5VfTW1KIsssMEsimWWE8gI+kgC9TUV2rh4gwkdmbfmdqMB8sfVbC4a4 tEZCKJwTj0joDv0qKZZdg2xjdsD8oW8Ztlllg5bAoa8aeJ+eGHNEwU91W1knQScOK8WEidh2HfLZ C2MSOrB5oIuDIknBY9qkePcH2ygx5swyfSZGaFrcty4UZGO9du4yVWEFOLOWO1kYyxcPVHMV6EdO v9MJPq8leu+WDM88jwj1FmiIMu6oqilVB3AI61pkgO5jzXeZUvjeWzpKsXp24RKvzElJCTVu67+G H3HdWtK136nfSwXMLXJiRfRiYJtvTaWvIj/JrTG6KA9l0zzHb69oVtZXMMji3dZFnHE3LBRQoUoR QU333GS5oid2NT6jLYN9Y014XltrsyW7nmf3ESBWZufLYFSRQ0rkgkh//9Dz/DeGxEjyTThL9BJB Z+qYkV2+yplj6lexAzY3tuGPPbuS6AXtzLE84mnup5PSdqj0wG+ym+7AhaiuPBGTIGjbK70R6vpt oiWIsNZtozbNewzKBNCF4rG1FNStNh338cMUSvmHmWoWGneboLrSr61a01iGIJpmrFkhKtCtWR0b jyB7GtQdshEUaJW9rDxWSK/0XUDp+ts0d1ABykJD8gQCPiFVG1MG4+aOY2dPZ6ZJFWGF5WoRDNsB sK7k7D5UP0Y3vvuvJE6BdO6va3blQhZ4OYohoCGWncgEbZWDz6MgyW3UB5o2HO0FWQLUB6gKdh/D JcIW3nn5teXVvtCttUih9GTSTWArVka3eg48iPtBhXIyA4fNF0XiOgXhgI5MB1HEHc5jxJtm9Zt7 ePUrJQ61jMRKP9rf2H45cRbEnuebX1rLZSzQTAExnjxA2+YPfISjbKPNBafJLb3qy7sJKKppsMJj VMhTJL5FKpdB6jkOcXQgYGN72hI4jE/qIP3aryoSCTy9uuC01vsihN9ZgcKpEsW6gmnTvtgKaUo+ U8brWoWu1KmvjkfchTMs8ToUIJhPfeoP9MNd5Um9k70+6ntLiO9tmVWb4ZR1BWtemSG/VkCboP0O /LzWj5i8vafeLL600CpBdkmhLqAKgAHrSuc5r8PBkNci912TqBmxXfLZ63ZCQjnxA5mhjPWg8a9s 1pFdXdAimV2MLCikqh405UqN+wplVARRdp7DZxekSyoWUfE9DSp+Z2yNMrRBjhUqFHwv3PQZICmq RsrfUVGHMca7IadAMB2bAFNpZHICER13LEbGnWuDcs6Qs0qQpRX5SkkUHz8MlGNtEjV29X/IjyP/ AIu882t7eRq+keW+N9qLOw4eqKmBCp+IlmXlTpQZvezdLxS4qdF2vquDFQ5l9yT0u7uSfj8CkiMf 5+OdhjjQeNkb6JV5mnkstN+owrW8vaBj/KWNAPfrkgQDvyYgW+Wf+cyvNS/lt/zjH5z9C4EWoa7b QeX9PIqGZ748ZWFP+Klc43e4WX1P5wBEjUkahJNeIzXy2LG7KCtozNeCKEhvUkCA9dz77YDyTT02 O3jMZURVktwFV1HMFxtU4RQUsr0eOW3t1tWgiuFkJdm4gOin7R7GtOmWix1YVuoa16UvopDI8nNl ETigIA6gU64TyUb8kum+qL9WhoIphQ8m2JI6ZWD8U2lGr8JrdxBBHcSCvLktAG7GnemJB6GljzSP 6rcWNxpV1aSGNoCityQrWQEFj8I6VNK5UY70zBsEMm/NFDaQXGmrcTO8dzHRuqEitaV3oK0GXS5N cTZSvylEBZrxnoafEXFQDvU0odtscZ2WSe3pkovQSFT6r12J6/diSQbREMPvwjMzRpyj4HamwIyG QeoFkA1pFykIpNU1NTTb4eg3NcA5oINp6Y1nSUer8CAfASakddiMnRRVPUvKTsJFRpqQXCVdVZqk lStaLsOvfJwNnmgkMn1rmNR05ol4QRRr6F07mgfnWjKa7ZZxFelJDptto2qX97dXU/oX5qbd4eYU uOrMTQUNeoORoWoCc6Tp2r6XKZbW5jDMjSTicpJE+xIDKTtUDc7UwyIqmJply6BO1u0YmUTWcdJn jqsTKzEyekdtq9MMSKUv/9Hyraa1JYXOn6NqMKFFjkFpOZKiQkMaFBuHr0HSmbGpSFgsREMlXUZJ rf6yGM0VsvAwq7BjGN1dQK7qRTCQClFWWqUljS8jgZJQkkE7S1WqnmjJypRlPsMSbTar5x02bVFg 8wWVstzr+ns7axbW9QJYCFBlWNUPIr1YA+/bCIg86tjTynWYLbzbYm1uDbh4SDp94vJeBpwCsKgM pagr1ByIBApZDZ5JqCarp10tlqEHCa3baEKFjrxpXYUNVO9MhIEUeiQRStaW4mtFed47fg7NFcc6 srrT4VTc1avXATa3TN7NpLkRtZcjJFxDRDoylaNy5UA37Vxj3FBK65tIr6yaGaBrlLMMs9ryLK8U 3wsqgLQEfFv2yPDV0l8i63ph0bWbm1VZYII5DJZ+pSrRNutaVHQ5RIUyDPvKmr+jAYJKNIFJtWpy HOu1R0+/JRkQd15Jt5htLjUbY6i0UZu03nMSBEZaUPQDcZKW4qkw22ebzxzmLmhCyRGv0E5WdjXk kc06hdbvTyyqoZVIkbqSQPDAAxkKXvAvoWMqgMpDKzdGBHb5Y0ExlQpECzjFWR/iK8mA6DwriTTK 7QssMltMZImCpIvxd6H6KZGwgGuakJeBKlOPIHetSa98jXeqHhkljlKNIShFK9AMsIFMue4fV35A +cI4dTPl6+lAjv142rEkfvVI4gHrU9Mwe0NP4kOIcw7nsXUeFmEehfc9nCFjTk/HiPtVNakdOvtn MziOT3AFFltoBGioH3HVT296ntlZ2bBRCYggoAKs4FG47KT2xLEmuSsvxMKsW+GhU/s++R3tjAG+ Sk0tZeEdQw25tQg/KuT5tkRWyySIycq1YdOQ7e9BhiN6YmTEPOXmHSfJWiXGv6qpuePGDT9NjBaa +vJfhgtoVAJLSPQdNq5kYcXHKh1cLLk2fpB+Snkq78gfljo1hqyKfOOvx/pXzhKh5lb67VWNurHc Jbx8YlA22PvnZaPB4cQHidfqDlyHuGz1qztVjDSuAqw7kfzP1/DNi60ksFST9N+ZwtOcGnKZGHX4 jsuRnuKZxFPzB/5+jecFltfyy/Le0dHnnmu/MGoRA/7riAtoK+NWL0wTPpPm18935BHThHA5kQ8l ACKOm+YpGyLUtKtp47uaaG3+K3j+FmAKhjtWhr0yALKq3LKbIS/upSpjCkMTy+At1J+/JGkdWcaS xk9W8WrGSvAE/wAo3II8Pll8eSLopNdc7dHldXjUisbMCaOa/D7ZXK7RVbpBaWt5fAuX5HmKFhv1 rtXfEb30T0JZfZWqSgrKgkZFB4k0bkOrGop0yYixVRo0ceppdGRzb2EYu7k81BQK4oqg8gxJptgn Ctwniphf5gyzXsGlervLNNK8kmxqFNakde+QluAoVNCtzbR/uwVbjVY/s7V/hiB0UkFNb+ORIY+T AsXqVYirU6fDTfJkbboYjfWztwZXUxyPwKVoTUdaDKyDzKb2S2JU9QLwIkjJUJStVHf3pgra0hkl nc/6FzaoEYCuBsSetaYjkgmmeaNRngmiZJECbMCUIA3oKVqckBwsBum+u3Ppx6dfTSzj07aR95Fj IKyEUQj/AFu4yyOw36pEbKf6JqMc+hC2m1GG4gKK/G5BaeGoqIy3EkAdQclAgi7Qdkmv9PntHVqL cShBJA8VwQsqyD7LHYsOFajIG7WwWX6PrLXhWS5kaaKZeKIr0JAFVDnensD3yQuPNIoP/9Lx19Rt XDQTyx3NtclFWailoup5r8PI8um5O/fNoPTt0YWUIdVureU2UkM8scjObO8dOCAVoAC1DxqamnXI xibsDYp5p9Z/u440u4leeMNyMhdw5oCKKSfhHamA2east8s6hNNI8cd36ci1aGP1DGFD1qC7Bm6b EUpvkbHFbLolv5g+Xf0dGuqWdrb2FtHH62rWlsQzIWr6bqlCFViB0G2T5hgC8/uYIfM2nhllWPV7 Yqba7npQqoAA4rWtenQZHeQplTzNIkt7hYdR5xurkXRj+GjVpyLkbfLvkZWAu/ROtK1KeONoDbs5 gLMsfHck9XcDc/CO5wb0E2zKNhc263V3ekTQLyhiiYx1iPUfBhBthVCnhP5vaBb/AOg6zp8FYaBJ 2RuShTUpyNBTbbIZYXGwyge95Tp+oyQMGB4lWBRBXbKvJnVvXNL1O5vbUxNMHDAqIWJrvtQU8clE k7Kd2Ja9p0mnzt6aVhkPOIkUDL4b+ByJjQtjE96UWMyw3v7w0juAFI6AMciAWR3TpIytpKxDMIZK oB0pTc74K6qERa2/J4poweLAcgat8PjQUw8IQDSLksHmnZIiFgZtw4ofh3rT3wCii+9LrnS5i9FW MCL7TAGtPHDIXzZiQQP1Ek1cjcbN25YEhkHlq9OlaxY3C3LWzxTRmKXlQBlNeRJB2xI4hTPHkMJA jo/VPyxrNvrmjafqMfGcXUCtK6moVuhAp71pnIavGceQxfRdBmGfEMndsz20WMoEMbyAigbtUe2Y tOZx79yaBKllEbADapoPpyRqkgWVSNFlZV5AAdRXentkYMgSLTCKGqAIisvSrUr+vJmJG7Amylet 6vYeXrS4vr6cQWtvGzMTSrAb0yyILVM0lX/OJHk+5/5yB/OO6/N3zNAJvy+/KSQjyVoslfRvNXeq LOyHaluPiJ/mpnRaHTgPNdrarhHCDzfrd6BuLlzHQKTvN4Du301pm/jsHmJzQHmO7Sy01xCKBVKI Ola7VyyPNgBZYl5KtHTT7rUpP7y/lYoT04R/Cv3muA82cqi/n+/5zL87L59/5yK87XcMn1rT/Lbw +XtMPL4QLBKTlabbzM/TIZpekDuaoj0vk26dJJZEVyvofCEbx8fozH3UC0VYoUUyR/EYxylIbep6 eGRIU7bJrZWUtwwVOEU1wCQpJpQb1P0dcJo7IItkmgQyNDI4PBmJoiEE8R0BA7V3y6HOu5iRaXa0 JpyYXuFPEAIApFKbEVI3qQeuMjYtMR3taN8NvICREZGCxTHselKio/DALI2CmkwgvZYt25XJj3JB BFFG4HStcSaXmj57tbi0s9PhmYux+s3aueRDODwjG1fhUZKG5QXmfmaKb9L6bb8GdIgSARRqNTrT 3yE47pDMlhijt7eRnBISoDIRyIFTuK08MkKYg7JVqcjKsXrQBTIABKrEjj9NciSRskAhLTwltFkj CB5zQsh3FD1pTGIPVa3SCBSt3I5NaMSjE7fLKSN2SdiBnhCIF3HxVYA9N6Ya4uqKZfoNlcRRWSiZ SzNzhB+HkAab7dqd8viNqYllHni3e00O3mmZgsrFFVfji4yUJoabGq+OGhVKGM3MEj6SjWU8yyi3 QH1Kgtxptt2oOuR4LFJBUG8y3UAs5L2BEZJVBuCtAUIoxAFdj1wAkfBTG3pvlq8hggRDbo5ZgEdR 8EgBZE57A1oQa1+jLIyvm18ub//T8d273em3uoQ6nGLLU7IATWULK4RJBVHjmViGikP2W9/HbNiR R7x3sNjyW6tLFc2dnc8rjUBGzfUo1JDmR2CmJgw5UBAFBhj7kGxKghLXWdQNre8nRZ2i9OLlGtQq uq0q9OLVanEeG+DipkUjgvr2ORnd2WVnaJgzU7lagCla0wGN7pG70TQ9Uuag3MaSC7iW3v7aRgVY MvD4JGBKk9AD3xJr3qQCKY35g0OfyprYRpmm0y+j+sWBDBmUNUGNuH2XB7VOSkKohAK+7s7DW4LZ Ijw1MEBgEUiSFQSEY8j8Qr1oK5UTexRW9vPbz61aTCEQtDdBqzXHxcxy6JxIBBoKdxlkogbDkkGr TTSAdPEZkuI6GrgqasORpuT1FewFchyKSqebrK51SwuYiF9HUYBDGWUKhYkmux2JZfDDIbUOqC+P 5YLizvLm3nR45InZGSvQjbrmLI8J82y9mW6JqEkE0aFzCFYHkNwT0GIK9HpzwW2t6VNaq3qXkaco pfidhTcqR8stEgRTA/VfR5Re2hgDQSrxlhIABry270ysxNllbI7ApJaywylmW4QFFG/xeBwAJJtQ hne35KWdo4fgqpPFT4CvXEDv5KE9sdQtWdEnapNakVJJpsuJpCOFnMfW9VKI2/On2fAe+I50ji2S J7V4Yp41oWDclB2qD13OMhWzO9mPyPJX1uABhoCpPcdadsjyFJEgH2//AM42+dUvdMn8vkP69ufW hUvVgo+11psOtM1PamnMwJjo9J7P6sxmYHkfvfZdhMx3FU23Vj+o+4r92c9IdHsgIk2yOJGl+Mrs erV24+G+LIyj3JvbQRirAInuPAZIhgZUhNU1e00m0a4kP92NxWu+Wwx3zapy4d3xL588xa7+annL Svy68ss3q6xP6d1NHUpDbg1llbfbitT77eObHS6ezv0dXn1NP3D/AOcbPIul/l/+V9voWi2iwWtu y28dR8T+mg5Mx7szsWJ8c6DSxp5PtDJc3uFxMttGbOL+9IBmYfqzOdfV7l5X551AsltYQt+8kcbA 1qSeKj7zk482yI3U/wAzfNVr+Vn5SeavNcroI/KmhXN3DG3wh544iIkr/lSkffggLq+rTKyafy56 heXOp3t5f3UxlvLuV7y9uBX95LMxkkf6XbMfJzNqdyUob4yHK7s1Wau5B75Hi6I6K86W5iWS3kIZ 2oVcbfD2JFMjdlAKON3PFJHxkKmFDCZIfiJUihr7UOJSCyXRdRs7dHR5peT/ANwo3BIp1B6A+2TB rcsSjL+WIl29Bi3EBfTHFat3rv0y3hobLySuGVYWSJ2Duw2jOwU77kjvkDJaZDaaUl1PGtz9XSIA PqEskhQJCgBLhl2oa9OuSIB5MTJbHGLq8luQoJdjIpZh9lNlpsD0GGClgutIZvMkbRco3hRYyS1d +pI9j2yBNswy2Fj9U4IaDgRybblx3J3Pc7ZI2xLG9UX1FWOV2CxkM7qRTiB2yJqt0jYsft7qNpJI C3pxxVIoKVyI5MpeSBCJDdhPUVUZuRYmo36GvvjMjqokaZFxjEQWoZnlBDqN1AG9D3r2xEtkWybT LmGK7ozqSydJVIGwHetQdu2MCirZn519G/8AKNrJCkzMnomBHYA035fDTagG+WE2Fo8kptHkvNFt vQiZWiQcYjTiyAkcamvQYUXu8u8zX80ttGHi9D0HIXam1aDp4ZRKVbBIerfl/KbrSy7S0Kxg3MLD kHLABSpBAqPwy2N1bE83/9TyPpN5/iXTLezu5Daa9aVl8qa26hgopxMFxXkpikIpQr8J+IZsIkfx cujEgA7cjzSCHUbiS2jitWRZjMY76GUh3imRv3gNeJU1JFaUyUOKRJ6MqpDXVpLo119UvkD21y/r +uQs5EjN1V1oVDdaCmCcaPO2HTZfJAZudxbF39JfRAmqCo2cUBAFKjam/wA8AJpI2bj1G4eNxcNG FkVkdAQ0jKAtVop6g7AnBYAs96aZyNX03VPK76bqUdsbdGH1G+aICeF2aoag6gnY/PDxdQxP1WHl cGo3djdz2U8phRWUGH4VA49a7g1AIIwdbpTuy27tdK1+OGIl4b0rG1rdNQA0X41YK3Q9QxxiaimT zy49XTp5CymfhIq1PEgGp2Hbf2wT2N9F5ptZX0cqs88XqCfjGxqRSnQkAgVqfDIxknm8L/MjSktd Th1C3av16IPJ/kup4kEDxC1yGXlssO5gFtKwYOw9U1BMY2rlNthp6x5avQtJhxV1I5EfsjoSaUrt l0SBzQaqkX5o0SOWEapbxGR4j/pJruUNACPHc4ZUeTWCw7Sr0Q8oHoxElVB6mnYH2yA2tmQAmt5c iS4PqIApUEFU4g1G59/owAd6qS2wlKvGwUg8lBNCw8KAZPg2tY0nNtcRidVumAUmlV/ZqcAkBdJM WR3emW97bmW3dY0HXk3NuXTjsB169cY1IXSOW7D59Ki5yx8Wc8QfavemQrdINl6V+SHna8/LP8xv Lev2yRSDS9QWaezuVDwTwtVJoZUIPJXjYoR9PXARYILbgkYyBBov6BLr8pvyt/NXT7PXfJL/AOBt V1S2jvbWKBSbCZZkDKDbg8RQHrFT5Zh5tFiz8xv+l6LTds58ArJ6o/a+aPOPkXzj+XN2sPmTTHgs 5pOFjq0LieyuNqgLIKcT/ksAa1GanUdnSx78w9Dpu0MWp+g79zF31gRxcndVUAlmHQD3OYkYA83I lK3y9+cP5kfo6zms7eQi4mUhFUgkVHU0PbMrHjtxM2V7x/ziH+TV3omn3P5geY7Yt5k8zqrRJJu1 vaOeUa7jZpNmNPbN1ixVF0WfJxTfsp5NsxpXlXSrcfCXQ3M9djV/i7/RmdhFB0OqnxZCiXUASzH7 b7nx65kx3aSDTyJYDqvnO0jb447R2uG22+DpX6aZKRZjYPlP/n5Z5yby9+S+heULObhd+fNegguY x1az09Tcyqf8kv6YOGJoE9zQDRvyfhTMBJM4chClTIK7HvUZiSPRj5pbFwa6b00+CBKyDqPh2rib G6bpSAt5I3QmVJC3KGReLJyO55Dw8MRIlOxX2yS8/TL/ALySnI/YIHzxpBTCF0huLSOYI0XMK7na gJoem5xGxWnpkdvpcyww/WnjUo0kjP0Y9FFQNsybsWGAtjdxDH+kA1Y5KAcGUlGK9/u8cqIs7M7T jUL2S30eVEQf7kV+pWkskXxLGHDTkS7Fjso6UoTh6sZKNrBxtlmW4mk+A0mCkMQBvUN2phBNIG7F JbP1tUkvQ3qI8irxBP2V77fhkTAjkmwy17SY2yzTAyQsOPrg7jam42G+SGzGiwK/En1V+HBj3qew qKDfIGJG5ZAJfbMbRUX0oXeb7DuoYgHbavfADSEJJbqhDFevxHlsB7d8jLfdlad2Crc23pShEYVZ JQdgD+zv4ZKrRTrOYmaP99VmqtDUE7061/VgtL0zXWvLjyzNbXCCeeNoyju9CqA/Eak77ZIgndEU vGsazYafDAul25t4o+BkJ5VqBuxBp28MnvSARbyvzRqstysSS20FoiM3qSRg1dj+0ff5DKZybAA9 H/LXU0t1EE8bfVxKDcToA0lApZFVTSm/U9clhJapDd//1fB0d9eaRLFbTuslq6qsc32ach8YqwU0 38a+GbCQ3QNyz/kLrRrXWdNS3utWEfDV+FEEkIbgs3AhizIAOXfv2xEuYQOfkhp7BrmweTUoGBVh KiK/GN3H92HaoqdwQK5I7Cwp5pXcTctNZoVjgkgiKMyngSUoSOLEioFADX3xiRIhTbBLq5t+QuJ5 GaR+AKo3EGFXUUHFeJJpStd8okdmYCY2Gr21w13bW7mC1TlHAXFBwYcd61IoOmShLdBOyN1i0S+t 9P1u3KrdWsUdtqTLHWQELyWRzU168a07ZYDt5sAN1ukXEm0c0g4hQE4IKKxJG60BNBvkSKFsjyTe 9trPWbSBLzlDeWIIDMlDxJ2LhGFdj4YQQAuzGjYPazPbTRksW4lgCpLV3dK9qeOAwrdjaT+btDGq aJekQQi6sUE5kU0LCP4WpWm9GBp7YDGwUxNSfMskUlvOp5BN9i3vmMa5M6ZLpV9HZXERMrMs2x2o p32rjE7Mjb2PR7r6zAY5WEoTaIJx+NN+StsdtvDLhZLVIWfJ5x5i0kaRqMhCvHY3g9SxLDY16qCO 4ORygbM4HdFSG0mt7CVTM0ijjJUDirD9n6crK8ynulxLIeQ4M6AgKdq17UyweRXkvv4rQNLFEyvu BHKo4/F9PvkK3qkA0mOli7igWC5V1ZwAGIBoD0IrXpktgKCdyjI9ORWuLrgZxGGR0KmgPckildsP DZCkpXNps8Xp30KpaSQEtUtR2KmhUdqnrkav3s8b9pf+cQ/zAk8z/lFpIeZprryrK2mTMac0RAHh IINacTQV8Mx52Jubj3iLfb+neadK1nTZtG83WEGvaZMClxDexrKAHBB5Ajc0JoevvlgmCKLMXA8U DReI/md/zijYeZNGvdW/KHXRp99wMkHlrUGMtpIwqxSGcfvIzv8ACGBGY89HjyctnY6ftucDw5dx 3vzm/KX/AJxj/Mj8w/zJlv8Az35L1nSdP8t3xjk0jULSSJru8havp/vAFMUZFSwND2yOn0UoSNuX qNZCtiN/x837FeVPysl02OzfVGhgt4aE2cJDyNQU4sR8K+FM2EYOknqokGju9olJJWFQFjQD92Og A6L9GXxAAcAnmUl125+q2Usn2eKnf6OmWAIjZefeQYnvdZ1bVHXkFKwROTttVm/WMiWzJdPyJ/5+ XedG1386/Lvk6FhJa+QdASW5AHIC51RvVcU8RGiVwkng26uMNwfMvzUuJuCtOIZC5qoJBpSuwrX8 Mp3rdVXS0jdHaVGiFySeYHUL1+45HlS01HDDDPNcLIxKFVjVgGVwPGhx5k7JB72yip6jzAOeLNyU 1qRt07ZCiDukm0oS7JnLfbWIgiopSpx2Rb0XSbyW6RTFb+q7UjeKMBQ6caE16Vy+MtqY8ij7j0Ed pTE0Vxt6qBSrlCxJCgbHYHqOuG6SgdZkuZbyxgaYzw2FuURmavFpKO3Kn7W1DTBFBTya6uWsnQyp I3pIqoxI48TTr7jLCLLHYMZsxOkXqBmWKSQlApIVgDUjqcrMt+ezKkfJc/6K8MhdxzJJBIBG9BQk 7eGA7DZG7zfWLueN2jRZViC1CHv7ZAyIDJQt2FybIiN+TrSp2UMD0riBfRU19DlIYmQu4PFwTTYd 8E9xR2QJW6Bn4rbj4VaQENSvTrU+GHhopRdw4t+LegswpTmu+wPQdMF9AgC9nplzdHUfKN05i5yL AH4FgyqUYbUINCQNqb5YLoBjxAGkvtLlLizt/ViitYpwiiYuAOY61Xrth4u9ls8v85RwLOn1ad5W HLiSKKKU71yjKbDIIzyVfWyXELPK54NVwR8RavSh2p2rk8UCd2EjT//W8YeZNLRo7aOIwENxWKIE 8mB99w1QNq982kh3MIyo7oXRb46Vqb3NpW1tQhQwEB1YunGWhck/ESQVNcpAoi+jK2WXF+9tCk9t KLh7kLJbRcjKyDaN4nDbCoBG3TJAi7UMaIinF/ZBJJBMFcXT8vSRzQMqrSvw8uvcYIndaYpeaZC0 ZJILW7pHIvBmqOpIoDQbioyPCK5qCwe/vJ9LvFWIopDBXjalaqKGtRv92UpBekeULyG5WaG5CyQX cTwSxsWZaNvyGw3rlgJJtBAASmWOTTb64s5ZUZraRleWNVYjgNmUsa7joMtlJRyTOPUJRezCRTMx QvWVwEZR22O+3bIiXRiD0RF5OL0B5mZHMa+jJCGC71+GjdaVqTXJAkBO9r5NPdo15Ri4t50ZJiCT 8TAgGngcJFo2fMXmrSDp11dW8qFHhc027HcdcxpxpmNmPW5oIqji0YBBO/3ZWebIF6LoGsR2qpJ6 YkmKEKV2K16mg75OMijyZbdWlt5i0+bTy/pXK1ms5DUnmCPhI3IGXA2KKKrkwu3sbhrR4njKyWkg 9UOQpVieu3XKxtzUHqiUt4Y5EBvOBLFmCjw964CBzDL6hbIPWiinU26s6gq7SBQat3O+Mb70Sj1Z L5c0PXPNOpLpXlzSL/W9TcB47axhaZxT9ohQeI+ZGRkQBua87ZxjLo9D1z8lfzj8sabNqfmHyFrt hpCl3m1AwCREApuxjaTiN/2gKZCE4yNiQPxR4Zu+rzaK2jmtkkknRFVKyvI4YUp4bddtsIJPJiQQ fN92f84M639U1/zv5Zgbhb3lpDewQNQcjBJxYjxHFwOuRy8w5eC6o9H6Pxzz27VRQwJ6nqK+IyBD kgMi0vXta06RZNHnktZXUB4VoyPt3Ugg4BfRZAHm9t0DW/NfmBFtr+2s4Ygo9WXlLVgPCLkR95zJ xxkRu4sxGPJ6AUhs1BP7yenGMnp9AG2ZIjTTZkEGEO7M9O9e/wBOSRTznzxqHpwmFXryBPH5d8nb OATjyBpzWmhwuyCOS4JnkLmgo+9SfACmVschIfzUfn55yfz3+ev5seajcl4NW8wXcNhMCzgQWrC3 hC0JABWPamOYbgDoGsigKeMXtyyRejMnMkijfzbbCmVCJLE81S1upre0CSBAIEKBmVfgDGp2pvU4 Mg4SBaVlysSWkMoghaql3SKqnc9SK/Tk5gjqgsYniDwyTQyMlDQIa9Se2+UyPEz6BCo8sAZ5I2JY U2HVfngA2Q9G8oFYo5SZiGjj5+mR9onYGv8Ak5ZE0iYZQBNLfQ3jhnjt6TSTOxQARryAJqCQQDtl p3FVzQDa3TZIbl551iR7q5cs8c1SCXNaqOW2xHU4Y8I26sa702vLOSNbyFVKTrbmSoWqtwBNR4UI yR33U0WDWzhrSJWnIctzICgVIoaD55RwxumVUrX7xzM0hfnHwUEmqb9xQHDKurHd575gj+KFo5ax VLEEmo/HIEWyAKHtSZJIBShJ2BJoPbr3xhRG7IjdP2iSdpmSZkdaIrcgT71wmV7MQi7SUQ3UsZFY goBI6A+1QSclzkEnyVrnj6ToGRhMSVU7UB7jbudsiQLBWmcaXGsehzQ8C/qofiZqKeIbqCe3bJmQ Y9Ugk0qCa1tpredZWoA8ZagRm8aHufbCYRKxedeYI/3s8bS8pIkYVH2dvfKZ866JA3VvJkEV3crF HKwmCfvGZa0PgOnXHGSCpf/X8k2V3bXBtInWjqWkhklcGPnxPwGlAux6HNgGuLE9Rqzy2zOwuQGe 4krwDmuxXjQUHfGYNbpiSE+8vyW17avaXchRdL5Ti6WgL0IMqhwKiqmlMECLP2MkDrTxNcNHp8jk SMERQw9QIzcqs3idh0rTbHiB2WkLftuY4mZFdSXuSGUepRi6kjc0Y06YTEFDxbzByinBdU9WNiWD NXdt6E9T9OUS2ZxLIPLk0U8LsxaFol/3o5MoQbAbjp18clHc0mXk9B11bGa103VFlT0JI1trieLk TJcIOSyOHNAOOxGWA2K7mvrslhmtJTarBWOSP4qSlUQVNCS1KUII3wAAclpMEjuIIJCgiknjkjKR OfjFfUb1FJFGWlB164mJCg9CnCXcawxcnaa0Vw9nIOJBirQg8dzu3Y4ao7JeOfmPY29xqK3dpG/C 9g/eAfEqvHtsTlc9xa28Pa2kgldHBB6Abnfrv4ZTRItmCOqb6byicDjyAIrvv18dsO6AO56pob28 SwyyS7w/EIl+0xO1AR860Jy2BBQQQnPmfR2vLGPWrGwMbwBotVhpT4T9iWnQ9DyA6YZgyG1bLE0d 2E2TWkkVVVBNExXn0UnYg+2VdE0aT+39e4u9O0bTlimv9TuYbO16Gstw6oo+VWyM8nhxMjyDZhxH JIDo/dbyX5B8rfkL5U0nyzYxejO7W8OvatHC0lzqGpTkIzytGhNC9QtfhQbZzsch1HrmL7u5zuCi B0fYFsEjaPy7feXLy2EmlpeDWp1hNnMZG4mDZi3NaVIZKU77UydyxUaq0iImL834Yf8AOZH5caN+ WP5pxXnly2TS9H8720mpW9pCgEdrdRS+ldpGq7KrsVkA6CubnBl4oDvvdwZxolhn/OKnmSbQvz/8 gySqHstdvl0q8Z5Aqql8Gi/eAAniHKnplhj6SnCbNv39l/LvVGkoLGyRRXlKZWLbdDw4Db6cmMXJ v8eJ2T3SPIDWzo1/PAGU1C2wKivatd8vjCIa5Ze5nHGDTYljt1Bl6J7e+Stq+o7rIBPLWWZqkigr 0whJHcqzuIInfkOmSQXhPmAzapqcMcR4tdTCMJ1+FmFflthJ2ptjyTv85vOEf5afkj+YPmlH9CbS NCuVsGLBf9ImQwQqCe4ZwdsRVhx5Gy/lujKGV7kzO8z1lneSp/eOSx6dak5UTVljLmg7yd3uYA4Z 1jo8/Mdh0rSmRuwgAJkZIrqFFjJR5QPTbip4npxJ8D45EgSKULfW78JEhkH7kKr1IBJI6U8BlhFj cqkU4McSxAF5UDNwH2anKhsVvoozJMi8ADQLRh2rSuCkyZN5cuobe7jDylBJxidwOQAqCTx7/Rlk US5M7vDBHYXN5JbQmW+mFrA8bGkiUBcsNqHalB45YObEqmn28MZgM6GNaO8gFTUjapAI37fLJEbb BG7vNRh9J5rF5VBjAMhorcGAqtAxOx9siQa5rVsLtUdbYyRfHwcBIm6AU8a+OQDMolncRC4lhBYx gemQOtd8BPCh51qrtI5YwlVDGo67+2Rn6uSQV+nTKPRUwDkKkcq1OR2paRkMvJJSI+J5fEQa0Jyd g7hQmT3MMwYc2haJV4uaVr+0O3fASeSo29LNZ25SKP1kPxlRQ9a7nEGwPigB6N5Zmt5LD02kUG6U qG5EcDxJ3FK7kU2yyPJikMX1XgwaKOXiFKyAmMMATX4Tv9JOSM4/FlTy3zLJbtPKsNu1sAW9Qcqh 2B2ocxskiVCt5NnYHlAlJ4WFSG+KlfDvhgeiyf/Q8Fw3qQyRXQt5YLl+AMjtzjJYfC5IX4Tv8Va9 e2bInvr5tcWZ6vaQ3lvC3IW0c0LM6cixWUHcMQPsnwGGzW6QWK6Ndxxa5Dxl9CKUtDqkZUcZEPwt TegPYHKwBfD1ZjlbIr6LT7GZmikdfja3a6bi3GMAmKQqwBYmlDTJ2CPNjW6D9OXUZDsY3ClhMQKv TkdlAPHbpXBuing/muBzNdSGksSSUWlfv38MxsnmzHJL9AvkiEyJMzB/hqxoAR4/d3wRkbsLJ7l5 b9PUra4sXkV4riMJ6e0hkki5FGC9aVNKjt45ZxXKwiXJLVeCMiMhQURopCqcTStABXcCvjl3JAHc i4r6NS6uxVmoxPDmCrVDAkkUBpQ0wnnSnZEB2uYY47d44qiiczQVbfhxUVWlNqZGQrdBlZWanpgu 9PIlj9S5I9VVYcSKinw1psTvgjEHZJDwLWNHe0mrMFUAn1KE7Glev4ZROFHYsohIljAuI/TcMxA4 ou9d++R5Mhsyuzvngk4MPTUH4ioqVZehr22whN9HqGj6zHK/pTPRJlKMqkgSpQoRU9265bHctRos M1XShpF9dQGJ5LS7h+sWTTUULtuoJG5FOnfIS2LOJ3QWm3z6Dq+la3aqhuNFvrW/jjND8VvKsij6 SuY2eIyRMB1BDfp8nDME8g/ogvtY0f8AODyZpvnX8vvMps9P81W8d5pWvWqRzyWNwSDPbyxShlSW Fi0bq67dfDOf05IHCeYsVyc6QIkOr1LTdP8AMV1Naa5feZNVuotH0yS1/RjzmLTVBo8tzJCtE5/D UsxPEdKZOW9CXIJjUboPxc/5y2/MzTfzO/MyBdBuY9R8ueULV9OstTT4kurhpDJdSI1d05KFUj+U 5udLDhhZ5l12Q7vnLRNSn0fXrDWIfVe/0ueG8tmDEt6tswmjYU6AMo75lgcQa4mi/qk8oebrXzh5 S8s+a0kVYfMmlWepx70p9ZhVztv3NMlE7NpjRTG41O3H7uBjM7bVXp9OTCgWpxQyMRJIfjJ370yQ W0YsTDud+xO2SBRbH9amMcLLy2YVOWAJG7z7QbZtR8zLPQmGxUsB1+JvhB+7AQCk/S+P/wDn5p57 Gj/lP5a/L+2uo4bvzfqn1u7gr8ZtdPWop2oZWXr4YwFAktI5vxBtpQvCaaNfSNUkiUEUoNmoOtMr qzbACyvisBdLc3cknoS8+KKwNHTsa+3hkTEFF7qHofV3SSdeQjUtA0cqmqmv2lBNKeBwCo80rpAj qC8fNJG5bsabDvX8MQOQ+bIJdfWMECNdCsIZlEMctA9WoakA7CmAA2e5FboaSBVqZ3IVqEcelQK9 cQOlKhraOW3lhlYhSasGlFVpXb8MeW6lnF79Zf8ARls0S8baAXB9MUHKbetBX2NcnGJ6oJZGrD6t Err++j+zGWC15CjoK1rQ5YL5FjxBJNQmSSKCJ6RmTjxL7kGlWHbocjJiNt0ut4oRHKteCBiC3HY0 oSe/bImjzZqM0kJhuZTKvqheJUKaL1/XkQdrZDd57ccmk5M4BWp4noffIGkkLouAuYVMy1HLm3UU pgFHmx3R9rGnpVqo9XlViadDUH54g9Ut2ZDXgjaNHLtwow2PianLZHc10Sj771DzREZRzCoq7Gg3 HTwwDYMIyZ15ct7iO3kb09pCpglX7SsxPWhHXvkwKC80j1M3MDS8SscqsVKoKqxBP3GoyuUQerIP M9b9U1klkDyHkCF9z4+OVyAASEy/L8erqYjMnAg0foCVHhsd8OPYsZB//9HwEJokKNbvKjR+mRbO AQhLAuQ+/wAJ5daZn7GIF7ooBlt1cT3FhJeRMiT2TrPO6x8Y2V6KyDh+0Kq1O+SJJ5rW7H5hKFgl aJKyOqXYZFQoy/bDmu47Vp0yJ3FdVHNkGrWwP1GSz4ubtEcitEictQ7NsAtcG53SOaEtriS5huIZ rhRJp5a1e6LMQ5HxUNT8NCaChwjY0xkdnk3m6KNLieLmWRTvIoou69D8ieuY8x160yiHmFrIlsXj SQMxY0A6HwyI6hk9n8ialJb3kEluGuT6gI34VZKtueoApl2MBBZNrFkyXzXkcDmO/rKjcqoQ9QaG lKg9q5YRYYUo3VpcwJaXHGG3jnfhzjcOCnU1A33PbJczfVAkLR8jfo2ZJEImKbRD4FjpUfaLVr1N MEjYUS3TFZUiurOd5FliKSBAhLKSGDBSp+GlKjIRlvbK2DeatOS7gS+SBYpWjCuAfhDKNtqU6bZM xBQZVyLxG7gngl9RF4ENUgb0IzHPNsFJjG31gDlIQ7ivqVpuPlkRQKNizPRtSitlUoqsY6UJAJKg EfT175bx0ESj1ZjcNb65pHpyQrHewuz29wftoTQsvHuO4w8PELLAGi85vNJuP3txFIeMQ9N2cBGB 6/Z3P05RKAboll/kL8yfzI/Kqee48jeb9U8s/XWV7q3tZAbeYig5SwSh43NABUrXMbLpYZN5Cy3Q zGIrm9o80f8AOSH55fmXpEflvzj+aeqXXluVeN9oFksVjbzRjf8A0iKzji9VfZyR7Y4tFjibpZ5i dwA8rhj9SRkgufq5X+4UsqkCm43pXYbZniIo+bjSkaVINN4GC6e5AhDVBBYkOx25CgO+GAHyQZdz 97/+cPdQvfM35C+RmueIbREuNGZlkMhpZylU5VpxPAjbKwLMnMsPr+105IgKbe48ctAobNZKbrD6 YFT1/HJxYkNseKHepyVKXnnmG6KqxY7UptkwGQO/JU8hWYe3lv3H9/ISD0qi1H6zkZFGQ9H4f/8A PxHz4fNn58Xej20xbTPIdjDpMK1qn1k1lujQdwzqtT4YMgIiAOvNp6PhqOaOaHgoPOMc5ioLGhND XICW1Km95HFFZwQq3J5ieSN2Q0328PfDIjhrkwA3tj8lt61xxFD6z+oUA40psPhHc5XQNMgU01CS 30zTr+8vlRY4QGgjL15UWoWniSKDJS2BHekGylyXQv4NCOoDhNNCrSLxNTX7NdhgjvspBDfmCWEs kUcTVUcvTJo/zp7/ACwykT6QEDdV0S2uL9be14hZbi4CwiagHEbNSvSlCcER6qKK3TeW8EupXF0G LCNhGwWgX0owVUgA/RkhYKpjFbKY5JJPggjbjI5FTyWv7RPQVw8x5sSfJJ7tbI3dpBqF5ReBeoUt Wp6gDxpgJtlEJnMLOOOOIL9ZSlWZaDoNqePyyW1Uo2LHrua3Z7hIwPjWkwNSNxUfTtlUo9yeF5rd yLHcSxDi670JrTKZJU7V4BI3qE/vPsoo6/fjE2d1ZNbQRcac2JIqI6Akfdl0qpSSSpwGJLhyZgrx 04qQQanbfxx2kbC8kdqL1VX+NDs9R7d8iCuyYeX9XmgeMCf900g5JIe/Y9R0yUZWt0nOsCC2v7pF X6yCwkMjgrzqNyBt3rvjsDugkh5f5lltpo1W1QRuNnA39/15TKjaQt8lSyJqkT0H7k7nuR3BxiQB Sk2//9Lwl5k8pzafevcQO0Vnx4wW7NSRR2VgOw6ZtJ4gQCGAnvSD0q6uVkhs7i6Mcci8niWgBjHg Adx3pWtemUSs7Wm6TKWGWYvJBGskSwkXHqOrsZUI+0K9gdyafTkuLiFjmEk8KKgEd/ay3T2cl01t NG0HxotVpT4EqtSNmGS4hIUFqt0UIGs7mdjbpcR3TxODVRWJg3MSFT9okDtjHY2ig8p8+LIt3cSy 1MkxYAEfAR0Wmw7DKskDzKYno8QZzDKOS81DVoO2/jlBjbYdhT1nybfo8zRyjir0pSlEYGtSD1qN ssgd6PJg9tmuEu9OkmWGF/q78UQVKoqgjYV8euXxIGzEpTyjksVhimakbUt5pFEZ+H4gCRtTegpW uSBBCQpw26GCUXULSqhZgaqCVrxb9qtAx8MBG6Gw9lA0JW4qhLCOMIQxDilK0oOJ7nIGXkyKFW3M tvOgWSVT+7kjk3MdDStB1+I1BGEECyUDZ5Prmh3cV1KJEVJAdwu6sD0IyM48QtWPW9osUjLLybhv xGxyAjQZA2mtrS3nPKNSG/ui42ofnkYipWptnGm3f1eSISyL6N0piFtCPijJ2FTXv41yYNFFWmWp RR/U1vYYUrPX1EP94vE0JZiKGtDiYkraQC2gngEaq0t0xPFQvOqDcGo3Jr2A2yIiU3TUVlc2ytDE piNAHlJoWVvGvh748J6pJCorXMDxwCSN2hBAZTXY9Bt75Eyo10QSAyJGmng9BLkRSwxgvI1Bz2rT uT7DLhVIoXb9nP8An23rEl3+Wfn7yvcxyfWNA8ww30MjsSGi1C2GwWp40eEmpGCvU3CXpj8X6WWy HjQ0qOgywMSVVkY9KVwhbKBvCYoz8QBockEDd5P5muPgdOQZn+Fd/wBo7DJE02C2XG8tfKPlG81S 9kWKz0awlu7t+gCwxmR9/emQAsteTufy1/md5rbzJ5x8yeZbmVpb3zDqk95c82qaSyMwB+QIGDKQ ZbsTzY9aW0pCPRvTkBZONBy470b6ciUUrgyyGKW54xniVMqHtShUj6Bkd+rGqSdZZVvWnMwZVjCk ybCo6ZGU76MnarCdUtbOymHGwMjXV7KBs5U/AtPAd8MQRG0ckdpPoySG7uKenB+7hWTaiKKCgPTp hgB1U3VKNpEL+8lm6SOPT4gkgkdNyciIgnbZeTLLm3bTtKvNSVzGYQto1sQADM6/sN1J4VJp0rll Vz3UpBpdtItxAqFd25VAL/SegwDdDOrq3maB41uYwyR8XQEDmF8Bvlnv5sRbzfUEnGoo78QsKCOO XqSB2222rlfFuzFp4puZIWMijnGQwQUFFC0FWG2/thIEltLxbTVmeQx/GKVLDagrU0PbKzEnZLzm 7gb1nZWRmiry379ciY0kIDkJLhAyleIFelenbIACJQySxCBoec3pyUIrUVPhtkxLoq34oby5BPJG I41279cIO+y3ZTWWYPAV5K9K8gTvQfPBXemQSy0R0ulCoVHqgs9QeIHQjBR6Iq2Y+YJ7iWIK44tJ EiOy9RwAXxPhXJkHuUPJtWKQFiAyUU8iaGpPfbIEUFR3klZWu/WQD1KiQKejAbkYIEDor//T4JbC LUNNn0+4uoriNFMcazg+sagmqmShK1+jNpEn6ixIsvIvO2gy6R6U9ijWssb+ncR7UUkbFVFBQgj6 cjIWbUSPJKbm3uLjTbC79OT053MdzKrsxLR04kKoBAI2BbrQeOU8PDuzMe9E2N9Ez3SwuJUjtzI8 FOPFonRFArSvJGJPywgg8mMgmcca2yzO3pwmNIWjTnxZkqewO5JyfFRpIeZ/mC01xwnlai/DVidg B2GVzIIQObwHUJFaf0Qm1dz269sosgso7i2Y+UbkpIsfOivJ8ZY02XxocshK5bqN30P5U+r3gvrV pXid4ConXdOQ3JYU2ZiNstgbKJA1brS1R/rVnxVQpCqxUMXUfErkEinwgk5MbHdjEdUFJCsa8Yrg XKtIIwXUgFW6NQAgUagpXGQrkqMnkieEobUqSn2gBRulBQ7pSlcFmI8kpSlxHaahcwzs/FmWq8vT Y9zt1Ir2BxBs+S2oaza+tIP3XIgmLmrhww2I+zQgkHuMfJjsC821K1KENbMebL8ZA6DwocgYUWYI QFukspQycnRAAtRtXvv2yPNTunFuXiCyMAeHIoKgAiu48ajEc0nk9T0i8gubVoLy2WWGUBY2l2A7 bMTU70ywHdgUtNu8N9LCr+i7BkZVFOI3Ao/WpHhhrqgm1LUj9XNIpDGjKSwX9ogjbc1398jlNnZI 7koa3uTK7W8gaH0hzk+HckE0NT7dq5UASKZorSxGoSFo45GrxDVGxIJDcagnwyQFc0cn6a/8+5PM KaV+aXnbypJL/wApR5XF6tvI5VhNplymyipBqkzHxpkyeRPe2xNx9z9lIbnqqx0CnqTllIkFVpGL VVgB3FcaY2k+oz8UZ2qaVpUYR5sgLDyx/wDcn5lsbdCCiSerKvh6dDv+GSLOiA8q/wCc0/PQ8l/k J5qVZPTudfWLSbcVoxNw1ZKd/sKcOPbdp6v50Ied3qMQdVeIuTKppUR1rSp8fHMWUiSSxTyWJEjm SJ6QsSRDWs0e9dh4Cm+WVtSOqMmgSCyaqLJNLGH4RpsgXYdTXcdcIACWI3gLxkNDWjE8KgEVNADl UvSVCXzSS1hs5DJburcZ4X6E9qN3yIFqUyih5RiN6kMtZXPTkOg+jJDfYBQWRWmnt60cUaiQoRxg DhPU3H2T470yQgoNlf5me89PTrW0uPX0m3PoySMzMWlO7ODSvt8hgGyAUTp1osFvaSTqJjNy4ySu BxBqNwpJA98mI7KE1aFUsoX5LEZUYOxR6gAgqVYD9qlMJssT5PPZ1LzwueISaRjE27b9N8qNgsk3 5yCMFpfiRqBFpQf62SG6gJfcO4MqtJ6r/FSRdwPDpgLJhN/bMyGXkE+P4iD9rbKzRW+5LWt4VaNg S0jAk+G2D0lUSJPq8/7wAitVNNht3OAen3pRyXCuWkEy/F0G4oK/jiikeXhmUs7VKnmY1NK7dK5L lzQg7K4mj1OI0ojkExdfxxolkyjzVqU4a3b0+KtD8e/IsQa1I27HJTlIop5Bqs3rJMymgJHKPoa5 SeaaZ95Kgf07cop5A8uYp8JJ9+uTiTdI97//1PJcl9DFOObCCNovRidh8LkhWNQ32WPHbem+bJhu EzS4u9ctrTS5o/rGnsD6M5VpWrU8C1a1G+/IdPDAZ9wtZVv5PPb/AEyTSbfU9OjWdJ3KzJDGQSrN QK29CfCnSmV3w2yJJosf0FjDcXPqAuwRxdgUNFKk8lrWhB67ZARMSy6I+SS3uraFjYyCFJ0huL0O GmKFiw+EeFPDLBEmywBefedriVLZYOTLuxVGNCVrtUV8MhkOwSD1eGXhZrgLL13JAoRQ5UK6somm XaLWH7JUOwHHp4+NMaINkpq930L5RuYUiiNzyaW4LUkRuBBNKilKE+xy0E97Ac02v2gsb/1Y2Deo hYmoLA+CHv8AaocyOIUOpYdWrZp1jY2rP6UiyOYmFaMPi7A0NaGtNsjIC0nYm0rRbiCFpGdvUkn9 asrUG/2AHqGBFD22GQhIdd1G7Gdcv/q89jO8CsJ+XJhyaio1DVvetd+uCIPRnHzZJaaklzbJFJbm NgvN3qVK1Hc1AIpt8ssB4iWIjuxvU7BVRwqM8XPl9bC/CVbYVb2OSPRWETRPaTRlJlVYX3IaoI8S PDMcikpusfOJiqsPrO8WwVua9+R3AI60xgtnmnHl+8Frc2sd2yJIS1IWq1N9i7VNRQ5YDut9Wb6p Zz3kCX8XqkceLs1TWME8DQGpAO2EjjFclBCCuJbKOZXWIEcFAkcNxB48WHToQOtOuEmtj0STaVR3 jQRCK0tLdriEfyAkJUbyMT8VVr2ysbSUDvR1gPWnlkaVbJpECh0oAqk0pUjoKHYYxu90l9Zf84na +3lr/nIL8s7ouGt9Ru5NIupiwJKXsLwLv3qxXriY7E/jZsxkUQ/fu3kAU8koVqDl1ckEW09yn7PX v44aWmO61c8YZG5MKitK/qwhRbC/JyJLqmpajICyx0ijIG9Ruxr9Ixq2U9g/NL/n4759e9k8q+R7 NmLQCbVNQpvxDkQxFgB4q2TkKjTSO9+Vq2EsVq0qSKJy/J36mv7K+IpmKY0gpnbh7kRT3xp9XFHk jZvV77NSg3JyUSSwPPZSu5niWUGdQ5NWR/tkAVAoOgw8hTO2NaizSxpaOojkm+NZBTZTkSVQcNm9 uzLKomVfiDGr79hXrkABVjmgI1HcpEyl43Xkx8OW+6k+FMNmmRI6p9DqLaZpzXzRxT3d0vo6dOCe Uc5AUs1e6qabd8MbIRYtHpaGXTvTe7R5VRJYiTx+KtBSg3r0ywgcLEjdOtLhZRcGKJyWKleQZl9R egqBxFOu+ECgkjvTvV5pksI7l1WOkR5ISCCSpBrToGrtkTIherymKCqwKrVbkQwZqKeRrSpykx+a ShmhmWSSFDxDOAatSoB6++SHpWwiZ7a7SCfjxETkhShqadACade+AR3Qwe4M6OyUACNTi2+VTiyQ xlkM0bOwYx7BVFBQ4Oqq7c5WklcjiFqEFB8Xhk+JUKsvplkMRJcEKGPvXbIlU3tJXeIqIgy9XA+1 8x75ZC5CiqYWJP1lE4+kwIIUrU17CvapwAm0FF+bJbYfVV+NGaEB+XUHeu+ORLyLUJVe4jWMVBIo a77HKbZR2eq+W549PsYpRJxNwhE6cQTvtsx6ZKPNA3O7/9XwXezXP1X0JZ1X05EJtmIZmO/Qinwm tB2rmxF9GIIZNp+ralbQSXS3bWwjkMINkSrhXYLwYLs4K7EHYjImO535bsgdye9M9YjOq2D6rZy+ rdW9tTknxNJD/Ia7goO+22+GQJYjqWEaWiSCe6dgGntppJY60edwOIVtqb1+7Ime/mGferLNdyRp dhDNGI9pkogXkHWvpkb8dvniLl5sS8X/ADFKpc2ip8TiFfrAc1JcdTv0yGQWLZReTGRGlSTl3owo DT50yiuS0y2yFI1mqOJIooG305Kr5K9p0W6EdhArcF5DYseNWTuQN6eNN8txgR3pizScXz2kMsTe stuKCGo4hoz+yH+I15Cg75djkLYFEW8F+scUk3opHxLBnPokBhUihepanbvhMdvikUb80puIbi1t AsJLD1uYiAU1FFKipNeRr8siY0Co3KTea5JYtPtXeMC3juN3YBKc1+zsKk/D44CNtmQBPNCaBqLx GR0dJYmIKiRtmWu4FemGMhVKWQ3+ny3a3V2x9Src1aE1VipowA6bAg9smDvTHd5pfxQtdEhQUNeA p1p4ge+VnYsissbwyDi8IPpjgpepHWv6u2V8jsqYAESxGVCH5URkAXfrv07dMmBRvqr0nQjKyzx3 IVLd0b960hJVK/EULbd++SAA5laWXunxw2/ptznikKPDKjqBJWnAgqCKMOophkRJhyUksy8NtLFc RLLFy/0RTyaPi1CPiAO/zwmIIZXSU83hnkkZzR6pK4ZeZBNCAvsd8iQpPJmvlTXb/wAu6zo+u2s8 kFzoGpWeoRzyCgRraZJhXkelFPTrh4fTR6s8Z9T+my0v47+0tb5W+C/hiuozQAFZ41kUgAmgo2WR GzMHbzauHRA2/wARG3brhpNPOfNV4YLWX96w2PGppvTDyZhrQa6P5YjlkIjkmQzOzH4iZDUV+gjD HdhkL8G/+cnvN8/nf84/NV9HKLqx0m4TT4JQapS2Wgr0NC5JyGUtR2D58qqoy3cYdbR/VvIeYHq1 IFI23qfHI2SKYlZMgMUMss0gSFOcpZ+J5L0RfHImJq+jGJQ1zN9Yt3uiqRs7fvY3J5dPs0Oxr44J ja2RSSG3knVri5jIaQkRqRtQnbfwGRhdd68giZ4GSNkLNwFOVO5HgRhoXabU4Y29O2jEk/1mWUOq 8Ayiv2R9+Ru+SLb1kyS39t6g/eWdEmAABMp3c9gak5Z7lJegQEm1tYy8KBYqh+pUsAQCCB1yYFDd geVLYfUt2MENw0hmI5I1aKDUHYePvlcvJkNxulOp3V5BpNzSLiiuqsT1o1aCtSNqHAYitikMT2lt 4lSMVJ+2zbmnjX+GAgjdNo+dZoEErBOKqocb8QPHkAcTLZAb+sl0ENVWI1eRiTvyFBSgyNmSaYpc wi4lnEarx3I41O48a4yhQpUjaJ1nY0jNNihNKU718Mp5G2VqCXMkspNFZmYhHXpUDcY8JtkXTzGW aNGSjJSh6bd8bth1T+CNLaSNlkIUioqe/hlkR3KU+eMvcFxIsSqisBTryP7PjjEXutWgfOdvH6dl 6codmho8rHYtUkgj2xmdkB5Fbos+ocWQ+mn2eOVEJNF6fbKYrOLm4ZCeLR9CKf25KPuS/wD/1uB6 5YWFzopXzDotqbnT0BvWgLRS1PQ1oCoUkVG+bLjocmugwqO38vNBeR2tx6F08n763ZXUswA+yyVH xBhsxGJnGR5blPNEaVJb2ciSPEtzZW9JLl+KhxGD8IcCgYEErRt6ZHJI9EjlRYfqemCxvNZRWkWB XeSyuEAKelMAqU6D4SCPh6HITs8k31Yut5MTLbxysQKKVJADBT2r3oMiBTKtreMefXQaoyNJzogr uCSaV3IrgmQPTHZQ83jkjV2k5FGGykbgn3yondLKdDmRpjFL9hiGDHoABU9MkOa+57BoMUF24jdk +PaKvYAbkV6fryziG2zAit3oVrfSxCUJWK0lLMkrUkWij/Y5YKG/exJVEm9OSYXN16kAAlig4Dbn ReoLbg++ExNJC6V51tJY7m3EkJnCxOByfjUiuw2A6AYOapF5njhvvLF0EUzFIVmh51BUxt4A7Hc9 cFdySaNvNvLs8EKFJJBWgDiStFqerEdKZDGOXmmnq1hcxIOaOJVehdVJZCDsa8vYZcNzt0Y9Epu9 KCXEqw2q3MUoDwz1CinUqu5HfJ0rEtSgFsoA9OA3Aqj1PwmvTYUrTxyiSSbQdq31g3MUs59aJQUo acjTeort0yMbBoqyzSb703jSaUTRSJV4w3FmYbHlQ1I8MnEC1ZlC6SJwu4SlVc2kA5Mq96APQ1BF ctjzQQp2PqWs7ev6aJK9ZPUYMQaUagBG3ffphJ6LLmESluYbmaNZ4x1c3DSKQ2xFOIAPUClPHGQH RTsiI9Pu7u0+tz2kaRIfq7VKgMq1c1qanw6HIg7oEqL94/8AnGjzyvnT8ify51O5ctfafp36H1J/ iNZ9OY25PJtySoU0yeEUCD3uRIb29omv1UMxdQpGxPXLJDuXiAeQeYJhqup2mn+qX+szgNw3AQbs T9GRJ2ZDvSn83/OUHlbybqt2ZRGbKzkdV7goh4qPmRTJRDTVl/Pfrd693dSzrO1xNNJJJevWhkll kaSUk+HxAZRE/NEihXVZGhWNC8SOXkik4gct94yCdvmMHMoVPSNxMIgVZFqTUVoR9omu1MkNzuxu kqvT9YvVtxdxvbQ0QqBVajfiDle90m7CManp+m0b+myhYFdtge7L7ZI7DZA32KHVIhcxWsvri1r+ +KKC1QAagE075ERBTRR1tbxwyT3QkErGqWPA0BfYgOh6UBrseuSEd1QP1UKsc0kfV6hmIarH5k4S EHnTM7WUGyjtnj4hJCBccuRFVG1KGgqcmBuqn6nCZZB6chT4HYVFKGtamp2ysgg2CtsX1y9AhW0k jSVpZCyXDMSyhdgK+G+Ek96xKRg+skbghmjOwCgAL065XxfFkjJ53YGMllEagNEPiIB7eGAkrW9J dEywXCuwfi44uxYgEHtQDGJKASQQpL6T3DuvJBG55Ie9emA7WfciiEBPDE4kkUCNFPxcuPfsB1wc 03bHprJrWVJIx6bMagHYUPenvlYZ3shyzNKOQPNOjdtz3yKGZxsJYo0niALgCN+PXah6ZfEWGKc+ lbqbdHnMbkFZyQSOI6UB6/RjdbBNsU89OtvY/uk5enJxEjbVDL+zgnXDumJ2YH5YhjeVpXJZWoXP gelBlUSt09Da4otUKcYd1LbgkdA2Wdea2//X8zWfm0+YTYIsot721KpbTahx4XAYsrpM4C8m4kAE ncdc2AN8mNAPKfM2lt5a1Zb+3iuRpVw1OEpZlicHeMk0K+I8emVZAY7hnH6d0BZ66GvhPbXJDOAS pYUjJpsxNKg0ptgErJ3ZEbM4115bvy7He20VBbz+leuRRTC2/wC7DEGnIDJC6pgdjTxezF9c3Tpa rJ6wYytC4qxoCdq1rt75GA3Nsq2eb/mCZ28z36z+lFJD6alYQFQfAK/D/mcjM2gMAK/vjxK0AAAP Qmu+3vlVKDTJtObeBljYfGCfDfbrkwKKTz2e06QySFlllhTiqq/qg12FNyPurl4Nc1Jtn0UCvE7G OW3gjcKoLA0RtgaqQNqb7b5MEMC5kSAwgPH6bIzTPw3XiAQEryB5d+1ciZc9mNlBLfGCS5EF0LmI 8ShqF9Nz8XEjoaVOG+nkyItM5NU4aO0cSCdxG4iNeRQspBRkPX7XfIk+aL3fONhcXH1hlYEysxSc A0OzUNcqtnb2PSZ3a5VTbFEESv6rNXiSNyRQVPyy8SYSGzJ1swsF1Us5VeJQMOKMlf7uvXwO1ckJ 1yQeTGbuBb+GSaO0PKABiyFnZRy4ggABd6HrkpGxyYhiNzbNa33BwxpuzOOJFN67k1OY9Etlshs5 4ErcJKVkCBBwQGp7hvD7stHLfmglnWmuFgimVJZ/hT14yFYih3VeVdvEDJ30VCajZyDUUkEcskcL B1RKboQKhTUCqnqRhJY8ymtxZWrFPSiihZlEdx60vOgIJ9Q7EVAp92MZVuvJS9eBysbmeSW2eisA IwVYfa6habeGCR2WwX6W/wDOCXmsp5R86eVZ5+S6TqkOpWcSU4iO+iKysGqakvFXDj2l8G4F9w3W ooY2kCMop+0a198t5MoyNsR0OX19S1DUSAEtEKQMNqs27H6BTI7JkafEn/OX/wCYv6P0CfS4nkeb VZfq8aIAxK0LO1K9ABucM5U1F+VztFdTSz2blJHRUVJAWViacjtQDbMc7liVQzWysvpQtaxKEiMM bNIhcbFjy6V8MQKKLpNpfTtYHSglleEenJGOnLxqegrllmrCCOqW28n1RGhESTNIOXrSLVg1CNvv yBkAy97QBmeM8SCiIpAYEAA9PCpwSlSjddZwtJdvcSyfVoYxX6yhU+kFFTIyHqFAyZoCyo32SuLz A+o6l61mPq9pp4EdqJG5EqDu712qx32yoSTSbPJA/wBZVpGeg5KV6AjuOmS4xSDzT2yv44ktOXJ2 lp6q8qFigA6AeIyQR1RMhULOxRGc1eFlqTuDUMGpvhABKHmutpdpd28MwVZDEsjMhU1Em46Eivtl ZNHzZBTtSdlRviRjuDsRXcEYI11SEdIUWQzhvhC/vEHUtiR3FNFRQPJ8VHMZ3BalD0qMIFMTsFYj iJVaIuXHMbgH2yMuSAFgjhmVgCHIod+1R098JNpSvU7clULBSikIX6nb6MrJorFj15ZzRyhQCFID KARU/f2yB52WW9p7psoekBJ5RAOpY0JrtscnAkokN041W4a3htZFiLUAcOTuvyOSPp5oAYR5wufr uhyySbtzTgSaknv1yM/ptlHnaQeXo2SFK7chtsenjlQUBN9VZdNDEPtKa8R+17nCoL//0PG76UWv LvhJLcGONCjBSrDivINRaFmoeNCNzmxAphHmm0K2+rWtxpWryRpZTHjFeSryZSyqEcOa0NQKg7Df ftkTt7mRle/V4jrvly58qaubKVG9JWBt5XBCuCBWgNepPffKckeH4tokaZ3psTaroV9ZS3E0Z+rX EkkNQwqg5BQe/wBnuNsMESGzAdCkvEe1uIRwLylKEg8gBxapptXABZpEth8Hivm6VrnWdTulPMPc Pwag3CmgBpTwxl3rypi0fNzyWnMNUDv+OV8wimd+XkkFzHMzBVgIIO1arvsp2OMNlsvVIJ2b0JAo 5SHlKrAcmNamlK9cyK4h7lDL4bmK4ib6s5ht+QEisdwoP2a9aHvXAJbebA81l5ewNDEkHOL0IiBC fjJJblyB6dBTph45FNLLBxJF9Wdvhef1F4opIkI3ArWtTkaIPNPJk9k0BUCOBGkt6P6ckIoC7EBi 9T1I75ZCaDyfMGqu0XnHVom4x871ysSD4fiaopTbvlUzUmURxRDNNNuJJBGPUKSQOFZeOxHgd+mM SCWBF7PbdJnhmt1lLVVyI3uAlCHJNaVJ75eGJSbUbG/jDwwo7whhCyIOJDGtKnaoNDhNkbJqmL6l pBkhjklUq8ZpRqszilQTTYdN8AHVNpVpdzSb6nChklgYFC69eWzAnrQ5XEm+SQOr0DRbhbS6a3mV ECqaCjMAZTUP1Pj0OWcJO7Ed6bXf1a4spmJkkeEtJ9W/uwIqihAXaq/jkok8lA3VreWKKKK1kdWg vl+EAUMbEbE0BO1PHJAUpK+9gs51e3VfTuPh+ruisxYRgE8uRqeXth5nlsxO/k+l/wDnD3zW/ln8 ybnQJF9Cz86ae1tDbt1+s2xM8dB2NOWV8iCGzHLo/TLWNWe1sJGkBT4Nu5rl9Ato25sSm1h9D8uM zMRcXavNKAd6tUivhQY11RIvxl/Pjz9N5v8AP+oXlvcyXOl2I+qaZw+JHAPKR+I/nbfKJzJLWXjS +nDaySSRkTPQKImIoSOpBpkaNsTaYaUiRJLdGWquKfvKEsQK/CTXf2pkojqUHfZTaSVIZbtqr8XE QkDoe43675EggJBJCrDewzoSEeNWUfEfhUEda9OuIkptThLtwh4RyI/7TPsV9j44ndfMKXmu6Fnb PoNkr8rhUOo8uJaNR8SwhwAaD9rfI5UjvY7olutu7xyqXQEkMtSNula/fkQFu03vpRHdERHiix0a m6sT29hkqSDbKrC5hWxhBHErISyqoLqR0o5NckCxqkfcxyCOSdFqJo2EbliwNQOqihydru8muXkk vp2jqh5UPI9OO1aZUbSVsF6kDyN6kbs1S4pSpr/ZkbB5pXpqdsBIHnQlejVqPlgsDcprZVt7uKaQ j1UWgAVwf67YDLqEFNri8tZGkKem4MZBYHcEeGW2Dt3oGySQXaLP+8np6igRo3YDxpkZVXPkyR1y hlkCLLGeQBQ12+7AardiUtu0ERUvx9UA805dqdRkSRfet96TW95MuoW8NjC9zM4P7rso6mpOCAJk yekPpgFsp1yVoHHEm2iUu4BGw7gV9zl8oC92HE8x81lJNMaGBTwjuFLVAqB2rucomdmUSCgLOcWl j9a9QCgoydzQbZAbRZ1ySC4v5tTkqw/dA7HwI8MA9SSKf//R8y6jbiK7KtZwK07mRLoV9QFDsx40 oFB6/wC3m1qixrZIb2NrYwNIizOHaX1UYUCcuZ5n4QSCDQ/LIyBKL3X6gbXzJaXNnd26SyysEspl +D6vITs7sdwrU3GVmNqLDA7GG50+PX2vEZIrG1uAVbakoiKBlpT7XKg9sqEW6e4DzrRpXt9LuLi4 mYSQwysqkVXpQb9RufHDEXuxJt4Xqs7yOXkLB2Y1PQUyqSdkHahHA7MOjeOCO53Xq9N0GE+mvE8n Zvi5LQU8AcnAUEF6PaO8ESyRUEsEwjhRj05HrXpSo75Llsgc09tQLoInK3Z3fmSsleNAQSw8Pllo o+9arm3GiW8pCzirhAVO78TudxXw7jGjaAmTWtv6UVtHcCskjGcs9KtWgpXiOo33yOQVutKvGTSV njEnM3EUZKc19OlSQCVJpSvTrhiLC08E/MC1a280yXKW31Y3KRz8Iz8JBUVIPvTKpxKY8l+hzE3H Hk3GVqs3I7HwNcAsbMjdPa9MjuRZuYKKTXnEh+NlNDy3BAAqa5kRjXPq1nZP7T616MH1pyrSRvFc cXPFmQUVxtvUHERI6pI2UJrZDbG3McbTmN2mILNzZSRyBNQvwU2yYFFhzeYzyNp2oo6RsGcH0zSv TYeHzymV1dswWU/XZdSt5LjkWumBLSyMByoAoHRQKAdsmDsghl2jXck7RByqCeIiOJd1LRgLTfeh BPU5I7BEtuSLuZbW3jhrAs0SsrNbk8P3RYghZDU1JYH5ZIE3YRzTGGSW8S4+pwJF66FIZFX1JPRo VYVY7EfhibJRVpj5C1O/8meffJ3mJYJfSsNXtZridjt6EjiOdlJ41IV+mGUaDKEiNn6t67qkl5f2 lnHdpPDO/KSRenpp8R+kimXxFhuD5t/5yZ/NeDyl5Qu7O1n4alrqvp+n0qQnJaSyVUg/Cp298hNi X5YWwVi8slwWCkMrCoZSPA7dsxtySwsEr53mu7iszgCNaBiKVptQ5Ibrdq9BLeKyScbSD4iYiCWP Tr0I8dsfq25LyXPGbmQRVLxc6hgaNvtWlaZGW6jYK1ybJZBbrJLGgQGQOVam5O5Ap0GKiwnXO10e xn1e5jMplrHoq/AI2lFeMi7bqh671ridgoi86a5e65TSOJnYuJSetSak4leTOPL1nNHEszwEQzqo VaA7jao5DGieTEkWgtUs/Slb6tDvU8aqQSq7iq/PDMCmUUy0yF4reQgOE50uowQ3xmnxDfcH5Ya9 NqT3pjqsjQ2RnRyikN6S9HWi7bg0x6bKHkk0imV5ZHNamh7ipyERvak7qT2ayQiWM8uSnelPHtiQ FEqLH7jS5GjMqMyP1VSfwymcaZcXUpav1iGGNSp5Bvjp8+tcrjHfySB16NQX/pSMjMVYDY17jxyR K1fJGS34RIn3BbY1O9fowCjzWrRo1BpUXgW5Rght9hTocmTYs8kSFIS4u5l4szcg3w/EdyO+RJvZ bC3yKs2q+b7e3D7IxkNVqKJvRvHJYj6t0SGz1bWNRa4u70XHJ7iOTiKbdO1anYUy6W1FDB9YWN9P kicmORiGNOxHY/PIZI2KZB51qE+8cEbliFHJewpmMZG02jbK3UgVWqgdOlfcUxBpQLf/0uXSWun6 rCnoypFKITzikIRKsK0YgEmpFK7e+bMFrsh5l5ksPq1tbsQPrFxIeSIRtRtx8Ox8KbYmx1ZA2WG3 HOIXaqhtIhKvostJClDsxUleQB3O5PzyNbkDlSQUbqlnPrmj6pp9uqJrFva+nAQKC5jJVmSu9GFP hr8sEQLUl88a1PJp+jXVutUknCwTIQQVoQWBB98pFi201bxa9kYl1ZhvUKD7+GVnmxIKnppAda0P UBffIR2+ajZ6po5Zrf4j+8ibl9XrSijeuWxK3bMY0hljjerxpIw+sL0BIr0FemS4rRdck90Wb05K NyjDoyjjxPwGvSvvk+IUxN96PglSkoVXmmLEgrxJp+0N9xSm2Hi6JCcwupsOSTSvOZGjEUgXao6n AI8RpBVWtI4pklNszLxYykUFTUdKhhy98nRBQbLyP807a3juNEuYjJFNcW7evHJUgBW+GjdNgaZX lIZRuqYHpE7Rz+rHKxLEUTvWu1DlQIvdNkvbvL+qJNPFCrF1elQvJiD0NAQaj2pl0clsZDvehabN B9SmtQrOsJpBI8ZJWhGxYjb78toWx3Q8sAcFVmDu371FQhWLgkkAHYdtyae2GwT5sRzYZrtnDcXD zPG6xoaoN0IbatfZRXocEomt2Ql1SPT5pDIunl/TiUNIEFA4buKnc0G+VRMQDuy2LMNLnRnfkS3p cVkkYswBQdSD1rXpXLIneuiE7me2El0iyoYoQJrZ5EIKA/C4CVqad6mmWDYsZEt2D2cF3FAtxdRi rSxD7CMpHLiKgAqSaEVyJI5JB2R+rPY3tvcOisq2shNqQWJjr2atOntkwNkR9Jfor5K80x655Z0n XwAxm0y2jLqCA0qxhXNN6GoocsiTw03Xs/N78/PPjebvzGvrWKdZ9O0H/QLWGh4F0NZmp2q+1fYZ jzl3MTyeV2yC7mjWEemoA4oehbxrToMiNwwtH3MFs8LWkctW9X1LiZVJJ23CtyGSC19iGFsTD+4U BixSONiRyA6mtCB/HCaKbtRjkayQrxPqDZUahqT14nbK5X0UlOtLtX4T3sxotsGkmZTR4lUr1Wh3 YniMkOaAbYHrOs3Osal6kylbdP3dnaqvFI402VeI7nqfE5AnyZoSJkVGCoxPLgWb4So79KVyQ3Y8 me6LfFbQKZQqRbbCrEUpTlT+GWQkAxFFks/C4t1milb03jVparQ8BUVFfA5EyBPJbrYKKKIV5Qqs iSgpIV+H23Ctvh5ckJBrl9JFo78UjDM6hFaoYUrWgGxPvldE7so082WYSPGxYA8iJFPc+GGJpNhG x3SK8sPJSgX4Vr0OIPJFIW6kDMEDDcDYbU8T3yBHmlLnaJker7gClOlR3yJFCk8TF9Rt+TSyIATQ Hw/DKqZA9yFBaREDuCwFN+tcidlJRMNyyiTia8QSRXbJAmKLQt/fM0bMWHMg0HhgkUlM/wAs9Ut9 P8yxXdzN6UTVRpj4MKdMMJbsSHoOqrLDqN2CrxtIxlLUNHQ71U9x3rl0iSQUggi0p1Jo5bCc9ZjG WFOhp0yPMK8sswXlYuPiO5J8K5SNk0zSzpHHQgMqgVk/gB1xIKQSej//0/P8mm3tqkxtbiIWlmUh WFg/IjkCXPCrIdqA17k5tCAN2N7cl0VxJe2zW+oW3qWs8so0+5O6xBDx4n4ak06k9cjQ3Pcksd13 Qrq2EfC5EllcufUjiFKvGvIBvYipH3YxBHvYjn7ks0QXNhcPJGXty7kIz1fgq/HQjrQkA5H6jul4 r+eFmI3ttXtI2t4tWlL31sQPhuVAD0puKijUyvKbAPdzZR5vmW5ejktRqd/CvfKOLqyJROkQCWZQ QeFRRuw9zkYmzagvSdNt0EsZI5LsJadx45YB3MY7E2y6JRGQVilihNIzIACvWpClvY5ZEfNIpkL/ AFS3jUxOt2GUn1QhU7n7JBqenhkqAFo3RNhCjXEw+rTT0TgZIzxUtTbdvCvjkRvyRzTJmjS2PBHt pYmLEgkc2jHapH4Vye9JCKSYNLJJLNJHGIi0ayNRWJ/aUnuD7YgVueqDbzX81IUm0fQtQiDGO3kn t5mduQEj0cUB3od8GagCOaRzeS2MjRpFJy59PhHXfY9cxeJIFl6j5e9GO4jSKZlLlKMxFVo1Sta9 xl3PcBjZ6vX9Lu3iuZWW4KRyNy7NRSpC9uhPXLyCFpOZ7hYAhKhZnYxFxvWgBFPfJDdjTHtRg+Bg 6x8X5GCd2JoxPJq1p17YeKykAAUwi9sJLe4S4RCY/tyDqSD8hglG0Apho5Zp7pUIYzDlFb0BqUFR VT8sjG9kvSLLUPUtrVVhhZ5mKlKtyC0HqAkoFBFa9cRI7oBspRqkkwuqhVAgahJ6PHvVKV6Ubtll WvJytcxsXij4QFOU8hAIZTQGu9eo8MIHCpNvozQPO/6F/KiSZ7r99okd16rFuPN/trv7hx0ycZW2 DfZ8BwTm+1C5vqlXu3aVmc1HxGpJbv1zHFnqg7MnteUIjj9N2aZ2WJ0JLgAdQNhQ5KN8ghMVgKcl kZRxABKj4x2+Ku1a9clW+5YEohbU26qxEckdAvJiKEHtsa7e2Mh3Ml9lZi4vIpolEhDE+lOCYiFF WPMU4hNqk4KobsdiUBqeridoNLtHYaZayMZbxNjcynYuxNTx7KtdgMrB4z3LXCkMWn28927PKQgd m9RVJOwyUZAlefJXGnq0XERq8s3Kq13I69+hwxAPNRunujxsJvQVHBAHFgKkRgVIoQdq5KAo9y+S fPe2sEAiIdXdqRIANgDUg1I2qe2CqKRGkPbOgaWdmARyzkJtQE+JqBkYk8+q8NPNvNGoSS6tHYvc lm9MOxUbV4gAbbdMjfqTVsekjVJYPhYlt6UoSfHIzhS0hZHC3CJwJBY8gT91cbJ6c1FtmQPIxYCI U+Hx/HHhTSkfSMZUuxA7igHyyEz3o6pXP6TRMzNVgQvP2yNMklnRozVXoSaUp3yEgRukFajmKMq5 r7+5xmvmlVzK7hkZaggkdBkJBShtLVkeR1NGDUT6MEeaAHtvlnzJpWq20eieZp5oFSP0tM1JCCYK 9BICalPEdcvjk6FEgf4Uw1Py/daRbRs6Jc2lylILyM80cdNiK0ND3ywRFFQd3kUsDWs06FaNE5pt WoJ2GUcO7K0bY3YEm7FQaBydqDuBXGiEixyf/9SFajo09vzutO071I7hFka7tpEeGQRmhK8CWNQd qjNvYI2a9zs861Ay6bfy28cSxWvOgdEPEGRdqsw3JO52+jK8g697Ib8kSXt7hLdw/wDojjhe24QL WoNCKnkDXvgGyY7sY1G3EeoIIGE9g0wErs/J1WlCCyUNCBtvjIi6AQDfNhP5laKut+SvMM0cbM2l stxZqR9lUPxJVj+ypriRdg8qTu+DZvjkKq27HcZgz7mxONJLxksPhWUgM1elNjhBSQHplowjgRxV VcVBA39iB88mAx2ZPp+pT20NtFJL6q8mZISaopdacuJqPvGTukUy26KXkmnRIkbxxq5kdOIPH7TE 03AX3wHeNAreyIttinxM0UkwlduNVCr8XIUan7PU5KtwQhMy8VzJHAr+o0zkrXYh3oq0O/w0Jy07 boMUzv8ASUtUNn6XrTQFlkQSBwGFKlaV2JpkL4j71Lyz80Y5P8LXEk8KRSxXcMiiImg5Bl4lSOoA 3wZIjeljvJ4VpjyhB6ZVjX+7PieuUbAtgNPXNKLxRRSBQeFCj7VQig6f1ywE8mJei2d+JLaaTifU iBaij9okn6OuXg7MOFkdrcyEXSSkAOvqW8sIVjyVanj8RJJIodsR7kVwotYYrlLdJVPxEoWcVkEy kkfEo2HEjemEZOlKd+SW3ljVjE6rd3NtxW4SORipX5bVFMkSTsghjNlBDZMskjFZOayCgBYBmZaA ncnBe9shTK7a3goHEYaNZfUErOTyWQmpIAFCvywAC/JeIJzJBHctOsXBLmMF7JYyh50qOITuaEbZ KHPdBYzNcIjFb6SaU24P1No3C1jNAwK0YnqTTCNjS8whPOevHTPI17pCTyenezKvFgOjnl4DsBgl OrWMi8QsnRkT4wwIB60FPDKOQZEs00yWFZFllkqI1LRhmLU3FBXsMlAFFbJvHfyJDP8AvqRymoYg M1PYEZbQHNbCbWMNzepawiMBmYrb1B6AcmYvT4R79PlguuXIseqReY9WgkWXSdEnFwhEY1jVhyUy uP8AdUZ6emD3pucgblLbokBYtoYbKWaAtRgok5HYEjc7nCAiRNrFijhUxR0Z5kBLu21SOx6Yk0E7 hNrKBQI+QEj8hxpuHHgCQKbYYg0kJvDFAs0txbSlIm/dkO3XfZTQVyZ36o5Mf803xsljBMUzPKBb oQWJ9SnQ1qCB0yqZpNE7oiH6jIs8iJOIuNPR9Q+qrAVNQy0+VMYyHNB3YHqOk6Lr+oyapYarJptw q8ZoL5C0dV2/dyJuOncZX6ZHzSAQrzaHfLbQyxiC+9Jaia3lDgqfb7QOTIHexO7Er61lDVo8TGnq AgigPep7YDEDcpA80LN6KhQzc+QH7w9BTtkAPVzZpdd3AaQBKNt8agUH0HKt7VAuzcKOKU3FN/vy Uo9CoS25kIYVo1d8rkTSUI83FaMaGlaYLtIOyBkdmYEioA2weSKVbJf3fP8Ayq0phCBzThXUMzKD UEECvfGyEgs28neb5NJupLC+dp9HvwYrq3O/FdjVa1Cn3GThMgsShvOuifojVGntZ1udL1EC4sbl KlWjk6KW/mHcYckSdwyjK2CyXkaEjkpHh3yoyKX/1eEQ2vmG0jR7O4nV7GQT2moWzM/7niGDKa0F CfiFaA9u+bMAD3IsHdFXXmaKeG7tvMViZkZY4mvSPSlHxDmzTKu5B3BYdQBjdJ4RLkhI4tN1IJca JdGW64BGt5pAskiKSKbAByRXpQ4LtiDwl5xLrlzp+sXdvIzQD62r/USACTGShNG3Ibf+GVUeZZRA PJkmscbjQtfhthxg1CznaBGU8SWiYutK7FDTvhlKgB1QeVvzWueQlZGp9o/ENvEZiSvibLTe2qsU JavKtST/ABxGyTLuZ7Y3MjRW45gw0AZG239j1ywSYs+tWWRY3mhVmBVLeVPtU9wdj1yUeVMa38k4 nZ4H5rHIwmHpq23w1+10r2wmFbhT3Jxbu6+osYjSFCVc1A+FtuXb7NcMNo0pCvBcR/W4o2YOCGS3 YMAaElRUU2GSExtZQN0U0Xoys0chjtpJFpNIvXhu7A1G3w75Ot7W2K+c55Ljyf5jS4jhMqMJBvuF aSokp7jpXtjIHceSjvfM1nOqOPh48hu4NB+GYO/Jk9b0e7V7NfTjPMqASxryrt0GXRkp3ej2n1kW 8rTacyQOqyhd+QQjieRoBTbLYg01iu9N44FEi3IJhuFjDQx8uMZYVAXcEALXLBEEpMrT7Rp5VuBb 3Fp6iuojkmoeKyMCVZSpFaUpv2wWgjqib1LiOkkkr/V0YJMzRhWqBspZdz7UyRHULySLVbadSl3P GWVytwCzhBQfD3FPfrhibZDmirVElVnSSJ3hVQ0x+IGnLdGB7YDR2Cy25JjcJEsFvewqiXcbK7U2 COhIryr+1saZKW6GryyuHj+sQrzW74stHVm9Tj9mIg7KRkomwii8p/MGaP8AQqrFyu3FyGdzyrGa UK7+HfKsh2RDm8w0yZ5mS3RlVgasex8BlIlezMkWy6KRYkDCXk5UBgtSB26ZZIUN0EEsm0OwuNWn hS3/ANJnchUgPw8qmhNaEAKNzXoN8MOS2Ep85eco7RLvyr5XukuYpFEOua0FH71wfiigalVjFOo+ 0epyEpGWwWIrdKNAsJWtxH6gD9XYivGm9ThgKKCXposZGjW0YU4rzMg41KjpUMd8yAGPHslcdrAs hDBVLAk0NVY9BttTrvlckkpnDGssaRxWsKSptJKQwIr16Gu3TbGSQbVvqKhZooB8UwQxShj8DVqa A9TTY4YgFSwrW45Jtf0axmgMh5mSaCPdjwqKqOwqMqludk9Ey1UlbVPgnVpK0WVlDEH4RsBucjIU FtJmtGtFjVEJVoxWg35EV+IEb4DEbFnaROTbStOGaEqahVJABPQ0ByNbqAOqhqOt308arczJOgVU RZVBIQdKECuAS3oo4AUElnaatF+5mWxu6hUWU0ifxox2H05YeEoohD3Hk3zBbNJILU3Sxgn6xbkS rxFN/hr44DjPJTKkluLdrEVuleFqUPqDian54DAx3ksbO7GJJllkejAgGikd/fKhKyyCGkjDNvU9 q5ECkdUJKhAYk7fs75FNoiwAaPjyJYGop0wx2VG0LB6GhoOS/rydLyXRpIFEi0LA7HvkSEgvWPJb r5stpvJepPJPFOjvpc8dC8E6g+man9knYiuX499i1nbd4lqGlX1jqN5YXicJ7KZ4Z1r+0pIIFPl4 5RKPqZl//9bjHlpZxZWv6PlupLHhKbUSxqi/V6nabg7R067nenUZsYc9mO1boy+OlBdYXWVgewaG M2slqzrdI/7QdKNE0daULMvyyUbvox91vD9RW2F7H+hpZ2m+sRfVA6AR86nmF4OdyvU+Hvgnw/2N kbZDrRQxgeY44V1UyD6nJZurXIFfhEqFQCnShLA8q9shvw7pHkl2jfXRY34vw5h+qy8Xj5Af8WkK 9RUr1odvfIj6/gg8n5/X/H69cb/B6zcTvSlcon9TPomEXLt0oKA/h0yJ5Il5M40P0Pg9QJx4fFua /TXvhPRB5s/s+Xqx8i3p0+A/s17ca5YGQ+lkE3PjBWv1Xl+74dC3bn4fDWnt1ye/wYlPZhaei5Zx T4/h4j7X7XEq1a08RTLYfYwKDs/qYltRNR4gD6TP8LGPvzHxEVHgTlZu/JPRmE/1Ywr9TIW59c/V +PpmKtO3Kgrk96QWI+dzqH+GPM318RA/Uh6orEf2xxI4AGlOgORnd/BQ+RbLh8NaUr/HMUXu2npb 07y7x9B+ZIbkvp0HxVrtSpp8sshzQeb1WATfUz9aMvGjeoZAOVd60oadPo8N8tF2ptGb8tN5GX7I 2IXj1/a3/VviOXxY9GR2HH6xL6Quf708gDvTiKUNKePXJR82J5MlYfuiZ2n9IRr6KzAcD/KSVNQ1 fY5KNXvaJJBd+j9Rbj6dfSf0utabcvtd64T9iUt03h6VvwI9MxS1JCeoB8VagGhNa0rgSWR6cbP9 Ht6iKF4/tsxmO2/OqhRt0pkxzYHkU30ow/oqiqn1H976blhz+1tRQKdfs0NfHGPNLyPzyITZaz9b KLF6Q9TgFJ9Svw03ArXrTBOqRDm8L0v1Kr9Vp621KfapT3zGFNm1p6n171ByA4b8ySadfl+vJb72 h6TCb/8AwhrH6CVDrJjX6/uRItiP736tseTE/apQgdK4TfDsnZ4hp/o+p++Ldfh22rUUrgx89lL1 PRvQ5w8ORm34hKjau9eoywde9qHMsvb1PWT0fS6n5Up35Yd63QKpT0gN9cuPqjVi4vyMgUeHUOTt Xw38MDI11TQ/pKp5islG41Kg+/KgPfFkKdac+DcAR8LVNamv7XGg+WGNWiTBU9X/ABbP6ocv9UPp AmhK786GhI71plR+pPRP9U9b0dN9b1RBVeJWhWm+zcqGle+TjySgJ/rlG4mT0q/FyA403+zv4ZUf NPRiGp+nwXnUvQ/Z22/yu2J5Luxe640f1an+Qio+XSu2VhLtL9bjFyrwqeHy74DaA9F0v9I+p/oR k5cBUqD7djt1p1y6NoNJxKbz0Z/0sun/AFHifU/SDLxrTenMVr8sTdj9LE8nm+of8q4a2jUi4in+ L15tNJk+L9nlHcBE6/yNkslVvXwRG3nN2tirEWc00sG9GmjEbe2yu4/HKDw3tbYlD19qeDZApbse dDxA5VNKHIjmo5prt6b8gPenjXLN1KLs1gYgXUjxQ1+3Egkb/gS6fryYrqh79+VY8ox3040SSe71 8on1Z9URLeEHl8XBYWmr9J6ZbGv4ftapXe7wDXPrH6Z1T64FE31ub1ghJXn6hrQkA9emUStuL//Z DQpbRmlsZSBMaXN0IEJ5IFVzYWdlXQ0KR2FsbGVyeTE9WlBIT1RPUy5HQUwNCkdhbGxlcnkyPVpQ SE9UT1MuR0FMDQpHYWxsZXJ5Mz1aUEhPVE9TLkdBTA0KR2FsbGVyeTQ9WlBIT1RPUy5HQUwNCkdh bGxlcnk1PU15IFBob3Rvcy5HQUwNCkdhbGxlcnk2PU15IFBob3Rvcy5HQUwNCkdhbGxlcnk3PU15 IFBob3Rvcy5HQUwNCkdhbGxlcnk4PU15IFBob3Rvcy5HQUwNCk== ------=_NextPart_01C8E823.DA10E9A0 Content-Location: file:///C:/8E69C634/Classof2004_files/slide0109_image008.jpg Content-Transfer-Encoding: base64 Content-Type: image/jpeg /9j/4AAQSkZJRgABAQEANQA1AAD/2wBDAAoHBwgHBgoICAgLCgoLDhgQDg0NDh0VFhEYIx8lJCIf IiEmKzcvJik0KSEiMEExNDk7Pj4+JS5ESUM8SDc9Pjv/2wBDAQoLCw4NDhwQEBw7KCIoOzs7Ozs7 Ozs7Ozs7Ozs7Ozs7Ozs7Ozs7Ozs7Ozs7Ozs7Ozs7Ozs7Ozs7Ozs7Ozs7Ozv/wAARCAB1AEkDASIA AhEBAxEB/8QAHwAAAQUBAQEBAQEAAAAAAAAAAAECAwQFBgcICQoL/8QAtRAAAgEDAwIEAwUFBAQA AAF9AQIDAAQRBRIhMUEGE1FhByJxFDKBkaEII0KxwRVS0fAkM2JyggkKFhcYGRolJicoKSo0NTY3 ODk6Q0RFRkdISUpTVFVWV1hZWmNkZWZnaGlqc3R1dnd4eXqDhIWGh4iJipKTlJWWl5iZmqKjpKWm p6ipqrKztLW2t7i5usLDxMXGx8jJytLT1NXW19jZ2uHi4+Tl5ufo6erx8vP09fb3+Pn6/8QAHwEA AwEBAQEBAQEBAQAAAAAAAAECAwQFBgcICQoL/8QAtREAAgECBAQDBAcFBAQAAQJ3AAECAxEEBSEx BhJBUQdhcRMiMoEIFEKRobHBCSMzUvAVYnLRChYkNOEl8RcYGRomJygpKjU2Nzg5OkNERUZHSElK U1RVVldYWVpjZGVmZ2hpanN0dXZ3eHl6goOEhYaHiImKkpOUlZaXmJmaoqOkpaanqKmqsrO0tba3 uLm6wsPExcbHyMnK0tPU1dbX2Nna4uPk5ebn6Onq8vP09fb3+Pn6/9oADAMBAAIRAxEAPwDsl8Da SNMs1tvDuivKVTzJJbZSccEk8ck1D4s8I6MYLW00/wAOaVDJcybWuBaIoiA5ySF6UsPiJdFgilki uJbm6jQ+QD+7T/A1ot4osNR1G3sEtHnlZt8ZJwgI9TU3QGJonw3s7WZpbzS9Juxg7M2425HfBFdA ng3wtbq8svhnSgMDI+yI449MrxWmtw8dhi2tCs7AlICeAfc9hXOXeg6xLIbq/wBYPm9RHDlVX2pO VloaQhzbli18O+CJZXEGg6VKd2G/0NCEPpyOKuN4V8HjIPh7Rs+n2KLP8qwbaC608OYJwWJyd3OT 71latqmuQuZwgkXusfao5zZ0GXD8OdEbUYWFjZ+QXHmR+SuQufUCt608CeErHz3/ALF0+aPriW1R 9gH1FcppPi+dwsjfvV6EFcMv1rrBqQurFkgYjzVOfxqVPl3IlTvscUbDw5LHIkPh+xJkkYiQ2yYX rgAY4Aqr/YGkf9Aux/8AAdP8K6qX7UfKtLG1UNGnzMibug9BVX7HrP8Az7D/AMBmrmaqS1iZNJbm 3qSpqOkxRWUkTp5KySbXxtPHze57VQs7lriazsIbtQYTywUbs/7Jxmse2hWGBAjtAjRoGyetbHh6 zSHWQ6xRtHGCxfOWziqdVyloNI7cARRgDsK5HWNRnkvHTlVBxWxrniXT9EhH2qYJMy5VcZNcfDq8 GqO0qOWOe4rpm09EdWHhrdluJ2z1p0gDDpVWHUbQT+U0gVverxCsMqQRWfQ6zkdd0x7CU39kCqsf 3ijpn1qzomsKwVclWzxnsa2r4qtq4Zd2RjFcErGzv2iBwrnKVMrWMJr3j0+C4zG9zDKYZwCo4yFz 3o83Uf8AoYJP+/Q/wqloeqRS2Ee9dxxiTjpWr9ssPQVkpNHPKF2cTDewi3WSKNm/dgNvOTmus8In M3m+WpMp25HYYyc/pXBWk8nkxxMvmMwHO3oK9H8HadcwaestwAiPIXjXvjA5pwj7xnFrqVPGvh2O 8dL/AOzm4lBwP9hfTHesnSNDeyt5tQnQRGZ9scQGBjHJx+VXdf8AE87aoILZmURNxjt6mmah4nju bk7kfaq4SMMC3+Ga3bR30oNctzmNW024u70M0jQx5yNg4zWxo0V3bsYpXMsf8Dj+RqSa6jwkrRny SeSeCv1FasRgWANER61OljZxSdzH1yQxWpHOSe1cRfStIXdopAsZ4l2Hb+deg3SpO5+QOygsF9ax vEj2o0JNsO0zAKB3yTyP0NQQ4Xu2Q+F7lmBcZwwwcdjXSYl/57t/3yK5HweTbzfKdyjrgZ/MV232 2P0X/v3WZzSWpzX2C80ZbS4urIlZUVmCndxwSPr7V6Jp+q/bY4NlmYInj3pu4IGOOK5/UtU0m7to dNeUTzOi8A/6vjr7Gtfwrb2Fpphjtblrp+WllY5wem3rx9K7FBR2OWxxWsw3i+IGNoQpMg8wlNxC dyB64qxFDpjyHOqMjHPE9qQc9u1doNPsbnN9+73KAA7Hpj1rkNTURas7WsqtCWJ+ToKyS0R6FOab ZDqKzQbEhEN/E4+Z0Gwp7+hFSWWYbNEbPGcAnoO1LLMZeM8elQSziIfMcVEzVO7JnvrS0kVrqdIV bPzO2B61xGva1HquoWyWbE2cDnYf75I+9/hVPxxqBnuFgHKwrkj0J6fp/OqFk0flwKOSnJ/EU0rR uZTqXfKjsPDm+3vXZRkBQc9jXUf2nN/cj/Oqnh3TlishcXH7pAgd5HO1QPStP+0vD/8Az/2P/fX/ ANas0m9TGUlex5LJdTSp9qRpElAw5J/zxXQ+EdX1CGyuks7nbNHz5Z5Drg5z/jWCkqXKA42Sbdrr 0Dfh61Fp982jXzz7Qf3bLz6EV6UldHGnZnWHxHqCWE9pl1WYh2R+CD6j61Ui1yUna6sK5Gy1+5Fw z3rtMHP3m5KgnNdhp4trpFkJBB6EVyyi4ndTmp+pqW+oTTITEmD/AHm7fhRJtgiku7pyQiliW7AV bhigiUKgyTWb4pgeTw9dTlisEYwx/vH0/lWSi5ysbyapxucKI5dbuLiVpVjaV92GGe/H6cV2ng7R tAEix3yT3F8rYjQNhTx9K4K2maJldWwR0rYh8SyRzKhtMTIRsljfb2/Sux04tWPN9pK9z0+aG0ub k2lyjRpEu6OGWT5SfX8P61N/ZVl/ctP+/grk9K8VSX12j6lZQXFuv3oivJGPXPX/AAroP7f8If8A QEH/AH0KlUrEOV2ef3SrewrMMCYKNxHBbjv71kXwLWwdh0O2T1xV8EiFWX76gfSocrdRc9HGD/hX QSYoi2tt64/UV03hG4DyvZScEfOmfTuK5+ONstCw+eMkA+orotH0q6tbe38R7IjawzqrBm5YE4PH p1FZTjdWNKcuWSZ2kcZ3JHGMu7BFHqT0FQ/E4rp/hm00qIjdNKNx9Qoyf1Irr9O8Ow22pLqUjSAR IfKhYgqpPVs/TpXm3xLvTd+JltwcrawhSPRm+Y/zH5UqVPkTbNa9Xn0WxyJtlZEC8NjrTZUwS+Bk N29hip7ViwKngg8VFcMMqvYk1qcxpWl1sWMk4JyM4960ftEn/PQf98iudeQragg9HGP0q19um9R+ VO4iYAJGmCWQrxnqPaqOmSB1lT0bK1eu1eK2LliQEBI/rWVpTbVZv7xo6jLN1HmTzVyHTGfpUqGQ wbUkcRs24x7jtz646UySTZeRhj8si4P+fxqaNRDMYz0bkUAe46TfxTeFrG5ZgA9uu8/QfN/I14fq 16+oaldXzctcTM+PQE8fpXSjxI1p4MawR/3rO0Sc9Fbk/wBR+NcgzbUyR06e9MB8QGwt6A5qpck5 RvSrMrGO2OW+9jBqk9zt4ZQQe4NJgK7EwgdmdRVjKf3zVJpg1srJ2fH0pmZf+etSBt3Or7rbyzAM NHz83tj0rF0+7MaY2Z/Giii4E15fFpLdvLwVJ79atDUsx5MOSDwd3/1qKKLgQXuoFpIiEI68bqbH qBbJaPPPHzdBRRTuA2e+3A/u/wBaqO6yQltpBHvxRRSAhgk4dSDgqe9Q+Y394/nRRUgf/9k= ------=_NextPart_01C8E823.DA10E9A0 Content-Location: file:///C:/8E69C634/Classof2004_files/slide0109_image009.jpg Content-Transfer-Encoding: base64 Content-Type: image/jpeg /9j/4AAQSkZJRgABAQEANQA1AAD/2wBDAAoHBwgHBgoICAgLCgoLDhgQDg0NDh0VFhEYIx8lJCIf IiEmKzcvJik0KSEiMEExNDk7Pj4+JS5ESUM8SDc9Pjv/2wBDAQoLCw4NDhwQEBw7KCIoOzs7Ozs7 Ozs7Ozs7Ozs7Ozs7Ozs7Ozs7Ozs7Ozs7Ozs7Ozs7Ozs7Ozs7Ozs7Ozs7Ozv/wAARCAD4AJwDASIA AhEBAxEB/8QAHwAAAQUBAQEBAQEAAAAAAAAAAAECAwQFBgcICQoL/8QAtRAAAgEDAwIEAwUFBAQA AAF9AQIDAAQRBRIhMUEGE1FhByJxFDKBkaEII0KxwRVS0fAkM2JyggkKFhcYGRolJicoKSo0NTY3 ODk6Q0RFRkdISUpTVFVWV1hZWmNkZWZnaGlqc3R1dnd4eXqDhIWGh4iJipKTlJWWl5iZmqKjpKWm p6ipqrKztLW2t7i5usLDxMXGx8jJytLT1NXW19jZ2uHi4+Tl5ufo6erx8vP09fb3+Pn6/8QAHwEA AwEBAQEBAQEBAQAAAAAAAAECAwQFBgcICQoL/8QAtREAAgECBAQDBAcFBAQAAQJ3AAECAxEEBSEx BhJBUQdhcRMiMoEIFEKRobHBCSMzUvAVYnLRChYkNOEl8RcYGRomJygpKjU2Nzg5OkNERUZHSElK U1RVVldYWVpjZGVmZ2hpanN0dXZ3eHl6goOEhYaHiImKkpOUlZaXmJmaoqOkpaanqKmqsrO0tba3 uLm6wsPExcbHyMnK0tPU1dbX2Nna4uPk5ebn6Onq8vP09fb3+Pn6/9oADAMBAAIRAxEAPwDo/DPg zws2hQG+0ywnuWhV2JhUlcqPapb3RPBVhc2UKaVpTMz/ADFrRCCPfius0K3ii0OxKRqpNtHkgdfl FVm8K6dJfSXMyeYHOQp7GlbQBE8HeFWQEeGtIwR/z4xf/E1xvjTw/wCGLFdtrpOnQS78vtgj446A Yr00DAAHavOdT0B7vxpI9zbBLEuJHyeWXvj60PYRxH2XSJiVl06zR+gKWqAH8hXVeGfB2gXrxfa9 Os9ynOHhUB/bGK7E+G9FlliS306HyXUlnU4I9OKv2mh2VnKDHC2EXC7myOalRaKuZcfgvwhes8ia LpjKvyFY7SMAEfh1p2l+AvDFnbNE2g6bP+8Yq8trG7YzwMkVsppdtEsmyPBfk4PWp1TyIQqgnA6V VwsYl74G8Lz25RfD2lxnIIKWcan8wKgtfAPhiFiZND052Jzg2qED25FXrnX1s9zXMQVVUnAPPt/K o7bXl1KMPZpuP901DaNFGWxJ/wAIb4V/6FnSP/AGL/4mj/hDfCv/AELWkf8AgDF/8TWhBdK6jcec c46UpvIFO3zVB9DVXRHKzA1jwN4cn02VLfQdLglx8rpZxqQfqBXAX/heygTbNpNlAW4BFunCjv06 mvWbieOeIx5yD1xVF4YAmx2WT034rOb1NIx01PPdB8EaVrl28BsII4oUzvFso3E++K0/+Fc2VneQ xnTLCVGkGCbdGJAPOciux0ezgsJpmjyiy4+UnIGK0zNGZgOCQOtOFmjOSszLHgzwtn/kWtIx/wBe MX/xNcfeeFNIufEUsEWkaTDaK/BW2jGD6dK9FuLhbaBpmVmVQSdoya8rfUZLq+kO0KJHLMR3yams 7ISNXUfC/hzzkV9I0uNUXrDbxjcffArz3xBpunQ30aw2FtGpiyVWJRzub29MV1YNwsvPCZ5rB8TY /tUDI4jH8zXNFtSsNnok+oXEGnaa2nyNcH7NEXiA3KCFHftXXWk0r2sT3MawyuOUDZwa4Tw/d3ek eFDfytAsaQqUSX7zHA6Vk6j4s1DV7q2MMTRmM5XBzz612KWl2Qer7hk+3WsnUtIl1DU7WcT4tkyZ Y/73pXPy+K5IrOIvNbxTFNzbXzuI9R/SqWheKdS1+/8As0jmCEf88uDVcwztU0sQ6gLm3l8pNu14 guQ3v7VfHHU1iWAv49SMDXDzWka/fc8knsauXV6SDFCCWPA29SfQUOSRSi2Z2v8Ai6w0VDGZA1we ijtXGzeKtZuZleGZ3Q8/KMD6V09p4Hgkke61adrqeRt2wfcQeg/xq++j6fApEcCgDoBWcubqdEFD Y4q51W9vrcRT7j/eyOpq/o94bJdiLtDYD/T0FaVzYRB8hQPaoBaR88VFzo9nE0IdashG0b3CeYTl jjAz7fSsW88RW/mlIofNGeWXgfnUd1psUmQV61kX+iu6YRzgdB2FJsXs+xrr4gjXG2Eqf9/FXIfE NpOwDkBh7V5vdHUtLck7njH94ZFadlfx3cCuqIJPbI5o3M2mtz0+1u45IwVcNVqAgSiXOcdq860/ VLi3lAVmU55B6V1tpqfnIAyoreoPB/Gou0S43NLWb930+eFI2JdcEg9BWHpGj2f9lNOsDLMGPzSe lXZGe4/iIUfdI6GqNwksEbLG7Ev154xUyqN7mbglsMvJrKBwPIR9nJPQE/WuK8VXNlLq/mx4AeMH A6Dk10cFhezXW14JbiEH5ljGSBXMeJ7COLU0QW0ygRDhoyD1NEISk7mbZ6ra6bbPo1hczQCeOO1Q mIqDn5RyK5jxDa21vdJe2VhJCkgwqhdoP4V2Vi8H/CNWazvtja0jBweSNo6Vzt1pWpS2qSz3rNbq xWJMgbV7Z/CuudrErcreHk0ZpJZdQgjjZRld46//AF6kQ6PpOrJeaW/zSSZkt8dsdqSCaLSomjSa KVpOuVzim2Flb3N89zPNlmG2ONBjmsI1eVcrHbU7GylkuojLKmzzPur1wPeraQxx/cRVx6CmwRrF EqKMBQABT2baK6IrS7Bvohs0giiZyelc/d6lgnHIq5rFxIkBwQAe1cm8ju3JOKznLWx2UKel2W5r xpXJzgU2ObJ61VB455qROKzOqyLRIf0qF09OlPU8YobBFUBn3ljFdRMjKCCK4q7sJtGvCFysTnKs Ox9K9BIGeao6nYx39s0Tjr0PpU7EyipI5y21JXURzHaex9a29PvHVSjkbD3HSuOnims5yhGGU4IY ZBrT0/UVOBtCuOCB3pM5zubW6MbqkspZT9x8/of8as3EIDAyIWXk8HofSufs7xJU2AcHqprWtLrD eVMxKDgf4VkxNXL2hXP2aZ5TuEbfe47dq5Txr4msLnWkaPzCqQhclevzN/jXY3L27W5WMhFYYBA/ WuC8VWVlFe2qh0J+yruOO+5q0ozlstjmlHqSabqF7BpMKb2aMwqoJ528DpXST6/J/Z1va7QwCAZA rHt3V9EsogqsGiU4x7CrC2ayNG0jZVRgDpWMpiSM2QXV3cgRxlVHet/wzp1ympI7BHVfvMW5H4VW uoJY7fbGcZ+6FrV8IRTJdTGZG2ogKNnhiRz9aUNZIdrHYKMKBQQc9eKjgkMgYkYGeKqajq1rZqVk nRD9a9HmXLcSi27FbWZYUXDNzjpXMOAWJHANMv8AXbKW4yJt+TgHtSRzxygMpBHasW7u56NJJKw4 J6d6kRMnFRmVVBalivIiwVmwTQalkLhelIRmpQQenSkZMH60WFch5zRt9elPIx1pBzU3BnPa9pUc 0TSKNreo9a5GKYxyAsOUOG9xXdarMCmzOK4nUofIuRKo+SQn6Z7iiTOZ7mxbXHkyKwbiutsAlzB5 4fPH5159ZzbogmcleR6kf/WrrvDV9Fu8qQYB6ZPQ1k2DWh1f2MSIUX5kChsjqK4jxfaldTg/d9bc H73X5mrror4JcAqxKD7yr3rmfGVzHJqsDKW2m2GP++mpU1szGd2tRIb+JNNtEjUZECbiPoKm/ezw KY8gA5Oahs7izXR7dY4xuESZPqcCmvqAjjEbjGegFZ6P1Mrlya9ckBeWxyF5rrfD0by2JJjMIPy5 Iwxrjba5u5SkcUjKiDp2FdrpcxSaG06kQrzu/iPJ4/GrppKWpcYt3t0L92xtNLfB2NjAx2NeLa3q eo3V/LHGjYRjky8Z/OvbtQszfWphErRHOQyjkVxPimGCCWOCNFfYgDZHzE+tdU1Z3exrQfMmlucC NN1SO2+2SRK8GcFo2zit3QZvPjIBPydahlDspRY3VO4BwDXRaBoMdpov291KvNJhQf7o7/zpNJ7H TG8dGyO9tnaDg445NcxfTi1+Z5uR0rqdSkkClU4zgZ9K4++09rm7ZGkUr0HPNRbU1ltsaGleJCSI myyjoQeRXR2mopL/AMtM+oIrkbfw1j5toXAOPLYhs++eMVe0xryynWC8T5CcK1XL3eplBN7qx1hI YBh0NRFtvP50sRBiwpzio5flB9MVDNOhjX8qCV0dQd3fuPesK+iEsTpgMsgypx0cdqv6jKpmIbII 43D0rGurtIZdksoCtzuz0b1/GpZzso28jQTgk4B9fX/6/StyzuDDKHUkKT07j2rGuF3sRlSx5XHQ n0/GrumzeYqZyy4xz1FRIaO7s5kmhVkyrHhj2rmvFakalD+9b/UD/wBCatXSbnbajLHOcZ6AVieK YE/tVT5iHMQOA3Tk1UNzCeg2xiZLSAh85jU4/CrVwxkRQyYJ6GsrSpZI4IiwZx5Yx+VarXbSMECj P8qiSsc6LujsxuhabwhkIG9+g/Ou+s4xDrE0hGWkcRrgdAFGf6V5xbtL9thWNPMkLDCjvXqNrBIN RmkYYQNlcj1Uf4VpTjdpo2hK0ZLyNGsPXUtbh0glALHgbfvD8at6vqIsLYkEBz0rgNQ1YhmdnLOx 9ec10VJrY0w1Ft87Ong8Ip525pQ0R5GetT6vIq7bKHASJAMCqOiavbWGhLcT3KtdXLHCF+QBwOKo pfLNM7s5ZickmlzKx0U4Sc25bIbPCWXJGaz7iwikXO0f1rVYpLzG4OO1Ubm7WJsSplOhYdqjQ6XG 5ThtvKbCkkehrSis0nUGRM46Z6ipbURSAFSG96vrCAuQeKaSJehBFCIkIHSqtyP3b464q47FcjNV JiOcisnuT0OXubSW5kJQEMhx9aqL4VS7cy3auy/3FPH4V00skNlbtNJ9zPJA5NaaiFLTzRtZMZyO hou2xRppas8x1jSorGBWtHkMTZ2hjhkZe1Q6Xc/6Skm07ZcFsHHPrW/4pa3YWqoNnmM7k/kOfyrn bSFrdthHAc7T6jtSexFRJTsjvtPiWdAI9oyemOtZPiyJ11OIbv8AlgP/AEJquaTKVmVVY5xlcVD4 ulmbVISdv+oH8X+01KnqzmqoyoUdNPt/3g/1a9O3FW7OwaQGRnOD1ptoY59Pt3UYIjUfpWnptxF9 stoXK48wb89AKk5Ukdd4P0WCKI3rRkyHhSw6CuoDKsuGf5n6A+1Qre2UUQAnjAA/hNEV3bXco8v5 ynO7H3fxrtjFRjYG7s5TxhI4mJ3HYBz6CuLt0kvJt7DqflHtXa+LVMiOP7zY/SvPr3WptFKvHbmQ t8q/WueOrPRi7QSN1ohBCQ9qkpI43DOPcVT8+4LOxhYK3ULmtKDT/EF1YpcysgLIrNHjlSTwKmTT tZjuRb/ZopCy7g4OBVPU0g1/MZtlYQJIbiGF4pG6srnn8K1JArwbCvBHQ96Ty9YgY4sUYK+w/Wor jV47S48jU7Y2r9Nx5WhWRs1J9SpaXTWF2IGY7GPyE/yro4rolevaubvVhu43KOrEDKOp6VqWLF7K CRuGIGRUNtbEc1y9LLk5qpNIxI2nHvUjN71EQCpBqE9QHzW63OnpE68kE/hUFkznSpIu7HYvvV2C MSKu9mCqOinGRWNrOpJo1lsiIE8m7yE/u+rGtC01FXZyms3aXniOWON/3dsvkqD0O08/qTVeCR4S kTJviYnIHVSD1HpWbpTMbuQyEkuSST3JJrTMe0BxwASeT9aJaOxw3cnc63S4RJgrJn0GMGs7xXHO upxgmTiEYy46bm9qt6JKwCtu+UdareKb1ZNSiYA/6gd/9pqzp7iq7Haab4R06PwvaKgcXTW6OZt3 8RUcemK4+60poJ2gju4/PB+eOf8AdN+Z4P4GvSdP82TRLEKAi/Zo857/ACisjxHpVvfRBWYJcIMx SY6+x9v5V2OEX0ORFTwxYXMmmySXs3l7DhIxhjj1yK6TRolEh2l2wCcnIFcL4Z8L3Wo6sWkWW1gt 3xOVYqSf7oxXqaoqLhFAAGKaikrCehyviOB5bWR1HMbZP0ri4tNivgY5VyG/T0r02a3EhmVgNrqR WXb+HbZIBL86MBlivf8ACueKO1VEkcxPJr9gIktr6FoVxlJI/v49SOamh8S6ykmTp1q/GNyysP5i tzWLaCXS45wRuUY3dK5Frqa3l8uQAHPODnFVdG0PZyWsTorTxDeusaXOmhPn3O6S7gPfGOe1UNZt 11qOSO4tlRXZjuJy3Pf8hT7aZihzj2NJNOTnpmjQrlitYox4NGtLLbBAhVc5Jzk1rqAihFxgVXHB 3E5IPen7/mLZrKbBakhbmoZpdi7qa0mTWL4lv/s2lTsjfMw2Lj1PH+NQldl3srkR+IdlZ2DKsUk1 wuQFxgHHfPpXMNqd3rN/He3LAySA8DoozwB7Vg3RAOF6YrX01AsJc8bIwB9Sa6GkkcsqspuzHWAA ncrx83IPI61tlVliAx13Zx68Vk2af6RLxz5uP1rotLg+0xrn5VySx9qxqS1CKsjV0i1dLIkZJx0A 5rG8Sqo1JB5TA+UM89eTXZW9k3lIYjuGQUAPJH9aw/FtqianCDGit9nXcDJkg7m6+9FKOplUlc6e Txba6bodnGMmQ26KCBkZ2isqw16TU7rzGnVQD0Ga4e/vJr6ytJdzFBEq/wC7x0qlDqdzYo8aSbVb 0r0LHNc9o0rxRaxXUlhLOm0D5WHY+/rXQ2E0r6dFJcMDIy5Y4x+lfPulamI73Msvl7iPmx0Nej2H jZrGBbbUEk8txmCTGdo9GxWcrrVFq0tDrhqEaagLd3HznC/X0rUzGkYBwFPFeVahrT3Fx5kUhUq2 QfQjoa2rrxiLvw+JFIW6T5ZUz0/2h7VhTk0b1aWqsburavpxi8qMLM49O1cfPCrzGRAoHvyT7/Ws mPUi2Sz5YnOamTUCVIVgfam97nRBKMbI00kKL2PGMineZ8xOeelZ8F0G5bp6CrUUoKkvwPShtCu2 TEEjpgVFK4QdqiudTiX5I1LN6CqDGe5kyx2j0FYPVmqRZa5ydkfLE1yfiu68y8gsEbOweZJ9T0rq tsdrCzngKCST6V5td3zTai9/13vuwfT0/Lirpq7uZ1pWjYz7kt5+MY7Vqw3GyAKOjSAZ+g/+vWbd Kq3TdSAcg+3UVsaRpF9qbpBbW0kpX5sKvc1tNKxyxepYgkxO5XoSzg/p/jXdeHdPmFmCsavKAMo1 QaD8ONXhBuL2IcnckW4de2SK6dbG80yNY42iaZzlld/lRR9OvrXNJaluatYu2lmlnbPcXlwu7bku MBUHsccmuA8V+I9KuNWUwR3bKkQTcV+8cnke3NbV3Y33iCVllllaKIkglsLj6Cud8R6PFbXsESrg CAdBx95q2gmznlI5ewnljjWKQExMo3D1FOu4fLOGO4Nyreoq89ur2Mc9o2dsa717jioN32q3CFQG XlSfWu0yM7OxlZSQRzXo0ccet2MQSEuZEG3Zk4b8P1rzeQ8nNdh4KuGSG9jd2cpABCu4gAswBPH5 1MiosqM13aOVljPloxTIySMepp7yeYCVY4IqHVfFlrpt6unWURNmA3msBgsT6e3161Fp8q3Cy/vY 12jcqngsPQVhOPVHTSqX91jS0sbfKcipI7uVW4OKsqiv8uOacLEM3ArI3sPhvJu3J6VfiE05G9yF PYGoraxIP3fxrUt7UoKzbNFEiW3RBgCrEcYReRU6wqpzjk0y4cIpOQBSsaI5vxjqAttL+zI2JLg7 RjsveuMsY4ncJOuRnrng1e8SXMl3qnnNkRj5UB7D1qguFIA5z29a7acLRPMrVHKeh0KadZ3DEm2V ZkAGMnDDtWro+pR6PfxMPOgCMCQGyCO4/wDrVz+m3wGFkbKg4Hqv0NdAttHdxCVX8092X19605UY 8zO507xG+tSvBbK8ZOWXy5eVHqc1BqxvoIGaX5snHmLwMdCT78Vy2lapc6NcFrWWSUNxJE8eVb0z xXWvqlv9gVpLm2jR1Cud4I9x5eCBWMqMdkXzt7k2nXsU9oLdGUfL8xFcz4stol1GArc7la3BB/4E 1aOn6TZalOLfTdQWKVySAkm5cex6/gaxPFXhe7stTjge+ZwsI28dBubiqiuXQjc5DTrt0SPBwVUY 9xirkipJukiABx8y+nvU97pVpNY297pilcxL50O7lWx1H19KyxK8I3Z6elbkkdzFuJc96dp15JZz blyQwKkBiu78RViRluU9yMmsycNFbso++2QPXHekxmddyG6u5JjlizHk96mtb+WBFQruCng55Aqu i4YAipVUcj07VNgudZp18tygYEEit+3dWUHNed2sjWk6TDO0Nziu3s3MkKSryjDIIrnqRtqd1Gpz Kz3Ogt9rL0qwZQg2gc1mQB+qscVaVSSMk1g2daLKtkbs1Glq16XwP3cfX3PpQ7EJtAyTwAK6W00w WlikBwXJy5/2j1/w/CtaEOaVzGvU5Y27njHi+NLfVkthgMqZI+tYy9N2NwHarniW7Go+KLy4U5Qz FE/3RwP5VX+zOB8px3wa7DzGxwZcAggE0k97e2N5HLazMjOnzY6HBxUa/fwy4NTXMJ+1woecR5/U 0AWItb1S8YxvIASMKR61PDK8zwzHcN3yuPRhWZDlJ8Akc1sWkaSs8iybN/zMh/veoppCN3TpmimS 7gjxPbvuUjg4/DrU3ibxTe3t/DK/lEiADI7/ADNWZZSyKpkiAYqc7Qaz9aWFr0MCQGTO0H7vJ4pt AaNlcf6NEwcYEYBHrx3qrf2mG8yPG5ueOjj/ABqOI7LeE4wQi5GeoxU6XBdWhkACMcg9xTAzYCAx UDAzxntVPU1aC9jnySrDGD2Nas1uTI3/AD2XqB/F7iq13H9qsmj4Mi8j60mgMq5hCsJU5VuelAHO 5e9LaOJFMEnfp7GlVGRmjbqtSA05HBrqPCd4JEa0Lcr8yg+neudULINpXBqawuJNN1GKcLgK2G+h 61Eo3VjSnPkkmelQooXJqX6U0RSwpGZUKLIoZG7MD3B71X1C/FqiQ26+bczMEiT1Jrh5Xex6t1a5 ueHbQXepNIwylqAxH+0eg/rWt4kvf7M0K/uwcG3gbb/vkYH86t6Bpy6RoUETHfKwMsrnq7nkn/Pp XH/E7UDBoFrZKcPezGVx/sr0/Uj8q9GlHkieZVnzyueSRxHzgWHTk/WtDAEGevvVYHHJq1HiWIqF OevFNGJC1uZxuC4I6etDAm+JznCAZqyg+XO7HYColUCWY44zTAqygrKGHrV+wfa5OcgjpVGQ5yOu DVuzZFnTcOtIC5EwUearEEHnaaqapsNypDHlAf1NNnPlwl1I3Akfe5602/YtJE27rED+ppsRfsyR DGkn90bW9sdKbODtGzGB2psLF7KI5+ZQAPyqWQ785zllzzQMrxy+chf+OPr7ipDtkbcB83f3rPtZ zDdMjHgmr+djlcE4OM0IDFvYTa3pKjaG5FTti4RJEGXXqPUVbv7b7RFvzll/lVC0lML8etICSMDa VIH1rTfRtQWwF7LYXAtiAPOZDtxVMlbeeOYLvjDhig6HByRXo99430ifQLqO2meWS5RlW3aIgpuA +8emB7VEm07FJJlvwVfm78MR29xGs8cLGJkYZHHI+nBrZ03wlpv9rvqim4Py4jjkwRH64PU5rmPh TdIk9/YSx79yrKmR3HB/mK9OUZA42gdBVKOpSm0rIgvG2W+xeC2FUV5B8Tr37R4oNqrfJZQJEPqf mP8AMV65K6m6DuR5cKl2PoBXgWqXbatqt3fOTm4maT6DPH9KshmeQFUHuBinWshM+DwDTioZeTgZ xk0xIysq7ThutSIuoMsMEDbzioS2EbB61KHIVj1znp6VXkXZGeOcVQisjFic81YhJV0I6hqqR8nA zUysQAScfNUjJr44icFR1OD6VSunc+V0/wBWO/uatX7MUYg5B5qjcEYhPcxjP5mhgb624ht4Xjbc jquRn7pxSoylcnseaktkkjhQOVYFF784IqGRPJYqfU4PrTAxZm8u/wCP71bYPmRK+RyP5Vzsj7rt iT3Nblqxa3Ck4A6UkBIxAHP4is+5thHIWAODWhMm5Gxg5B7VBHie29wOKYEdsQ48tjjI4PvTzCF6 Zz0OKhAMbBTwR0xV75ZUDc+9FgOj+HNybbxZbqxwJkeI/lkfqK9lZgFzjtXgmjTtp2sWl0D8sMys eO2ef0r2+5uVSFmDduMU0howfGGpf2f4T1K4Bw8w8hPx4P6ZrxdE+Xk9smu/+JWofurHTQ33cyyf Xt/WuBbhTxwaGJkBOTsPODmp1GI2fALHgYNR+X26mpoUw5z0C4FKwCyLttcY49agdgY8dcD1qa4c 7FXI69KgYjBHByKAKY+Vs8cVKGyhA+tMdCvIp0C7ifr0qQC8fEKDBzt71DcR48of9Mx/M0+9GZIk 9RUV0370c5+WhgdCInms4sECVYxtPrx0NV53LLEZOCoIIz6VqJEJLOHYhVginHrxWbqkTCyabkMn BGOx71TQHPJ88/41vWzBI8EcVhWwJmyK2YiwG72xSQFqNiW5JUGs+zl2TtEezkc1fU/Lg96y5WMW pvtHfP5imBpXEO/JTB7g0tswKYb+LipYmEkXPBqqymGUkD5Sf1piLpT5D2IFenabqq3Oi2czN/yy BfJ/u8H9RXmAbGHHJ6EVfl1lrbwxLbI2HkkMa+wPJ/rTGijr+qNq2sTXWcpu2x/QVQ3dAMkDuKai 7l4FOwF5Y8enqaQhkpZUAXh2/QVLGWWXacjiq4EjSeYxBOc1cJGQTjdigCpdtiYew7VD9pj3YJI/ Cklm3ytIORnioXYNngUmMsGZGyMjGOKbCw+0BEIO7nrVHJVsZot7jy7rc33SpU+2am4Fm5wsysSS FB5NUZ2ZpM9Mjp6VcvEOxGyGXP3geDVWZlLD6UMDuYpk+xwsxU4jXlG5HA6g1Uupopre4UshDxna c9eP50UVQHJ2r7XByOa2IXAUDcOvTNFFSgLccg5AK8DuayL91XUwwIIKjODRRTYGhBMAg+cD8atM ySRgllz9aKKaAI5VKY3D6Zqjqj7BGocFQ2eDRRT6CIoriMIzM/yIOcdT7U+GbzyZJGVR0C+goopX AmjZAM7xz70xpcyyESDgADmiigCrK6KCCEYe3FQCNZhlZVX2aiikMgmhkTLY+X+8DkVXUgOeaKKl gXLMNMzQnmN/vH+771nvuzy2aKKGB//Z ------=_NextPart_01C8E823.DA10E9A0 Content-Location: file:///C:/8E69C634/Classof2004_files/slide0110.htm Content-Transfer-Encoding: quoted-printable Content-Type: text/html; charset="windows-1252" CHSAA Hall of Fame
Fran Sixkiller
(Lyons, Longmont High Schools)
nThe late Sixki= ller coached 18 years in volleyba= ll at two schools, winning 3 state titles at Lyons = and two at Longmont. Her t= eams also finished second in st= ate five times. She posted a coaching record of 389-75 (84%) during that time. Sixkiller ‘s teams went to the state tournament 16 times and playe= d for the state title on 10 occas= ions. Her Lyons teams won in 1986, 1982 and 1977 in Class 1A, while her Longmont teams won the 5A title in 1993 and the 4A crown in 1994. She also coached track and baske= tball at Lyons in addition to be= ing a class sponsor.
------=_NextPart_01C8E823.DA10E9A0 Content-Location: file:///C:/8E69C634/Classof2004_files/slide0110_image010.jpg Content-Transfer-Encoding: base64 Content-Type: image/jpeg /9j/4AAQSkZJRgABAgEAyADIAAD/7QE6UGhvdG9zaG9wIDMuMAA4QklNA+0AAAAAABAAyAAAAAEA AQDIAAAAAQABOEJJTQPzAAAAAAAIAAAAAAAAAAE4QklNJxAAAAAAAAoAAQAAAAAAAAACOEJJTQP1 AAAAAABIAC9mZgABAGxmZgAGAAAAAAABAC9mZgABAKGZmgAGAAAAAAABADIAAAABAFoAAAAGAAAA AAABADUAAAABAC0AAAAGAAAAAAABOEJJTQQAAAAAAAACAAA4QklNBAIAAAAAAAIAAFBIVVQINQAA AAAARAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAUEhVVAg0AAAAAAAEAAAAADhCSU0EBgAAAAAABwAHAAAAAQEA//4AJ0Zp bGUgd3JpdHRlbiBieSBBZG9iZSBQaG90b3Nob3CoIDQuMAD/7gAOQWRvYmUAZEAAAAAB/9sAhAAB AQEBAQEBAQEBAgEBAQICAQEBAQICAgICAgICAwIDAwMDAgMDBAQEBAQDBQUFBQUFBwcHBwcICAgI CAgICAgIAQEBAQICAgQDAwQHBQQFBwgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgI CAgICAgICAgICAgICAj/wAARCAJWAWsDAREAAhEBAxEB/90ABAAu/8QBogAAAAYCAwEAAAAAAAAA AAAABwgGBQQJAwoCAQALAQAABgMBAQEAAAAAAAAAAAAGBQQDBwIIAQkACgsQAAIBAgUCAwQGBgUF AQMGbwECAwQRBQYhEgAHMUETCFEiYRRxgTKRCaEj8MFCsRXRFuHxUjMXJGIYQzQlggoZclMmY5JE NaJUshpzNsLSJ0U3RuLyg5Ojs2RVKMPTKTjj80dIVmUqOTpJSldYWVpmdHWEhWd2d2iGh5SVpKW0 tcTF1NXk5fT1lpemp7a3xsfW1+bn9vdpanh5eoiJipiZmqipqri5usjJytjZ2ujp6vj5+hEAAQMC AwQHBgMEAwYHBwFpAQIDEQAEIQUSMQZB8FFhBxMicYGRobHBCDLRFOEj8UIVUgkWM2LSciSCwpKT Qxdzg6KyYyU0U+KzNSZEVGRFVScKhLQYGRooKSo2Nzg5OkZHSElKVldYWVplZmdoaWp0dXZ3eHl6 hYaHiImKlJWWl5iZmqOkpaanqKmqtba3uLm6w8TFxsfIycrT1NXW19jZ2uPk5ebn6Onq8vP09fb3 +Pn6/9oADAMBAAIRAxEAPwB4/FTxL+W+u/r4f+xlyTd3vtFeNVq/zPFv8PL1Wu/6xYr8Pz56vUzf 1jxb2fr9/PV6mbEc7fnw3oppGf12xb/prflw2oorh/XbFvn/APkrcEVB+vf1kxb/AKa35/2c9Qip 9w7MmLf9NbTgdo1rr+smKf8ATXPCmvU9f1kxf/pr13PV6uv675t/6a9d+XPUbU9f5x81/wDYXV3C ivUssN6kZsB/5iyu17/78+G9ep5/ztdQv+wsxz/x5c9XqeP87fVb/t4OO/8Ajz56vU9f57erH/bw 8c/8eZ56vU84d1+63af83Yxy/wD3s+er1e/2j/UL/wBvYzV/48zz1er3+1H6hP8At92a/wD1JOeo pr3+1p6msN/67dmr/wBSXhtXqYsR9bHqav8A9XCZq/8AUlzNwRUVUjP9vz1Yf9xNZ3/9SXM/NRXq yf7fnrG/7iYzx/6kuZuU0J6KY/ndcP8Ahw31tf8AcTOd/wD1Jcy8r+Xb/oj2USyae/8Ahx/1uf8A cTWeP/Um/s5v+QDoqs08Yf8AiX+vDDqH/q5fO5+nMn9nGl7tNq2pB9lb1Gnb/hz78QH/ALirzr/6 kY/o5v8As3lH9Eeyt94rprJh34qn4hB/6+vzVp4/zLhQd38rPAUdfzyla34r/wCIDQ0IZvUpmh2H YtiCk/nw2/s1k/8ARHsol/n56aff+HZPxB/+4mMc+4c9/ZrJ/wCiPZXv5+emnOg/Fv8AX+/2/Ujj L/8AElU/xHPf2ayf+iPZR3/PTXGg/F+9fr6P6j8Yfw95EP8AEcKP7OZV0D2Vr+eUo/8Ah4v8Qn/u IOu/8duWOW/s/lfQK9/O6V2H/jDfiCuDu9QFa/8AxLC8r/tHK/2dyroHsr388p5oPxmfxA3HvdaU f/iWF5XP8ee/s7lfQPZT+o08t+Mz+ILQaP1UDjvZsMyuf489/Z3KugeymP55TR/w9b+IR/29ih/9 RvLPN/2eyuvfzynfD/xvvxBmHv8AVahYDtfLOWDzZ3Gyw1v+eVz/AOHwfxBv+3gYf/6jWWOFH9h8 tp6TTp/w+b+IN/28LBP/AFG8tf081/YXLaa/nppn/wCH4PxBv+3gYJ/6jeWv6ee/sLlte/nprh/w /f8AiA/9hJgH/qLrzf8AYfLa1/PDWb/loK9ef/TXyr/6jR/o5X+wuW0c/wA7rr/loJ9ef/TXyr/6 jR4TfyLK63/PKev+Wgf14f4Mqf8Ajr5v+SZZWv50K//Qx/iw4hs9dvqTW32cRC/cBwZ5Jso2Tsqs D+Yj28PaJ6Zv6yfR93PV6mbEcyeHDeimg0/mR9n8eG1FFMf8xPtPBFVq589Xqef5kfZ/HgdqtPH8 yPs/jz1G9PX8z/1eFNer3PV6njnqNq9z1epZ4d2HPV6nmg/p4UV6vfzL/W4b16vfzL/W56imvfzL /W56vV7+Zf63DavV7+Zf63PV6mLEcS/0D6PDgioqoNcRxL4/G3Dug7SN/mR9n8eer1cuer1e56vV 7nq9Tthvc/r489Xq5c9XqeOer1e/mf8AoH6/fz1ep5/5JvPV6nn/AJEPr56vUy89Xqef5aPb/DhJ XqWdB/Tz1CKnznq9Xuer1M/PV6k/z1erliOJfl489XqZ8R7HnqDtI3nqEVM/PV6nvgdqtMv8yPs/ jz1ep64U16v/0UT+LJ/1ff6lf/BkH7ODTJNlGydlVT4jiXx+NuHlE9I3EcS+s8N6KaZv5ifaeG1e pn4IqKqx0H9PPV6s/A7Vax/zL/W56jenzhTXqdcO7jnq9Szwz97nqNq9z1ep44UV6uX8yHs/hw3r 1e/mQ9n8Oer1e/mQ9n8Oeopp4/mQ9n8OG1er38yHs/hz1epk/mQ9n8OCKiqvfzIez+HPV6kZiOJf 3cO6DtNHPV6uP8tPt/jz1er38tPt/jz1erlz1er3PV6nfDsN/mVv+mNz1ep5/wC9Tz1epn56vU8Y Z+9z1ep34SV6nsYb/Lb89Xq9/LR7f4c9Qip5w7sOer1PvPV6njnq9TPz1ephxHEvy8eer1M38yHs /hz1B2uPPV6mjnqEVM/PV6vc9Xq58DtVpn56jevcKa9X/9IAfxdMRt6/fVaAbWzIByTN3RCRXjVX v8yPs/jw7onpG4jiXw+vnq9THw2oor3PV6vc9Xq5/wAxHt4U0b08/wAy/wBbnq9T5z1ep1w7uOeo 2pZ8KK9Xuer1PX8yHs/hz1epl4b16vc9Xq9z1er38z/1eG1FNMf+/bnq9XX8yPs/jwRUVUz/AMyP s/jw7oO0zfzE+3nqKKe+eo3p456vV1/Lf5b/AGc9Xq9wkr1dYdhv/TU56vU84j/vy+HPV6u8Ow34 fC/PUIq656g7Tzz1CKnr+Wj2/wAOer1PPA7Va5/y4eznq9Tzh3+9/wCvx56vU+c9XqZ+er1Jzgiq 1NGI4b9Y56g7TLz1er3PV6u+eoRVz4HarTPz1er2GfvcKaN69z1epn56vV//0yn/AIsh/lv4hvqt 1/56S/Jl3eVKQaKDVYPDiiek/wA9XqZ+er1cv5l/Lbac9Xq9/Mh7P4c9Xq48KaN6eOer1PlB/Tz1 epY4d3H08KKNqe+er1cf+RD6uer1cuer1PHDevV7nq9TN/Mv9A56immjhtRRXDgiq1MeI9z9PPUH a589Xq44d3H08O69QmYdls4l/v2t/JcG4R0d/wAlrrEcSwnDf+SX9fN0/XsO/wB+VBbFMW56vV7n q9XsM/e56vV7nq9Tz/LB7fz56vV7+WD2/nz1ep9w7sOB2q0689RvSg56vVj/AJb/AKvPV6snPV6v c9Xq9z1FFJ/Eex4IqtTN/Mh7P4c9XqZ/5kPZ/Dnq9XHnq9T3wO1WuWHYb9Q56vV7+Wj2/wAOeo3p mGGnDaD+nhTXq9/LB7T9/PV6vfywe0/fz1er/9Qm/wCLFhv8y/EM9Vvs/ruOS9Z/3JPkPhRQrbRB /wDNvi97f84b28U0T0keG1epFYj2P0c9XqZOer1cv5kPZ/DhTXqdueo3r3CivUtKDnq9Tzh3cfTz 1G1Ov8yPs/jy9HVZMOxL6jylEtcuer1e4b16vc9XqZMRxL8/HhtRTT3z1FFcMQ/35e39bcP8krdM 3L0Hq4Yd3H089XqGbJnTfFzfFsU4Q/zsUd/yShk/qT/Mj/KcrrXY1jPfhN/PaGn8ipG5i6bnLf8A yVD/ADnGfr57+eUT/wAjoNsR/wB4P+mLw1r1dYdiX+gd/r56iinbDsNxbEq/+Ujgiq1PeYsufy2v 1/5LPb9deEP88Fapn/5EPr57+eCjenjjdap7w7sOer1POHYb8fq56vU+c9Xq9wpr1IrEex4bV6uH PV6mn+ZD2fw56iimfEuw/Xw56vUy89XqdeCKrVz4HarTxz1ernh3Yc9RvTrz1er3PV6ueI4b+fhw pr1M38tHt/hz1er/1Sbfi64l/wBVDfVdp/z0gFuTLu+ISBRQarWxHEvh9fDitUx89RRTViPY/Rz1 epk56vV7DsN+Fr+PPV6njhTRvXuFFG1PeHdh9HPV6n3nq9Txz1er3PV6vc9XqeOer1M/Deimvc9X qdv5afb/AB4bV6nn+XYR7Oer1Mf8u/0/gioqofcuYb/Mv+YXwn+S9/28D9G2R0eLoz6b/wDQP5tn zCa7G8Y7/wBXeA/PM8oYZHkdDHiPTfNmSaDGf+Mn/JT7cu4bwE/zwUN/5FRHuomZcWw2+E4ZhND/ AOJFfnv52KJP5JRH8RzIMSr/APfp4duHf86oFU85MzHhX+/n+aYPw7/nh6a9/IqtF6d+nDFsSwHB s2ZXyn/Ov59/z0R57PM8o5yPI6DTqJ0CxbDf5zmzNB/kuDf9g7rwE/zsUefySin5zOE/84wfyXBv Dnv52KI/5FQa4dnf+W+Hb6OHf9t61/IqEvLudsJxLw/38nxvwafz2if+RUJuHdxzVVr2I9zz1FNN XPUbUn+eoppqxHseG1epk56vUz4j4fXz1epn56iilbwRVaufA7VaeOeo3p456vUoOer1J/nq9XP+ Yj289Xq9/MR7eer1f//WI9+LJ/1f96rf/Blx/kwW39zT5Cig7aq9xHseP1quHDavUz89RRTJy1N/ yWn3Dex/Xw4T0d1x56vU9fzIez+HCivU84d2H0c9RtXsO7D6Oer1PNB/Tz1er38y/wBbnq9T5z1e p2/5EPq56vU08N69Tt/LT7f489Xqef8Aft8h/wBMXBv2cNqKa9/Lf9P+Hfnq9Swy7lv+ZV3b/fyN OFX89o4/kVXU+lb0T4riVfg2LYrhNd/OP+eay7l3kYZ5nlDTJMkirRP82+U+gOQ8Zxbqhi9DgvAd /PDQ0qor1Eetjp7htfjOE9L8Jrsaxr283Vao96q9SOoWdq/Gv5p/vl4b0UUAN82Yb/yTMW+HPUU0 9YdiOLYb/wAlTnq9WwZ+G766sJy3j2TenuZ8J/nWDY9/xlueo2ofvxZc7YT8/gv9Q8J7a8KK9WtP nPMmLYd/OfZw3opoGsRzrhIr/wDsc89XqWeXc7YTiNB/yVqHXnq9Qx5L6tfyztw5yPPKD38jofsO zthOZKD/AH1/nwbZHnlE9PX8y/1uHFVpj56immfhtXqZ+FNepnxHw+vhtXq9h2G/D4X56iinXgiq 1c+B2q08c9RvTxz1epp/mX8ttpz1epn/AJkPZ/Dnq9Xv5kPZ/DnqKK9/Mh7P4c9Xq//XI9+LJ/1f 96rf/Blx/kwW39zT5Cig7aq9xHseP1qmb+ZD2fw4bUUV7+ZD2fw4U0b1x56vUz89Xqev5kPZ/Dnq 9XHnq9Txz1ep456vUoOeo2p44UV6sXCejuu+Hdap6/lp9v8AHlKJaWWHf77f9+38pv4cN69Xv9+2 ZK/nqKaEnp303xbMlf8AynC/qzF/0yOE/wDPDRxkWRVfp6M/wzP5lgODdQc+f75f1tyMM834qT8j yOrkMSw3KfSXKX9U8hZT/kv/AHcXIwzzPKGP8iqiP1VZkzZiWbf+NRi39dP5D/2EXNVqqu855b/r H/yg4KOH1E9Ef6if1Ty3/wBjr48O6J6AHEepH/TLwnhvRTQa5i6kYTiVBfFP98p9nDavUjOlXWvF um3UvBsWwvF67/fDiXfm/wCRV6tifOfX7/O16eMGxb/nDYD/AMxLmLgRo2qiPrN1Iwn/AJK2Kf8A iNZd4b0U0TfEeo+LfP2+7h3/AMLaDlPOHdWv5lgP/JI/nX8h143W6WWXc7fy2v8A99fCivUPuTOt n8t/37YWP983PUIqPFkzq1hGZLAf75ODTI87oPfyOhJ4M6JaasR7HnqKaZOeo2rv+WD2/nw2opr2 HYb8LX8eer1PP8tHt/hz1ep5/lw9nPV6vfy4eznq9XDnq9TViPY89XqZsS7D9fDnqKKRH8yPs/jw RVauXPV6v//QI9+KkP5j6/fVb/4O+P8AJgtUw0kdQooVtqtTEf5Tce3x+/j9apG89XqZ+er1PHPV 6uWG9j+vhz1FFceG1ep456vU8c9XqfMOw34/Vz1G9PP/ACTeFNernwoo2rFwno7p2w7DfrPPV6lv /LP9bhxRJXv5Z/rcN69RlOlXSXFsSr/+R4+P/Gd4T55nlHeR5HWx/wCiL0B4Tlyg/wA4PVDCf5L/ ANg1l3mPmd53Un/yOrdv5aMSwH/kk0OC5N4R0bUR31M9bMJy3X4N08wvFv51nLHv+edy7wor1VRd VcSynlv/AH04p8jjWM/+WjhvW6pw6zdWsWxKvxnKeQ/kf5N/z0uY+H1E9V2ZizJlLLdfjP8AzmsZ /wCwi4d0T0WnOXUf/QBhOGfI/V93DfI6JP53QBZizJmvEaD/AJKv8OG9En88pZdO8kHO1fg3s9t+ FFHeR/8ADCjL9Q87Zsw3KQ6e4Xi3++bAe/PGvZ3RNcxYbi+ZK/8AmuKYt/v5/wCwd4d/8s6iOg1/ mOE4b/DtxuaJ/wCe17Dsxfy7/nE/75vo56vfz2llh2dfG1Dz1e/ntLLDs7DDP9+uKc9Rz/PKEzLu dbf8wviv86/kPCiaO/53RxulXX7/AJxOfPu4c5HnlEVHJw7EhiXj9XBt/PDRRTNw4qtPHPV6nz+W /wCrz1FNPOHdxz1er38uPs56vV1/vp56vU189XqRWI9jw2r1BhiOJf3cEVFVMv8AMj7P489Qdr38 yPs/jz1er//RJx+LJ/1f96r/APwZMf8A2cku3/uafIUUHbVXHDytUkP5YPafv56vV1z1erv+WD2n 7+er1dcNq9T1h2G/UOeoop5/lw9nPV6nnDsM+P1c9XqecO7j6eeo3p756vVx/q39P38KaNqer/8A Yp4UV6njDsN+Hwvz1ep05ejqhn6edN8WzJj2DYTheE12N4zj3/MNZd4QfzqvZHWx/wCkT0T4T03w /wDzhdeP+SzgP/PO8jLPM8qUMjyOrRMOzt/WT/nE/wAl6af+XbgHo3oGuqfX7C8Sw/OGEZFIwXJ+ AgFsxjtfhSaP0TAnbVdvUTqR096b5SxnNmfPnv5Nj3/j9zbw3ogqgz1E+qIdWsexnCcUxX+S9NMB xL/jS/1d4fUT1V31m62fzL/jJ5Dwn+S4NgP/ADzvDuieib5ixLNmJf8Aem4b0U0y4bkn/sU13PV6 ln/m3/0//klfXwoo2o43pm6SYt8//vrwrhF/OqOf5HT16qum/wDLce/m2FYT/wAkH8+HeR55Xs8y Oq7M5YboMJ/5IvDk0C87pG4jlv8A0D/fXw3oipG/1b/mOt789RRTNiOG/wCn4zhPPV6nmg/p56vU ssm/73/76/8Aks89RvRlsOy3hOdqD+bf8kXGeFFCKhj6d9SM2dN7YTmj/f1g/wD2EQvw5/ngoOzR 38u5kwnEqD+bYXi3B1W6WnKUS0+UH9PPV6snDevV7nq9Xuer1InEcS+ocNqKaRuI4l8fjbnqKKRP /I/9XBFQfpp56vVk4HaEFf/SLX+Knh3/AE/96rtL3zLyTGjKB5Vo1V1iOG/l4cO61SNxHDfz8Oeo ppk56vU9/wAuHs56vV7+XD2cNq9Xv5cPZz1ep956iinTDv8AeD9fjz1G9POHdxwpr1PfPV6llhvY /r4c9Xq48KKNq4Ydhvwtfx5ejqjMdKuif9dse/36j+S4NbgFzzPKPcjyOtgzoR0l6T+l3ImDdQsU wn+S/wDYNf1i/wCS7yM88zyhlXsO62DrZX/1sz5i38k6aYD/AM87wio4pG5d62Yr6oq/GcJyvi3+ bHoFkP8A5iXqJ/M/+Svz1eoA/Uz6xsJyTgP+b3IeE0P9TcBw3h9VaoM67+pDNnUi/wDNM2V2NcOs ioJUVDDsNxbqR/zlv5Lk3Af+YlzGebrVA1nP+qeW/wCTfyv/AH9Yz356vV7p1knFsyV/81HK/wA8 Nbo/WS/RxmzO3+/bFO3bgJzzPKGOR5HR4enfoD6ej/kqHgO/nhqT/wCRUcfDuiXSfJP++nC8J7cI v54KOP5HQN506J/1kH/JK4e/zw0T/wAionHUT8PIYl3wr+HDj+eUT/yOi0509CmLYbQf768K/wB8 3/et4NP51QH/AJGKJvmLoD/Lq84SP98vDvI88onzzI6DTMPRP+Zfzj+af8ljhz/PKBed0WnMWSf5 bX/yn/nNcN6IqZsuYb/LK/vXe3nq9QyZdzt/Lq/hRXqMt/Msp52oP+xz3vz1CKmXLudsW6b49/KP 5t/vm4cZFsoO0fzLudsJxKgH8s4OMi20UUs8OxL6xw3qtLL+Zf63PV6mb+Yj289XqZsRzJa3PUU0 GeIZk7D9e3BtktEed0jeWokr3PV6u+eoRV7nq9X/0wE/FS/6vx9S/wD4MnJNR9orRqrnEe54dUUU z4jhv5eHPV6mb+W/6vPV6vfy3/V4bV6nn+XH2Hnq9Tz/AC7/AE/nq9Xv5afb/Hnq9Tzh2G/C9vHh TXqef5Z/rcKK9Tzh2G/C1/HnqNqef5aPb/Dnq9Xv5aPb/Dnq9Q9dPMkf1j/k2E4V/vl/7CTMXARn eyhvklXI9Gsk9EegOQ8G6hZo/wB/X/YNZdzF/wA5bkZZ3ndDPI6Kd1E6/wCbOtmO/wBbM0Yt/Jcm /wDPNZd4R0b0AXUTr9/nIx7/ADI5Dxb+TZNOvUrMXPUUU99ROtmE4b00wbp7lfFv5Lg2A/8AMNZd y7/5e+H1aqtPqJnbFs7V/wDKcUxb+S5NwH/nov8Aprc9RRRacxZ1wj/kk5XP++b/ALCLh5Wv55TP iOJYT8hg3+/euxrGce/553/pkc1RTTLkzJP9dse/5JPCShdVr3p39N2E4bX4L/vp+ngJzzPKk/I8 jq17L2W8Iw2gPAbUm5HSw/30/IfXwho8pl/lv8y/hwpr1D7l3DcJw3/kmYTz1epnGW8J+f8A99fD avU0YjlrCcSr/wDpi4z8P7uHf88ok/klFo6zelzp7nb/AJxRwXGf+wi4e/zw0C/5FVRPWb0l5tyT iGo/3ze3hxkeeUC87yOq7MxZbwnvin++Xko1GVAHiHSTFf8Afxi2F/8AOB4bmiTO6Zv825+P06c9 /wA11O08Zdw3CcNr/wDsdH/nneeoO0JeYst/85bnq9TNl3q1/VvHj/HhxkVFFHjw7O38yoNPDkn0 T1w/rJ9PDiiT+dVzxHMl7crTlPOI4l/oHfQePPV6g04IqD9e56vV7nq9T5wO0IK4fy4+w89Xq//U AX8UT/q/D1K/+DLyTxsqtVo4l3H6+PDiimmnnq9TPz1er3PV6ldhvc/r48Nq9XLnq9Txh2G/D4X4 U16nn+WD2n7+er1dcKKNqWeHdhz1erhz1eoZcmZbOJV/81xT/kjf38JaOsjqxPp3iWU8t4CM2Yph P++bAf8AmGRyMM8zyhxkVE16q9fsVzJX/wBbMU/39YN/zzWXf+mvwEUL6ALrN1axb+Q/yn/nM49/ zzvPUUUG2Xf5TkrKX9Uv5t/Jf+wlzF/01+H1aoNM552yn8//ANibAP8AmJv+xvz1FFFRzn1IzZ1I r/5Thf8AvlybgP8AzzuXuHdapG4jhmE/Ifyn/nDHnqKaeMmYb/MuElG9WWdCOm3/AGKP9/PATnme VM2R5HVunTvpv/LeRfUpUP2HZb8eer1POI5b/mX08KaN6WX9SThtB/KcLwn/AHzc9XqecOw3+W2/ 5wvPV6vfy4eznq9Tzh2G/H6uer1exHLeE4l/zib/AA4bUUUjsxdNsJxOg/36YT/OuH9aqon1Vfh4 4VmPD/62dL/+Sz45c4cZHnlRdnm49Ue/1bOSsexnp71Qwn+S/wC/P/jNcmjI88qF87yP+XU8/wBS cJ+Rt9fDmiqg1zFknhRXq9mLLQxLAf8Afp/vlxnAeG9eomuI/wA2/n3+/P8A5LPx4b0HaNh0pzt/ LaA4TiuLUJ4OMjzyijPaMx/Mv9bguoIV3wRVavc9Xq656g7Xuer1d89Qip74HarXueo3r//VAT8U H/q+/wBSn/gy4/yTGfsHlWjVdn8s/wBbh3RRTPz1epn56vV7htXq4Yd3H089XqWeGfvcKa9Szw7s Oer1OvPUbVz/AJcPZwor1cOer1PGXcNxbMlf/KcLwnhPR3Q/4dht6D+U4XwD57ntDbI8joM+s3Wv +W4D/Kf+cPgPAZ/y0KOaLVl3EsWxP/m4WfP98v8A2DWXf+mTzdapG4diWLZ1/wB+2KYt/Jf+waPP UUUzdRMyH/nF/wDJGwHXnq9RUM5/zbEv5N/WjFtf+wd4dZFXqZ/5li3z/wDKcLxb+S83RRTzh2GY tiX8mwn/AJwuA89XqPz0I6b/ANp4B88zypIyPI6t46M9NxlqgP8A02TyFs8qZ8i20cTLuG4t/wBM nnqEFCZhvTfFsSt/NMW4U0b0JeHdN/5l/wA5b7+er1LP+pP/AGNvz4bV6usR6bfzKvwb+aYV9HPV 6nnEOm/6jnqKKef6kjDaD/kk/Tz1epm/ln+tz1er38s/1ueo3oNMxZJ/ltr89RRVXnq69HOU+tmA 4z/vqvjP/YRDg1yTO/5dQHzzI/5hWt/mM9QugObf83ufPo5NIzz+YVj7neR/y+mfEcyYT8/g3/TG 7cOqKq9/McJxGg/lPs4b0HaI9nPEsJ/n3+/T/nA/887z1epmw7MmLYZgODYtheLf7+cB56ij/lo0 eHpTnb+ZYF2/W/JRyOibPKGb+Yj28NaKaV+G/wAq+Q/7HNuCKrUy/wAy/wBbnqDtZOer1d89Qip4 w7uPp4HarXPnq9X/1gF/FE/6vw9Sv/gy8k8bKrRA+HFFNM/PV6mfhtRRTPz1ep2w3uf18eer1PWG fvcKaN6ecOxL+7nqNqesO7D6OFFep4/mI9vPV6seXMN/mXL0dUM2XcRwnLVBfC//ABJuAKhDSM6h 52/luH8jbOqF9V29ROpH9Y8ewbCcLxX+dfz7/jLZa/q7zdE9PPUTMf8AM6DBuk3/AEwOer1LLDv5 TknAbYp/yWf+wd56vUWnqJ1tGGjGf5XhFD9Q5X+SVr+dmgb/AKyYTiX85xbC/nsa/wCwa/rFw9op p6w7/fdbw/kPPUbUPnRnLdqD+tmKG/jwi/nVHOR5HVr3Qnpvi3yGDW/5LPjfkMZ3ndTRkWRVa507 yT/Lf5NhHCKhxRx8u4b8Pp56vUJmHZa7H6+er1CZh2WsJw3+gc9/Iq1S1w7Dcp4ZXj/ft/v54fUQ 07/y3CP+mrzdH1d/y3CcSvhP82oeaohpY/1cwnEqD/kq0J56tTSN/wA2/wDp/wBfN1v+eV7/ADb4 r8h/Zxv+SV7+d0GOc+m/+gf0cJKP6LVmLJP8toMZ/lfPV6qo/W76J8J6/ZSOK4ZhH8kzjw8yLPP5 fQHzzI61KuomG5syTj2M5TzRhFdguM4FryaP51WP2eZHSN/rtixoLf8AJG/kP/MNcGlAekbnPEsJ xKv/AJt/zmfjz1eoNMOxLFv+mT93Deiih/6fdRhiGfmxRcMoMnYJjhKrgGXLgYUL99bH7+HuS16j w5dP/TUxf/wWjySaCFLL+Yj289XqwcEVB+snA7QgpQc9XqeOer1e56jev//XAP8AEw/6vu9Sn/gy 4/8As5MTH2DyooO2iD/8iH18drVMvDavUy4l3H6+PPV6uXPV6mfhTXqeOer1PHCijanjnq9Xf8t/ mVvv056vUIww3/nE4X+vjwno7oaMOyT/AFJwH+tmaP8AfL/3bvAPnue0NsjyOq7PUR1IPyH82xT/ AJLPAX/Ja9QA9KstjJOA4x1YzQf5LjP/ADzWXeHeeba3SN6d4li2JYhjObMU4TV6vYjmP/nLf84b Af8AmGuer1AHmL+bYlX+3GfHgyoop4/5Jv8A34eEn/LQo2pZ5dw3FsSr/wCU/wA2+7hRW6sS6VZb /mVfg+U/+mDrwE55QxyPI6vA6M5bxbDaDBv5XhPIvrIejw5d/m2G89XqWWHfzbEq+38156vUMmXR i3b+bV3PV6h9w7Df5bX/AM2/m1+er1Pn8t/mVf8Azbh9RBTz/LD7fz56vU84dlrsfr56vV7EcNwn DNPrvz1er2HZcwntz1epXnEjhtBri3N0SUAmc8Sxb/kk3/3zduB+jygAzEf+xT8f2c3R9QN4jlz/ AEC/1c9XqoN/FU9E+EZkwLGOtuQ8J/384B/zEv8A2N+ShuPnlRbvvkdarmI4bi3fv/IeTRUBV7Ec N/l1fz1B2kbiPY/Rz1FFew7EsWwz/fr/ADbXh2B/L69/I6sU6V4l/WTKf8274z/byTMioI0JuG9j +vhz1apY/wDJN4bV6uHPV6lxz1erj/yP/Vz1ep2/308KaN6//9AAvxMcSt67/UoO/wDxt8f5Mu74 hIooNEG5atUz8Nq9TPwpr1e56vV7nq9Xuer1PHCijannDv8Afb/Rz1epZ4d/45eer1CRl3Mn8t/5 hfCf9/P/AGEXCPOqOsjoNes3UjFv6pYLhP8A03v+Yl5GWebaHFVpdVc64tnavwbCMr/9NP8A5iLl q1SM6zf8wlguU8L+etf+q1+eyLbXs8pZ5Mw05byl/NsU/wCSNyv88NboHMRzJi2JUOM4tf8A3zHT hJktapGYd/NsNrx/0xuHeeba3Tzh2JfzKg/lP7Ry1e/kVDH07y3/AC3HsG01+PAP/PBRvVu/pV6b /wAyr/48BueZ5Un5HkdXg5Mw7+rdB/KOAipSofcOPYfyn4c9XqWOG4b/ACztz1eoTMN7H9fDnq9S xw7MmE4bQfxHPV6nv+s3x/X7ueqn8jpaYdmTCT9XD6iOllh+ZP8AQB/K+er1M/8AMsW/xc9XqZcR xL+W89Xq9iOZP9A56vUisR/35W8eENH9BtiXYfr4cP61SLzFhv8AoH82tf2cIK3RO+s2G/1kwHGc IxTCeH1EFaVfrM6J4t0l6mYzbXBjoOTPuNvtOWwKx+34yOiPYj/vyt48GdRdTMbfI41z1b/kdM// ACUuerVGu9M+JYt/PhlP/pvcGmR53RRnmR0fzEcN/q3X/wAp/m318GdE9ew7/fl+zhtRRT7wpo3p 456vVw/mX+n/AJ89Xq58KK9X/9EtP4l3/V8PqV/8HfH+TEz9g8qJzRB8R8Pr47Xq9h2Jfy3/AH7f 8lrnq9XsRxL/ALFPPV6kfz1er3Cijanjnq9Sw56vV7nq9Tth2G4tiXw9vL0dUJuHfzbDcCxr/wBi LkWZ7R5ktEe6qYl/La/GcW/5LQ78BtHlE4yZiX8yzbjOLf8ATB14d1qkZiP82zHj3+/T/kjfzPTh vRTQl5zxL/T8Gyn/AM4bAeA2jeg1zniX8yoP5ThfDutUy5ixHCf+cWK7+Snhv/I8trf8ip5yXiX8 t/37cBteo2HSv/e4fr4cIs8zyjjI6vZ9IeG/74MHOKcjHPKmjI6tEy7huE/IcJKHFLL+sn/TL56v U84diXw+vnq9Qmc9RvSww7Dfha/jz1ep5w7DfqHPUUUt+er1Y/5j/LfDtz1er3+/XDa//fXi3PV6 vfzPFv8ADz1epmxHEsW/6a2vs56vUzYjiWLf9Nbnq9SM/mOLYjX89Xq7xH+bYbQDnq9RH+s3++3/ AJJfNUQ1R967ukv9dumn82wv/ks4Drpwb5Jnf8uoF78ZHWsfiJxbDa/vzIKKx9/klMuI2sfo56iP +R0yc9RPQndO8xnDM24Pi2Gdxpw7/wCblWqtGy7/AL8sB5JlFFLLDsN/ln8eG1FFZOeo3p44U16m fnq9WP8A37c9Xq//0io/iY4j/wBPwepW2n/G3x/kyNiEgUTmiD8vXqZ+G1er3CmvVx/mR9n8eer1 cuFFG1O2G9z+vjz1ep656vV7nq9Q9ZdyTi2GUH82zR/vkwbhJnVHVM/XfqRhOSMhn+V/75BfkY55 tocZFVUWYsyYt/VL+bYp/wA57lq1SM/mWE4b/Jvy4b0U0zdO/wDflj382/6YHjz1B2mb+Y/8ljXX Hv8AnoueoRUzYj/vy/304Zz1ep6/lv8AMq/Bv+cL7OFFep5y7lv/AE//ALE3w56jajj9OsNHz2EY Thf/ACWeAfPNlDHI6vb6M4l/LaDBsJ+/ka1NGRbaNb/Xc/rbhBQgpY5d/m2Jc9RvQyYdknFv+cpz 1eozOXck/wAtoO2nhw+oj/nlCX/VnF/+mUfv5unKef5b/oH/ACSeer1PGHZb/mX9vPV6mXEcN/5x I78IK3T5h2Sf5l9HD6iCnn+pX6/qebr388rliOW/HhzWqRWI5JGHft4TVv8AnlFOzFlvFsNr74Zw go/pmxHMmbMN/wCSphP++Y89XqAHOf8AKcx0GM89Xqrv6h4b/MhjGU8U4OaA2e1qheofJOLZJ6t5 xwrx/mWvJm3IrH7PP5ZRasRw21B319unDmgV/O6ZOeqte4b0UVbB0HzJ/MsiYN4/R9PJRyOibPKH /wDlx9h4a0U17DsN+u/hz1G9PfPUUV7nq9XuFNG9f//TKl+JF/1e/wCpX/wd8f5MqdlE9EG5aiim fnqN6ZP5ifbz1ernz1ep1w7uPp4UUbU8/wAyPs/jz1er2G9z+vjz1FNLTLuJYthv+/bC8J56jahI /mX8yxAYtimbP53fhHnVHWR0R71M5k/mVd8fjyNKG9Ef6iZk/wB+GD4TfmsiopoM8xYl/Mh/KcVx b7+HFB/PKWWHYj/VvAcZ8f59z1VoNP6yD563PVb+eU86f75h/wBN7TnqrQl4j/vtoOeoRUJnTv7s GwHTMvCijajkembDv6yY/jOLfdyLs9oZbkVbvkvEv9AwbCcLHAbU0UZLLuZMJw3+TafzrhDR/RtM vZ2zZiVB/vqyn/Jf+7i4fUQUGeI516sYlX/8j3/js56vUssO9R/VfLY/36YV/OsG789XqNh079UW U8yf76cU/wB8tuer1Guw7MmEn6uer1LLDsS8fvHPV6vYj/Kfn8F56vU8DMmE4bw8okrrEc7flwkr 1BpnLq1hOW6D/fpi38m+HDuvUAuYvWN09/5xXz2Nf9+3laOqLTmL1IZszJ/yS+ntd/JuEtbrrLvX /CcyH+U5nyn/ACU89XqRXUQYT/zy+LcIaP6IP1Fw3QYt24d5HQHzytaf8SHLf9W+rX/e+9n08mnJ ax933quz/nH/AK+3g0oEUy4b/Kfntfq4b0UVx/30/wDS9z1eo8np3zJ/zibcHORbaKKPHh3cfTwW 0T0scN7n9fHnq9T1z1epH89Xq9z1er//1CpfiQf9Xoeq/wD8HfH/AOHJlRsFE9V3ctXqZ+er1e56 vU7f8k3EPDhRXqaeeo2rh/MT7Tz1FNPOXcSwn9fHhvXqEvDsR/mX/JU+jhRRtQkjEsJy3gJ/5wuM 25F+e0NslqojqriWE4lj2M4t7eFFO0VDOeJfzLHxwX5FsoP55spmH+/LHsGwn/ktc1RNTzmHEv5b Qe3nq9SN/mX/ACWf99P3c9XqecOxL/QP+9Dz1eoZP6yfzKvwXCf5T/vlwHDP+M1/vs4UUOaEvDv9 4P5T/wA5nHe3AbRvVifRjDcWy3h+DYTlfCeAnPakzJKt26M+m/NmZKD+bZoxX/fNwHUMqth6VdE+ nuG0GDf76aG/NUd0Pn9W/wDpl4T/AL5uer1LPEem/wDMrfysanh1WqBrMXTf+W6/yjhLW6AL+W5T w3/nE89XqEvLuZB/01vo56vUPeTM7f0c3R9Qm4dmTx5qiGvZizJ/LaD+jnq9QOZizti1/wDfX93P V6gCxHDf67V9s0H+dfHnq9Qx5dyThOn++nnq9Ql4dlv+W98J+vnq9TNmLJOU8SoP5TimE89XqI/n Poni2G1//GXxb6uer1Eb6zf1syTQ/wC/Tlck2USVTf8AiIZJ/rt0mwXNmF/8lnAf6OSdkX/LSqM9 96oMxHDv+cT+XJOqFKZsO7DhvRRTN/yUvp56vUcjo1/vtx7BxhevD3Ja8P8Alm1Ytlz7R+rkk0EK WGG9z+vjz1ep656vUz89XqZ+er1f/9UkH4h//V6PqV/8HjH/AOPJnonohHCivVj/AN+3PV6u9MRr /wCU9uer1exH/fbX4zhPPUbU1c9Xq9w3opp1/mJ9vPV6nnLuG4t+vhwor1O/VbEf6t5DP/TYx7kK Z5/wxqTMkqrrOmIm4/lfcjh3kVezqi0YdiOLfP8A82wv/nA8N6BdPWXcNxX5/GcW7ezhRnmR17Iq Z8R/5IR4b16mXLuG/wCgHnqKSaecO/m2G1+DYrhfCijahlyZiX+/Aj/nM257PaGmS0cfozlv+u3U vBuA6hpkdbBnSrpLhOW6AYt/Kfo5GVSfR+8u5kwnDR/yVv5L7eeo3pZ/5/cJ6bn/AH6Zr09vNVv+ e0DeI/i0dEck1/8Av0H86+7hv/I6J/55XWTPx1eiGJV/8p/lPPfyKiT+d0ZfD/xIMp5koP5t/VL/ AIx3/YRZd4UUM8ioe/5l0R62UH82yvi3CWtUVLOeW/6kV/8ANsL/AOSMOao7oYOlOJHEuENH9Gwo Oer1M+Y/sj6+aohoNsOyThOJf8lT8uH9ap3znnbpP0TwH/fpzdElV29VfxaOk/SWvv8A1T+nhz/I qJs8zz+X0AOHfj8dKMSr/wDnXtceHH9haJv7cUZfJf4mXSfq1Qf8kn+S37jMPCbPMjo7yPPKHzDu pGE52/5JeLUP8mHCejeg06iZbwnMlB/v0wr489Xqpx9VWW/+MHnHCf5T/JdO3BjkdRlnmytVrqHl vFsNr/8Akk/85Pkn5H/yzKhfPKDXT/kk6cOaJqaP9+3PV6jvdKji2JYD489/yzqN6P3lz/eAfR/R yf8AIqjqllhvc/r481Qcp75qhFTNiOJf3c9XqZP5j8P48v8AyKg9X//WJz+Ihhv/AE+H6ltb2zvm DTkz0T0R3Ev+ScOFFepI89RtTPz1er3PV6vc9Xq9z1eoR8OyThOG/wC/bNA/ko56vUMWTMt4tmSv vhmE/wC+Y/8APRf84LCOAjPM8o7yPI6LT6mM7YT/AMknC8W/8SLkaUN6q66iZk/07Bf5X931cGVA jPKDTJn++3hvRNQl/wBW8Jy3Qf79MW+gZe56vUDeI/78qD/fZi3++bAeer1PWHYbhPs4fUT08Yjl vFsNoP8Akk6cIaOKEvLuJYtc4rifAfnm2hpkuyrwfQB0TyniX8mxbFMW/kuM8jDPKmjJMkq9zEck /wBW8pfzbC8Xoca4U0MqJt1V6kZsw3KRwnK/yP8AXLv/AMZ3hJXqJx076J9WM7Zt/mvVD57+pv8A 3bvBjkeeUDP5Jmde9XfQHKeHV+Tf6r4T/Jcm99OSjUZZ5keZVUR07yRi2W+pecsqYX09rs6H/nms xZi/5xPDf+ef8LaJP5JmdbK/p39Lv8y6D/zbC8W/qXnL/nmhyMM82VNO49NHSrMn9W8+HCb/ANS8 5f8Aki5GlSbR4OomdsWw2g/lOKc3Wv5EaeOledv5bXnhBR7kdH5y7na1Bz1XpmzDmT+ZV/PV6g1z nmTF8NwHGcW5qg//ACKq08Ry3i3VrNg/r5i1dkrBv/J7wdZFtonz2icet3035TwzEP8Am1+U/wCu mDfy3vyS8jzuoXzzIsyqrroR6XfUziVBjOU/83v/ABjf5l/Wkf77OHf88NEn8jzKrd8u+gLNmJdJ cGwnCsJrsFzl4ngJzzPKk/JMkofehHQHqx0Tx7+bZoxa2DYD48jHO6k3I8jqxLMWI4TiWA/zbCzR W+I4R0TfyKqivVVhv/MY/wA0/XTg5yKibPK1jfUzkix/31/857k0ZFWPmd5HRN9v/Yp4cURUzYd2 H0c9RRR4ulX/ADD+C/Rwoo4yOjj5M/324D7L8mXcfPKB2eZHSxw7Ev8AT/hyUaBNPf8AMj7P48Dt CCmf+ZH2fx56vU089Xq//9cnPr//AN9vrD9Sv/g74/yZ6J6IPwor1Mn8xPtPPUbUzfzL/W56vUnu E9Hdc8O7Dnq9S2w7/fbX8pRLQj5d/wB+V8WzRi2vL0dUtcR6kYt/IjhOF/8AJGtwD57R3ktVp9Zs yfzLHv5Tf6eA2jyin5iw04lp/Ke/JN/5Z1Aeg1/7Gv6+zjdaoTMRxLCcNwH/AH1/Pcc/4W1qga/3 04bQcrnmyimnnDsS/lv/AI7e/K16lliGJZsH/JT+nTnqN6H3pVhv9ZMf/wCSTfgPzzbQ4yPI62Wf TPhuU8t4Dg3++nt4/VyF8821NORVZXh2Jf1koP5VheE0OC/AcA9DKg0w7onlPJOPfzb+bf7+fbz1 eo12TMt4T8hg18J79uCCiOhlxHpL09zJ/wAlPKn86+rhz/PDVv5FXsO9JfRDDf8Aft/VSh9nPfzw 17+RU0Zi6b9Pct2/leE6cJaOaL9huSenvz+M/wA0ylwho/oNuu+JYTiX8mwjK/8Azgeaohom3+ci +fcG/lft56q5FViWXcyYsaD28KqG9LLDsS/mVf8Azb+bfdw2oooTcu5kwnDMB/36f7+uaohpFf76 MS/37YnhPN0fUJ2Xck9PcS/5xVDzVEND5l3JPT3DbHC8JocF4IKI6ecxYbhOG/8AY6+nnq9QB5zw 3CcSof5TwP0eUAGI5JwnDaAnDPkfZzdH1V3eprDf9OHDvI6A+eVrs+rvDcIy3/Jf99Pftyacj/ll QvnlVqX/AOmWeDSKBf8AJKDL/kf+vnqIqP307/51oP5ZwmzzbQioZOneY/5lgNx/yWeHOR55/Lqa zvI6Ev8Amf8ArcyByPPKhf8AklO+Hdx9PD6iSufPV6vc9Xq//9AnPr//AOrw/Uv/AODvj/JQonoj 38sPtH389XqR3/I/9XPUbUy4l/KNPbz1er1f/RwkrdOmXcNwn5DGf5pi38l+PL0dVm/5H/q5SiWl jh3+/L/vTc9XqRmYsx/y3+c/yv8A3y4NyM6lCiC5zxL+ZV/b/fzz1FNA1iP8ow2gwb/vW+PDegNQ af76eer1POInCfkP9+n5Hnq9/IqZv99GJUHt56vU9Zc+0fq4b0UV1/Lf9P8A28KKN6tF6MZJ/qTg DYtinIwzzZWQGR1ch0I/324Fg1x/v5x72cB9DjI6sU6d/wApw3vi3CShjRrMOxLKeI/84n+deP8A xo+ENH9PGXct4Vr/AL6dfHnq9Ql4dlu//JLxauwXnq9Sz/q2f+ST/Nq7nq9QaZiyT/Mvr0156vUG 2Yst/wCgf9MXmqIaIF1VxHCct0GM/wAr783R9ROcmfzbEsf+vmqD+RVa7kzDf5jgP0cKqG9PP/JN 4bUUUssmZjwnDa/+U4nhP++b289XqHz+reE/84v/AH9X056vV3/LsJ/6Y/5c9XqWWHYblM/8ksfD nq9T3h2JYv8A84vFuaoP/wAirr+W5r/w83QgotGc/wCU/wDTJ+P7eFNeohHXfDf5lQH9fHgxySiD O61pPV3iX8yx7qXhP18k2sfqruGG4Tr/ADT9fHg4yKghQafy3Cfn74X24cUHaPF0Z/35YFjOEYXq eAvOqHFdZd/4zeP4zhVuHf8APDRTQ+4d/vy+PJNyPO6A2e0tMO/lNj7fH7uSVUXU6/8AIh9XBDVq 5c9Xq//RJv67v+rw/Ut/4PGYOShRPRH8S7j9fHhvXqR2I9zz1epq56vUn+FFeoTsu5bxfEsB/wCm Lf8A56LMXPUbV1h38ow2v4SVulhiWZMJ+Q/5JX18I872UdZFRUeomJfzKg/lJ/3y/RwH0NqKhmLD cW/n366cN6KaDPOeI/y22E/+Itz2R0H882UjsOGE/ID+aYr/ACXmxnc0TV7OeJYTiWPf76/r4bV6 kb/Mv9AH38tnmyvV7DsS+Gh8eVr1DJ0Hw3+smfThN+FGe0NMlq3XLv8AvB/KeRfUl0cnpVnb+W/y bgRocVZb0qxLT28JKGORbaPv07y2cR/37cIKEFGwy5lvCfkOer1dYjhv+n/76/Hnq9XsQ/m3/OT7 /Dnq9SOxH/fb/Tz1eoAuquZP6eer1V2Zzy3iuJf79sU/5I3s56vUAWHf73/ynC+3PV6rL+nf8p/k P8pPbhPQyp2/5H/9+n9nLUSUJeI5b/0D+bYXz1ep4y7/ADbLf8m56vUPuHYl/Mvo4bUUU84jhv8A 2Ke3t56vUs8u4b/Muer1LbEMN/lv8LcPqIKKZ1F/X8+ENH9V4dZf2cPqIKoJ9d3RTFsk5D/zg/8A OGz5iffgyyPPKjLO8jqj7/km0A/37/dyUajKmX/kQ+rhvRTRyOhH+9/twbHtOFFG1LPOeG/yyvth f++Xnq9TxkzEv5b4/wC+bhvkeeUCc8oS8P7n9fHk0ZHQNzylh/Mj7P48G9AmvfzP/sUnnq9X/9In Hru/6u19S3/g84/yUKrRHsS7j9fHhvRTTTz1epF/8k3nq9Tz/WLFf1vz1epmxHEsWxLTFMW+jnq9 Szw7+U4aB/NDwoo2pjzFnbX/AH14T/Jfo+nkX55R3kdFpzniX8t/nPPUIKDTDsS/5LOEHCaH489n uRUHaALEcSP8+xn+aflw3oopG/zIYb/zifgL89XqRn/I/wDXwor1d/zLFvkO/jw3r1ew7/fbXnhR XqNf6Zf+Y9xrFuE2ebaGmS7Ksty54/r4cBOebKkzI6Mp06/3vH18CFDerR+g/f8AX2cI6GVWUdO8 Sxbw+7hDR/Rl8u/8k/6/289XqWP8twnDfr9vPV6mfEcN+P1c9XqALMWGfzKv789RvTNiPTf/AJy2 aMW056vVXb6qs7YTlug/lOFj7+e/kVE9FR6Vf8aTHji2K8PqbyOrReneXP8AQPp4QUN6d8Sw3+Wd +bokpZZM6kfy3nq9Rlsu4llPO3/Yl56iinn+pIw2v789XqEzDsN+s8P61Tzh2Wv5b/RwP0RVyzB/ vD93D+tURvMX82w2vxn29+ENDaicdVfsjh/QJzyiQervJWE4l6H8Z/mn/JZwHE+HVA3PK1KcxYl/ oGMYTah7f8xFyZ8irHzOqR3+/bDfp5unaMr0IxHFsNrxr9fK55tr1HIzn/vyof5t38OE1G9Bp/yT aEfR+3h1kVEedU85dxLUjwH58kzJaBee0sv5l/MvDvyTf54KCNcf9+3D6g9X/9MnPruw3/p7Tr6O /wDxuMf5M9E9E3xHDf8AQO3wtz1epmxHDfh9fPV6kb/Lf+mX+fPV6mrnq9XuFFeoSMOw3CfkO/0n MXPUbUisxfyn5HTkX0O6LRmP+U7f4/fz2RUHaR2I/wDJAznw3r1FPxHtjP089QRpHfzL/T/5v+3n qN69iP8Avf8Ar8Oer1M2I4b/AKAf5XhPPV6lll3Df5lwor1Gv6DYb/LcdOLHgLzqpQyOj85L/wCS efo/bwkzzZQwyOjY9PP97v19nCYUOMiqxPox/RwG0MatC6VYZ/oHe3CGj+jK/wDJNoPHnq9Qm4di X1Hh/WqZcx/aH18IK3QBZzztlPJNB3156vVXZ1V9UX9ZK84ThfPUb0TjqJ/xpK//AH6cP6J6eulW W/5Zj38Lc1TeR1bv0qyTiuJUPb+HCH+RUd/zyhJ6qdFcVw7KZzX+8O456K0M+ExNEew7/fb/AE89 VqWRzJi2W7/yvnq9QzdB/VFhOY6/+U4p/vlxnw4f0T0eDDsyYT/yVsL56vUtP6yfzLx5qiGgxxHE vz8eENH9AFnL+nnq9VeHWf8A3uP0cP6IM8omnqqyTi2dui39U8L/AN/X++zh3QNrUrxHDf5acY5M 2RVj5nVI3/km/RzdO0PvRj7WC8rnm2vUfr+Zf74T/NO3w4TUb0GuI/77f4cO6KKZMRw3+Zf8kv6e C6g7T1kzMn8yP/Y57fnwcZHnlA/PKE3+Yn2nguopr//UJz6uv+rmOv3/AIMuYOShRPRT+G9epnxH wxbC+er1I3EcN+o89XqRv8t8cU56vU9Yb/KfkdPr4UUbUr/6t4SbYtimvCPOqOsjoNc5/wApxL/k l+PAXQhoAcxYb/v+7/Tz1B2gC6iYl/Lf99Pfx4b16gdw7+Uigxn/AH02/n3D6iemPDv99tB/yI8I a3TPiP8AKP8Av8/Xz1G9d4fh5aiwjCjhV2Y3JPjfvzVaoSsOw3/f9f8A9Z3m63RrujGG6n+V/wC/ rBuRpnVSjkdHJ6d9+EVHGRUa7JmG/wCgfT48KaG9WKdGv+SfwG0Mci21ZV06zJ2PCChBRmMu4l4e A/Ph/WqWP8x/lvh256vUAPUTq1/LaD/sc8IKOKrT9Q+ZM2fIXxT/AJLPPUUUSHDsS/llf8eH1EFL H/OPlT5+381/jw7/AJFXv55Szw7MmE4bX/zbCtfqPCH+SV7+d1aH0q61/wDGSwbCf+cNxyj6hKzn 1swn+qX8oxTFuEFbqtXMXqQyplvHjhP8prsaxn/u3eHf8kFaoe8mYbi2ZP8AftimEjBeElHFI3qr 0lxfDf8Am4OQ/wDks4Dz1eoZPTv1+/mVB/KcU/5LJ56vUfnDsyfzKg56iimf+ZD2fw56vUDec8S/ 0D2c9XqrV6i4lov/AE2fhw7yOgPnlD5kzJP8tyH/AL9P+mZxyq1p8+szpL/VvqXjH/OFwbHsTtyS 9x88qM996JxlzDcWw2vxj+q+LfyXGf8AvZfyTknVG1LLLuG/1boP5SRwoo2o8GXf+SCcJ/jwkrdB piH+8GDfzT/nA/Xw6yKiikd/WT+rdf8AynhxXqeOw/rZhf8A4kvDeg7Sv/rthOz/AKE3/wCjnBzQ Qr//1Sdes3/q5br7/wCDLj/JQonop3DevUz89XqZr4Thv/JUwn+c/Twor1I3MWJfzL+PDevUzYdh mLf84v6OFFep2GG/9NT8vp4CM82ULzTPmLDcJyTgIxbNGLfyT/u3eA+hFRaf+Slj382xT/fLg3/Y O8N6DtFpzliX8yzbjGLfw4b0UUjtf+STz1FFdf8AIh/NsUwrnqN6ecRviVf/AN77nqN66H++2gHC jPa9TNh3+9w+nnq9Ryeg38p+Rxn6/wCHAXnVDnI6ORkv/e0/r48JM82UMMjo5GXe/wCvs4T0N6OT 0rxL+W39nCejjIqPx07zJ4cJaHFD3h2ZPHhBW6Zs59Wv6t4Fa3bw56vUDmXf9+Vf/WzFP+Syeeo3 pG9Vck4T1I56vUSDMXRPFsN4fUR55QNf5t8W+f8A+STw8oFV7/mG+er1GZ6d/wBbM7YD/Kcr8rR1 R4OnXpc6hYlQfzbPmLfDhLW6EjDugWE4bX/8iOvt4Q0NqEv+W4Thv9vCmvUzfzL/AED8+G1equvq rlvFsk5u/wA4OV8J/wB83/PS89XqOT0p6tfzLAf+St3+nnq9Qx4jnb+ZWtz1FFAF1Uzt/LKD87c9 XqKll7DP67dS8G/9SnTh/QFotP4iHWzqxlvHsm4T0wxauwXB8h/8anMvBjkdA3O87qnD1mdSMJ6t dJMGzZ/yRc5YDidsy8OMiok34zz/AIW1Wp/Mv5b499ODmgbSzw7/AHhHPV6jjZM/3vwb/nN/77OE lbp6zn/yX8Zwn/nDY9hnDutUU/MWG/y2gxn+af8AJZ4b/wA8oppm6d52/wBPxnCfq4b0HaFH5E77 3rv8v5n/ACZbh5/w0onr/9YqXrN/6uW6+/8AgzY/yUKrRNuG9FNM+I/77fjwoo2pG4jiX1nnq9TP h2G/zGv156vUrcO/lWG/76MLP864T0d094d/xm6/GMWxT/ks8A+eUIKLT1VxG9v5X/v6xnhRXqKf mLEsWy3lLGcWxT/nPf08F+RbKDtFrxH+baYtin183nn/AC06KK7/AOSlX+HDytUJOG4b/wAkbCML wr7uENHFCXh2W74BjJ4UUIqBvEbfI4x/6zXDj+RUBv57Syy70lxbO9BjGLYWKHBsGyHhlsygcJ87 zv8Al9DTJMkoZOg+Jf6ef+mNwF51Q0yOjkdO/wDkvN9H9PCTPNlHGR0eHLvf9fZwnoQUZbp3iX+n /wAOFFC6jxZMxL6uEdHdCViOZP5bQdubo+oMcOw3FsyV/wDWzFP/ABG+EFbp5/mX8t56vUjcRxL/ AE//AH1/V/Hnq9QyYdhuE4lp9ZPPV6lph3Tfp7mSgtimE8P61TuPSX0n+f8A5timE6cIK3RlsmZJ 6e5JoMG/qvhNDgvPV6jN4b/zCR+n9vD6iCi/5i/lN/j4cIaP6BnMX8pt8fHnq9Qa/wAxHtHPUb0y 5iw3CcyZS/lOKYTz1eonOXcNxbonm3+U/wDOGx7/AJhq/D+iejXf1iHw/PhBW6AXrNiX+gfa4fUQ UsfQnmTpT/nZ/wCbnW/qfYhb9r24d5DtoF59MGNtAx+P3nb0+4ZmvJmbOhWL0Jb+WnK2ZTl36dPy 4cGP5pUXtjNIx21pxdRM7HMmn82B5J/8ioHfzqge5unaGHDr/I/ynmv5EaNv55Rl+lX++3KWDf8A Yh/4y3N16uuquJXwDBsW/wCczz1FNA5nPDf5l/v2wvhvXqADEcT/AJbj382/5w318OP5EKDtO/8A nEwjZa3+4+X/ANHL8PaJ6//XJ16q/wDq5br5/wCDLj/JQqtFpxHseG9FNIzEfD6+FFepG/y0+3+P PUbUzYj/ALwH+aYt20/4zvCSt0w/12xbDcP/AJThf++Tx5ejqueHYbi2JUJB4B89o7yWgCzniOLY Z/Of5X/6kR4UU7QBdVcRxb/fNhP/ACWvZwX5FQfzzPKBv+W4t/35v5n/AMxFzVE1CX07yQMN/nOb MVwn7+FGeUc5HT1h2W/9A/31/wDJZ9nPUIKWWYsNwnDaDvz1eotGJf77aDTCeG9B2vZd6kDDf5z/ AL6qHTjmeZH/ADCij+e5lT106zti2G58wY4p/wAkfhJnn/LNo6yPPP8AhlVr2TP97vq5GGebKk7I 6PBl3v8Ar7OE9Dihk6d4l/v+9o4UUb1YpkzDf9A+nx4R0MqGDEck/wAyoMHwn/pvcIaP6ALrNmTF sk/76fHnq9RUv89mE4Z/yVMW4f0BaaP9pLCfn74X39nG/wCR0dxQ+5d9SOE3P589/I69FCTh3qiw nwPHKPqEvDfVF/MtOeo3pZYd6tMJ+Q/Zz1ervMXrGxX5D+U4Xb6eeq38ioGsR9UebLfzbFMJ/wB8 3jz1VoNMR9UX8t/5KmE/Rz1FFI3/AG6uk+G65oxX+S/z7h1/IjQI/ntHH6M9SMp52w++F4twDUOK eOs2Sf5llLBsW/5zP8y56vV7EcN/ltBgx8Oer1FS6q4l/Mse+OA8P6Ata+fru6+9Qum/VrJn9Q81 /wAl/kOGeHJl3HyOoZ34zyiPdRPUh1u6tYD/AMbzFRjX38O/5HllAv8AnVE3w7Ev9Pvb6uDCiKln iOJf6B/vrwnhRXqEnLv+8GD89ntHuS0JuTMyfy3+c4T/ACn/AHzd+FFO11iOZP5lgP8AKeN/83Kv UGmI4l/LaDBvH7uHdB/+eUjcw/8ATJH/ACRuG9E1Jf8AmvvX/wCPd/8AyZbhRXv+Ftf/0Cperv8A 6uF6+/8Agy5g5KFE9FRxHseG9epGfzP/AFeFFG1IzEe5+nnq9SOr/wCjhJW6Zv5cPZz1epkznmT+ W/XrpyM6HVFp/mP+n97/AMh4b16gCxHO38yrz9evDjIqA1POXcN/mX8mwnmq9kWRUZbEcN/mX/GT /jwI0OaRuHf84fFr8r/PDRv/ACKnnMH+8GDfXy1FFFQ6ifyn/fz/ACu3BdQdoMeeoornh18Nx344 Dz1G9XU9Kf8AflQYNyNM6qUcjqxLLuG/74cG/hyNak+lnh3++3Huer1WWdO8S/mOA4PfgFzyhjkW 2jvZew0YlgOD4thfCmhBRU/V30TxbO2Q8Y/qvi38lzl7eG2RVqqJOnfSTFjX5ywnqh89/XLAdb5i 5KFRd/yzqNhiPQHKeG0GDYr/AM4bHsM4UVv+eUeD0q+m/ol1syH/ACnFPkcFxn/mFeEle/nlHH6V ekrohiXTTGcJ/lFCcZ5ujn+e0Jnpl9JfRH5DGf60YTQ/znnq9nmeV1mL0ddJ/wDPTg2E4XhP8mya eeo6yPfj/hbQl9ZfTf0nyRkP+bZXwmh19vCPPf8AhdRLkeef8Mq7zn0T6e4Z00wbCf5V/v59g4eV 7+d/8MqDTrN039PdsG/mnyP85wHTLWXeN5JRN/PKoL9Znpv9PedurXRv/M3i1djX8+0zL/3v+Shk eefy6q/yP+Y1ZX6VfS7/AJpcB/mv81/5L/IxzvO6lKjwf1a/mNfg2E/84bAeEVbotfWbEsJw2vPN UQ0R7EMN/wB8OMZsxQ/8l7ggolz2tXX13Yji2JdasYwn/pg8yByKsY86om+JYl/Mh/ySf/Ud+jhx RHkdBpiOleP5p/vl/s56tU9a/wDJJ156hFSwy7iX8toMZ57PKD+R0s8OzJ/p/wDNueoQUzYdiX8y oP8AvQ+PPV6mb/kQxnCeeoO0jf5l/oH58N6KK6/rLi3/AEo89RRX/9EkHqY/53x1m/8ABlx/koVW i1Yl2H6+HPV6gzxHEvrPPV6mnnq9TF/Lf5l48JK3TviH++2g/X28I882UcGi1dRMS/7FP38JqEVA FmL+U5bykMJxT/ks49z1B2gbw/DcWxLHsY/lff2nhvRRQ+dCMMxb/fzi2KYT/Jf5FwozyjnI6GXM X82w2g/jfhRQ2rvDv99uA89XqRmYv94MZzZinK/zw1uiC4liX8y1PBhUX11h382ufZ4/fz1erliO GjEq8/t4fUT1aJ6ZcyYt/IcGwn+PIxzzbUz7k1a907xL/QP5TfQ8jCpOyOjW5z6b4tiWQ8GzZhZ4 DqGNDN6ds7f77zhOKcbzyrZHVrnQjEv5lQYzlLhJQ4pm6zYbi2G4D/NsL4U16qo+omScJ61/zn+V /wC+XqWP+ei4Msjzum88yP8AmFU39d+rXqa6A1+DZTz5lP8AnWDYD/z0WXeTR/wtzCsfc8yPMsup 49M3r86hZJr+pWLYWf8Aku/+SnhJnmR1rI88qy70q/iG4t0lyHg2FZoypXZ0xn/sIuA7+RmpO/kd HG6V/ii4Thv85xXNHT7HP+Sn/wA87wmrf8ioZcvfih9J8x49/v0wrHMF/wC/aear39hczpZdd/X5 hP8Am0/4y+VMcxvGf+wdzFhvN17+RUWnqr6tPU1mSgwbCcr9Ef6lYycS75ixP/nAcGP8joF/8s+q uvUznb1udWuvH9Ush4r/AFLyb34dZGMsy6iX+RZnmFH69KvpdwnongP+/T/f1nLwzFpwGZ5nlZBZ Hkf8vy2rdcuYbi/8h/m3t4CKcp4/lv8ALaDGcWPPV6qvOquJYtnbPmDZTwvv3HD+gLTR6iP+bb5R wbCfhxvJKKM8rTF674l/XXrT1Mxb/sZcydyT/hdWMOeUDWHf73H9fHns8r2R0zZi/m3z+MYtz2R1 7PNlM/8ALj7OeqtPOXf94P8Afpw3r1POHYb/AMZLt9XPV6vYdiY/rcf+cL/vt07c9Vv55TNiGG4t htf/ACn6Oeomz2kb/v256vV7+rOK/wDTJrf/AB2nggon/nlf/9Ku71M4l/zfjrJf/sJcwHkoUT0W nEcS/u56jakhz1er3CSt044d7MU/39f927y9HVI/MP8AvyA/5wuDcA+e1WiQZixL+ZV+M/8AOFwb 2c9QioAc5Yl2+o89QGz2kb/Lv5jX8N69VlmTMuf1J6aYNhP/AE3tByNM7zupQpHYjiWLYlj38p72 4e1qusQ/35fyfCcLwn+S+23CSt0juon+8P8AKf8Aki4NyuS1qibZiy3/AC3ARwaUB6RuHYb7B/Ob +A4b0UV7+W+H/OZ56vUeD0q5j/l1f/KcV/XThRntDTcirkMu4l/yRuQxU2Vbx6RMS/rtlHGenuKc BOeUMMjoAcw5bxbonnz+U4pxyq1aL6d87fzE4Ni2F8D9HWRUZXqrhp/kP82+4c3QgqqHqJlvFsNr /wCa4Xz1epnw7+qfUjAf6p58wr+dezh/WqLV/sc9PcN/nOVMLynQ4Lg2Pe3hx/PDTf8AI8szGjwZ My10+y1QZN/mmUqHGsZyHrlrl63/AGIo8WH9SOh+G1+DH/N7b4fyzhJRJ/YjNKecu526IZbx7GMW wvpPQ/R/LOer39iM0pZ4j6kMK/zaf1TwvKdDfhx/PDVv9io0U/qHiebM7X0/kuDcJ6Of7E5bQZ5d yP8A1boMZ/leEduU/nlHU0MeTMt24R1ujj5dxL/QP5Tz1FFJDqrmTCctZD5qiGibenjLf8yx7GOo WKeHBBRHVdvr/wCrX+gZzxbC/wDwVstcGO4+R0Dd+M8rUpzn4/8ATY/ZfmQOebKx6NBr/Mv5bp34 T53nZJwreR0zZi/3235qtU8n+U/IYNz1er2I/wC8OM/Tz1FFLLJmGj+Q5y/9Skc9RvQaf76fn/8A sdc9RRSyzDhv/fl4b16kdh+HYSaG5wqiN/3jz1epl/q2f+mQOW/ngr1f/9Orv1M/8746yf8Agy5g /wDYo5KFE9FrxHEvz8eeo2plw7/flfx4SVunznq9St/mX8y8fhpwho4oHM5/77MB4UUIqI5mLEtc Y/3h57I6D+ebKAPEf9+X7eeomoyvpn6b/wAyx45szRhP++bAfbz2eUc5HRsOomZP9P8A+mLwG0N6 Bv8AmX+gfzbFO/PV6vZdxL+ZY9jPPV6gb6q4l/v/ABhN9bcOsiojzqgbxHDf5llL+bf85nAcS04c URUjf+cD/wBjrhvRRSNxHEh8/bC9eer1CXh2ZMWwzHsGxbC+FFeyP/hdV4XRjO39ZMpYPi318jDP MjrIDI6sU9PHUjFsk58wb6NbcBuebaHGRVaN6qum+E9SMh/5wsL/AOSxgPCahjRTfSt1I/q3jxwn E+bomyKrdsxYl/vh/wB+n/Oe8eEFDiq68RxL+ZY8MJxT8uer1A3mLDf5bX/zXC/y56vUZjpVhuE4 lQf79Pv4f1qh9w7JGEYl/Jv5phP/ACQfo56jj+eU84jlrKXz1v5V9enPV7+eV3h2W8pYb/zif51x v+d0d0MeTMRynhtB/KcLynQ83/PKI5rvqJ/xpKD/AJJF+bzvO6tkVAFiOG/n4cBVHVK/Dv8AfbgP DiiSlr07/wB+XNUCqLV6iMyf12x7Bsp4Xw/rVdZzxLCukvTT/fWP9/PCCt1q6+u7q1/Mq/8Aqnhe Laf89KOZP7j5HWJO/GeVUPnP/e/Gf5nwY0C6Bwf8k4fr+9woz2jemPnqKKE3LuJf6f8A9Nr289Xq ZsR/32/Dnq9T1h2I/wDeDguDD/nneer1I2g/p4b16vYd/vB/Keer1d/85D9fZw+onp5/l2L2/wCS Tr3/AOCv/RwFVuv/1KovUT/zunrL/wCDLj/JQonoBuer1M/CSjeo38yxbDK/l6Oq5DEv9b9b8IM8 2VU0AnUTMhw3+zgPoRUU7qHiX8t/308N8joP55soNcu5b/rJj2DYT/03sTPbhvRNkVWjYdiWE9N8 P/qnkP8A39Yz/LP+NLfgRoc0DWI/78vbwko3pG5zzH/WTHv5Thf/ADgeHdFFLL+Y4TknKX8pwvnq NqKhmLMn8yx7+HDegPTzh2W/+MnjJ/lP/JA57+e16i//AFcOf54KKK5Yj/vt/wC91/M+Vr1PWI4b hPyGDYt/Kf8Akvc9XqPD6Iuo5w3Hv6pH/kjdrePAfnm2hpuRndXUf8iGDYt/HkY1JVW8elTq1/WT IJynimnATnlSlkdFP675JxbpL1LOLYX/AMkbh9kVVo/mTOpH9ZOmn/JW+HCSjuiZ4jmT+W49jP8A DhDR/Szw7Df6yYD7Oeo3oS+nf82y3j18U/5I3PV6rSMmZkyliWUv+STbGe3D6gTQY4j/ACn+YcIa G1POXf6p/P8A+/T8uer1Gxy703yn8h/NsK7cP6BP88oAequG/wAt/wB9PCCjzI6AL+W/6f8Azbx9 vCmjqmXEcS/ltB/DhtRRXLDs7fy3Av5TzVENADl3/flj2M4rinBBRHVdvrc9SH9WqDGbd/8Anmhw Y7j5HQN34zytb/OeZMWxKvxnFsU+7k/1jHRUcxZk/mVfjPPV6kb/AN6zhRXqZsRNq/Gv99PDevU8 4j/vB2/XTlv54K9XqD+nla9Tzhv+/Gg/m3PV6kVz1epaYdiX8toP489RRTPiOtf/AL68J/3ze3nq 9Xr4t/2D3/A/zL/k39vLfzwV6v/Vqi67f87p6lf+DLj/AAa1qgExH+bWHs8fu56vU8YdlrFsSoP9 9eE89XqDPEf97/1+HCGjivZi/wB9tB/ySv8Afzwor1E2zFiVq/28KKEVAFiP82/mH82OE/8AJe4L qA1D707y3/LaA4timE8CVHOR5HQ+5My3/La/GcWxT8uEdDekb1ExL+W/8kv8uer1M2TAcNti2KC/ PUUUjusuZDhteP4cOzTOd0DWXf8Ae4Ytinz384/mX7OG9EmR0JeHYlhOG5Dzl/2PsS1HPVqiof8A JN56iinm+E/If9jr/sHf5Zz1FFCZiBzb1HoMnYRiZ/nODZEwz+quW7Yb9ft5YZKRso3oSvTMDhvW n+U/8kThJnn/ACzKGm4//LSq/LJmJf8AOJxTkY1JVD/07zHi3TfNoxbC/wDkjc1/I6PsjzujXdVM yYT1IyHg3w4DqGVAH0rzsMNoP6p4pw6reRUscRxLCcS+PALR3QxdKsyfzKgOEnm6PqGT/kQ+rhTR vQl5d6kHDaC/jw2r1LX+uv8AMv481R3Tzl3Ev5jX9+/PV6jX4dmTCf5D/wAlb/fzwQUDKLPiOZP9 P4QUcU08Ka9QYZi7fr7eG1FFA9mLMn+n/wAp7cP6IM8oG+svVr+pOA4z/K9BgOG6cOMjyOgZnmeV rT9VerWLdSK/+bZoPMgcjyP+XVjHnv8AwwoqHUT/AH20GM/s4b0S0VD/AJH/APpjcKK9TNiOJfl4 89XqZv5kPZ/Dnq9Sy/mX+gd/19nPfyOvUx8N69T5h2JYt4H6ueoopl/5H/r56jenrDv94P1+PPUU V7/ko/8AY6OO89W6eP5Zi3+Lnq1X/9aobrx/ztnqX/4MuYODijmgZ/lmLf4uer1d4j3PPV6mgYj/ AC3w7f08IM82VU0G2c8yYtiX7MxZi4D6EVFo6if77aA/9j7/AJ6LMXNZFXqBvDrfz7+U4X/6kWnB fQf/AJ5RyOneW/5j/Jv5p9J4EaEFCVnPEsJ/5JOF8JKN6ATX5/8A36YT/wCI8OHdFFM39ZP5lQHC ML56vUWnMWJfzK2E/wDTB9nBjkf8soDZ7Sxw4HEq/wD314TQ/wA5wHDf+eiHKV7+e0zD/mEh/wBN nhRntG9Bp/3q8Wrvp4b0EaWOTOm+LZ2x7nqN6tfy70BxY5Sxn+V4Tz1eop/RjJP9W+tGM/zT/nA/ 08B+ef8ALMoabj/8tKrd8ufvfX+3kNVkHQ+5dxIfIf79Dp48FtAj+RUJmXP3vr/bwo/kdHmR53SM zDhv8tr/AObcKaO67/rJi2G1/b6LW5X+RV7+eUP3TvMf+n/TwloZUcX+ZjEqDhDQ2rn/AMlL/fTh evhzVHdDFkzLeLYbQfDm6JKNfkzJGFfyHv8A7+eH9Eud53QmYbkrCcSoP+xzz1Ef88op2c8N/wBP xk9v28IKG1BpiOJfy6g789XqB3qHnb+rdAMW4fUR55RasOzJr/Nrf7+T46cGX8jqM/55RTvV1iX8 t6S5zxa3+/nnsj/5aVEmdf8ALNqiXDf9+NB/vr5P9Yx0AnUT/eD+bfyntw+rVFnxHEv9Pvb6uENF NM3/AIw4Nz1G9M+nyH82+PPV6njD/wDsaf8AJH8bcc/4W0UVy/5EP+ST/rcOq1XWG4b/ADPnq9XH /kf+vhDW6e/5ZhP+Lh5/wrr1exHT/vw8tWqyfy0b+1d/l7/9G+ENbr//16uuu+I4ThvUvqX/ACvU f1lx/hvRvQBf79syV/8Av0HPV6nn/NvhPyH82xTFv5Lz1eoNcxf1Twz/ALHWM8KKEVFoznmTFsNo MZ/37fyT6OFFeom+Ysx/1krv+StXae36OC6g/nlDJ0ZyQMSx7XhRnleyOjwDDf5b/vpwvgNob0j8 54lhOG0B+7+rvDrIq9RaMw5kxbEqD4H/AIyvN0UUjsRthuAnCcLxfXhv/I69QO8N6A1O2HYaMyV3 8p/5LXPUb0ssxf77MA/31/rpwoq2eV7oz0TxbOuIf9ibhvRNV7XpV9JWFYbQYNiv8pF+CCif+eUf rOeSf5bgJwnC+B+t1R9h2W/5b1p6l/xH0nkaZ1Uy7kUeLLv+/IjkaVNWR0PmG9j+vhzdaoSqD+nh vRRT5z1B2kViOG/n4c9Xq7w3Ev5b8Bwn/kVDnI88oy2TM7frY8If5JQy/ndGuyYMp4lQfza3+/nh JR5/PKMthuJYTiX/ACS9eH9WoScNxL+reIf08IK3Qn/5ycH/AFHD6iCimZyzJhOG1/w4Q0f0VLqJ nXKeG1//ACVrcP6IP55RUcxZ2/rtj3++vXBu2nBjkeR/y6gZned/zCnrDsN/08afVz2eZ5RNkdEd 9buJf82zxnCfHntxv+WlXt9f+WbVEmYf99lf7eT/AFjzRac5Z1/mX++n8+eoooMeer3/AAtrl/yI fXz1ervDv99tedeb/kVerv8A5H/+Str9nl/+WfXq6w7+bXPs8fv4dUT084dbDaA/84U+PNfyWrY1 y/mJxGuGFa4yOwy98ebrUGuu9f8A76/98o/mfPVqlniP9U++V8Wrsa+GYsN56vUkOer1f//Qq56z fynLnWnOX++n+dYN/MswHXhvRvQa4dhv9ZP5z/KzXYLz1eoTMO6S4T/If+Sr/v5/71nCj+eUIqDP OeScW6bf79v6p/yX/wAGLgNo3oj/AFD/AN+X84sf/Ei4dmiLO6LRh3TfNmY/99N/983s4b0R0eHJ mW/6t0H++v8A5I2A8BtDmnnEf5rhuA/zfFP98vPV6io9Q8SxbEuwvw7oopG4d2/lPPV6mXMWZP5l XYzhOF/8kbAf6OG9B/PKRuXcN/0D+bePPfyKq0P3Tvpvi2JY9/ySeer1H5yZ6Fc152r/APkk/T25 6rfzyjw9KvRyctj+UYXhNv8AsJe/9PDegb/PKtGy703wnJOA/wApPD6imgy6iYbp7de/LU3ktUfd Vf8Afb6iBr/yXsM/p5CmdVkDuRQ+ZM/e/X2cjWppoy2Xe36+3nqN6WVBz1FFPnPV6vcN6KKY8Rw3 4/Vz1B2mf+W4thp/31jT2c1R/wDzyhMy71IzZhv/ACVANfo4T/yKjr+eUPmXetv+gf8AJW/kv38I v5JQy/ndCX/nsOG/8lTF9Pr57+SV7+d0jcxepDCO38157+R0TfzygaxHr9iuZP8Akljtw+/kRol/ ttSN/q3i2Jf8lXhxRTSyw7LeEYbQflbhRXqev5acNw8/t4SUMMiqu31M/awX+af8kb+aH+sv38Oc ioFb70y/8Nm4t1ayH/WvIX+/r/kv/wDMO8yArH7PP+F1Vd9ZvS5mzJP85/mmEf8AJB/56Lnpo6/n dVpZzy1/VrHvz/PnsioirvEcNxXLlDgpOgx7/jUZbIxLw/LhtRRXWHaH+akfznBxpY+B5uvU8Yj/ ALwfr8Oer1M+Hf77a8683/Iq9Wbh7Wqw/wAs/wBPP6/XwiyKt1y/5EP+mNw9onpmw7sOeo3p4/qN jH+Str/ySf8Agv8ALfw56iiv/9GtPqr/AFTxLqX1LxbFMJrr/wAyx/nqHNI3p3huU8Sr/wDkk8Js 820b0MWI9SBlv/mF8IrsE+PARRxROOomduoPUjHv5tinz2NcPqJ6B3EekvUPMf8AziP5Lw5/nhoh /keZ0JfTvpLb/kqYtf6ee/nho+ofMN6b5Ty3QfzbFNeAn+eCjeicdVcyf1jr/wCU3GC4N49+Hf8A JaBn86otOHZbwnEq/wD6Y2DeHD2na9nPEsJw2g/lOFj7uG9B2gy/305lr+ezyrZHQ/dO+m/+gfzX /ki/927woqtbBv4d/o5/rJlH/OFimE/8l7/mGjw3yOijPc8rYO6VejnCcNwH+U/yn/fzwa0EKNfh 3o5ynlug/wCSTp2PN0HaLRnPoD/Lbf76dOer1EG6zdN8Xw0/w5qhFWvj6u8tnLefMm5r7jkY55kd THuPSzyb3P6+zkM1kJkdGUy72/X283RtS356vU789RRXueoor3PV6nb+Wn2/x4b16vfy0+3+PPV6 kbiOG/H6uer1I3+reLYl+3nq9Syy70TxbErfzTx8Oer1GWyZ03wnDaDhRXqWX9Wueo3pmxHDfz8O ElbpmxH/AH2/w56jaioZzyThOdqDOR+rnq9Vlv4ROZP5lgP9U8U+q3J/3HzysS+1TI6OP6qvw8On 3VqgxnNmF4R/JcZ4MZqMv53Wnz67vw8uoXROvxnFsUylXYLgx/56K3Cj+RUM/wCeVR7iWW/5b/vo Hx56vZFTNh2G/wAyr/5Tw3r1Pf8A2Kb83/Iq9XDEe5+nmq9TVz1erj/LcJw3/kqYtw+onr2I4l/o H/JW7eHPV6mb/kQ/m3PV6n3+si7/APkk0P8Alv8AmThBXv55mNf/0q7OomWRiOfM5YTinz+C/wC/ PH7f77eAv+dVKH8jr2TOgOLYl/vpwvFq7+TewcJM8zyjj+R0MmXfR11YxKg/314TjmNYyP8AmGu3 Cb+eV7+R0zYj6J+t2ZMe/lOKZt/kuM/89Ll7Ltue/nlG/wDIqWeHehXNeW6D/fri38Oe/nlFH8jr j/UnKfTeg/314T/Ov+7izFzdG1E46q52ynhv85OKf75T/wBg7w4yPI6CGeUR/MWI/wBZP+SXhH8l wbg4miP+d0y/y3/nE4WfpHDeiOmbEem5/wC/zj3CivUJeTOif8yr/wDfXhP589Xqss6MeifNnUfI eM9QsLwmu/k2A4ZfLX/Y24b5HRRnueVtFfhm9Af+neOmn++n/nGcN6CVXV5MyThOW+H1apY4jhv5 +HN1qgbzFkn+ZfXprz1B2iC9d+if8yoMZ56vVrG+v7oDi38hxnw+ngJzzI6lHIqIN0YxL+Y4Bg1u /bkL57WTmSUcbLuG/wCge3hTR3S356jesWI4n8Pr56iinr/kQ+rnq9T1z1ep2w3uf18eeoopZ4dl v+ZeP1c9XqEvLvRP+Y356vUPuXeieE4b3wnnqN6ev802Ec9XqZv6kYT+tuElbpGZi/3289XqDjnq NqY8xf77b8D9HlFow7Ev9/2M4TwQUR0P34ZuJf1J6tZzyn/2M/H6eTLuRUAdqmytqP8Aq1/vh5NV Yv0AfWboDlPqRlLGcp5owr+dYNz1erR6/FD/AAu8W6J1+M5syHhP/NtMe+n/AH0cIKHH88qiPDsk 4tb2/wAh56rV7+reLYlX6/75fG/PV6u8Rw3/AED+bfzbnq9TNh2W8J+e/wCSt/JeHuS16vYjhn+n n+V4twir1I3EcN0HgeWzzZXqZv5cfZyterr+W4x8L/8AM393D385mW31+VU/4ZV//9Orn/O31Cy3 m3GbYv8Azr/fl35F/wDIhUz0frp36kMp/If8anKlDjXCj+R0b1Yn0Z62dJ8NwH/fXhVDgv8A4MXC ihFQ+5d9SHojyTQYz/NPkcaxnhJW6JB6mfXV0ozJQWyuKH/xHLcGP8joP/zwVTd1m6+9Q87H+U4X hP8AJcG4NMjyOgbnmeUTfDsk4tmPEP5vig/nXD2imnnDum+LH/fTheE6/wDYRc9Qdpm/q3/Lf99O Fj+d4z4jnq9Q+9KegOLZkr8G/mn++XBuer1bE3pV/C7xbqPh+Df1owr+pfTP2/8AOdxbhvkeR0UZ 5nlW8Yd0SwnLdBjPT3K+E/yXJv8ALfDg2qLqNf6RMt4TkjoPk3CcL/5wOnNEUI6Nnzdar3PV6sf8 t/1eamt0GmYsk/zKg7WA5ug5VQ3q79Lv8yw/GTheE/RzdH2S1qV/5uMW6S9ac5dPcU/6aX9actcx 5zzZWTe4+eUZXLuG/D6eBCpPp6/lv+rz1G9df1a4SV6lnl3LeLezUcO69QlYd03xbEteeoopZ/5t 8Ww3/fv/ACnnq9QlZdw09/1PPV6hjw7EvrHCSt0JmXcS+PPUbU84jiWE9u3PV6g0zFiXx56vUAOY v+Sh9X7Oer1JDDsN+P1c1R3TFnPEuEVE1FTxH/mLDw+qtLH0ZYl/Vv1pfyn/AKbvJL3IqGN+K3Os uf8AJCwX6OTLWNdd4jhuE+348P6DdEF9TPSXKedsBxnKeKH+dYNj3t56vVow5y9LmLdN+vGcsp4p hH++bAcS4QTR9/O6Bvrv6Xf5b/xrMMwnmqOsjzygCy703/mXbm6tTxiPRPFsN/5xNuer1M/9ScW/ 5ymEfr256vUDeYukv8tr/wCbfynnq9SM/qR/Leer1M/9SsV/Uf2cc/kWW16v/9SiXET1BxLNuM/7 9a7/AJKfCihzQl9O+ifW7O1f/Kch4TXY19HPV6j8f8Nv+tzDcB/m2KZS/kv/AH8hz38iNNf23otO I+krrdhtf/v0weu+PCSa9/O6WmXck9V8tUH8p/lOOcO69/wsplzF0l63f8lbC+k+OY1/4MXCSnaD X/NN6hMSr74plOuwX/v28O69Q+5c9JfVjMn/ADyeOYzz1B2j89CPwu+t+Jfya+U6HJf/AHcWY+G+ RZFRR/Pavb9O/wCG/wBPOm98WxTCDnTOf/YRZi4cfyKgX/Oqte6eZcwrCwcKGvjbh06ohMiiMUje s+W/5aRi1vr5bJK3neyvdCB/Lch/yk+zmynGa9kVDTzdVrHQf089Xqe+N0I69wkrdIrOWScJzJQW OFXPDlCuBONaNaun4sXopXJeOYL1wyphe5cEAyvmNh2IOt+RnvrkwUARsNTH2WZ2RRBcu5J5AVZM 0M2Xekn8y5qjuhKw7ona/wAeEFboZMmdAcJw2g56vUJv+aXCcN/5xPD+tVwxHJP56c3RJQN5iyT/ AC6v56vV1/LcWw3nq9T1h2Jfy3nq9Tx/MsW9n8eer1M+I4b9Y56vUAWYsN/3/X/Lnq9Szw7Df9A7 fVwP0eUAOdO/1fs56vUWnEv+S9g/0/s4IKI6RuI5j/zb+sPppi2KflwY7i0Dd+K3bOlWZMJzJlPB sW/7Fvb6zyf6xKzyhMzFhvhf6Tw/oD0AXUTDf9A+nvz1eoqGYfTf09ztgP8AWzFMp/7+eHVFFew7 0K+nvq1lLGcIxTKdDr7eEtbqiP1d/gwZs6S49/nC6Dj+dYN/2DvCCaGn87oAcu+ifqxiX/JUymMF v48P6I/55QmYd+Hji2Jf84kHnq9/PKHzJn4Q39dqD/jUAYLz1e/nlBp1V/AZwjDa/wD4y+Lc3R5/ OqBz/hhjqF7fyHPV7+dV/9Up/oR/Dx6sesbq1jP8rwr+S9M8BxP/AI0uYueyPI6Os7zv+XVuD9O/ Th0S9JeUsGwnK+EUONYzwZjJahb+dig2zn1IxbMn++rC/q5eq0DWHdE8JzJX/wC/TFr8IKElDHkz 0uZT1/300ONeHPTTP87ofcO6A4T2/lND/wCO3nqerl/mTyn8/wD79Mp0N/Zz38iFVoS8u5Jynhtv 99VDp7eH9eoS/wCW4R8h/KOeoO0scu9vq/bz1ep50/5K2nPV6kb14xIf5tP5rfjeSbaKM8oNOhGJ fzLD+OV7I6HvnqN6fKD+nnq9T1wgq1PPPUIq9z1eov3qG6SYR1Y6Z5xyjieFbhjuGnt4cZzJj822 EzMUa5Lnn8vNayGXOm/9W6/GenuKf8lnIeJf1W5ijndZ0ZJ/wxoZMu5a/o4R0dUJeXcN+PPV6hLw /Df5b3156vUssR/7GnPV6gzzFhv8t/5JX3c9XqZv5b/MvD48EFEdI3+rf8tv+XPV6vf1IH6256vV 7+rf0/fz1epG5z/32UH089XqAP8Alv8Ap/w78D9HlCT/AC3+WYDzdH1FS6if73t9P7eaohoG/wCW /wCn/wA256vUQX1VYn/zfjpppf8A5h/Xko7i1GO/Fbg/p2xLNnTfppg38r/42mTT/wCSnk0VjHnt HIw7q1hOZKC39bKH6Tw3oJUGuc865Tw2g/5izh/QbpG9KsyYt1IoMZynhf8Avlwb/sIhz1FND7l3 DcJyTX4NhPDqtUMmYst4TmOg0+/hLRvSNy703wn/AKZND8Phz1FNM2Yst4Thtv5XhXPV6vZLw3+W 8Oq1XsRw3+ZY9r9XCWt0Jf8AUrCfZ+v3c9Xq/9bbpx7L3Sj0xZPTIXRzKFHgG8AiLAgAwv7QL8GW SCoxzwRNE9xHDcWzJX/zXjlUpZZd6b9xz1eoS8OyThP/AEyeer1LL+pOE/8AOL/3y89XqEvLmZMW w3/fTinPV6hL/luE5k5omK3SMxHpv/0y/r56a9TPh382w3/kqfnzdapZ4d2H0c9Xqd/+RD6+er1M 2YcN/rJlPGcqePK6cZopoj3p3zJ/Lc+Y3lPFPq4d55tomyOj94d2HCahfXDnq9S343W6eOElCOvc 9Xq4Yj3PPV6qJPW703/zb9aMG6h4X/yR89/8xLzH/tTyScyBrK/srzz/AIW/kaB3kX1NFCTl3t9X 7eer1Lfnq9Tr/Lj7Oer1M2I4b8fq56vUjv5aPb/Dh/WqZsR/32/089Xq4c3RJTPiOG/D4X56vUGm YsNwjDfr56vUDf8ALf8AT/h34H6PKWOI/wC8J+jm6PqLZnHt9Q/jzWR0QZ5QZ5dw3+Zc9W6IL1E6 b4TmP1idNMp/9jPvyUdxajHfityD0iYb/MsA/lP8q7ePMgMj2VjHntHIzF0T6e4l/wA8nQ/HmqCV A5mLoD0nw22Lf1ToeH9BukZl3/fbm3nqKaWfUT/fbX4N+3h1RPRlsmYl/MsB/PhLRxXv5aPb/Dnq NqRuYvHnqKa9h3++2g56vV7JmHfzKv8A5tz1eoaOeo2r/9faL6h4l/Mc94yMU7fzLTg1Aiovp5y7 hv8ALeboooZcu+HPUbUssOy3hOJHnq9TLiOScWw3/kl89XqZ8OzJhP8AyScU+vh1RRSxw7Df5bbF sL8eEtG9CVl7MYxK/GXGwRWwaeMRy6MR7/eeNJuUgY1vTSOGXP5bxSFA1qnqg/p5atUzYd/vtrzz RE1uiB9ZcuYr0n68YLmwG+C4+bafDh1kCgaB2eCDRssOzL/oAP1c3RzSxw7EvrHCWjellh2JfD6+ VUma3Sz4RUI6eOer1M/PV6ia+rvpIOrWQ8Zwn/nM4D/zDXAdvxkQzDLakfcfPf5dmVUq5MxIYkf5 Tin/ACWcB5jBWaFDNhvY/r4c9XqWP8xHt56vU84dmPx+vXnq9Xv5l/rc9Xq7xHDf5l/G/D+tUz/y 3FvkO3PV6gzxE4tqP5T8Oer1M+YsyYthtfg2E4XhP189XqZcRw3/AJy3jz1eoMcRw38/DhDR/XsR /wB4T9HPV6i05y7fUP489XqaMu/77aD+bHmqIaBv0Q9N/wDah9f/APWz/njch/8AMS8mvcioX33r bu6d9N8I6b5txj+V/wDJHx7kzZFsrGTPKMtX/wBHNUV0GmYvHh/QboqOI/77c28OqKKWPVX/AHgH N0TZ5toY+jeJ/wAywDjL2yjrIttDNX/0cKqNqDTMX+/K3w4cgQKKKZsR/wB9mA+3hNW6WWTMN7+H hzRMV6hN5SvV/9Dakznhv/GtxnwP8y4Nqi6nnLuG9hb6Rz1FNDJhn73PUbUs8O7D6Oer1LGg/p56 vUx5y6cYXmOhP8s/3zYx3DDiVDpBxxHTVyBRbMOzJi2Sse/lOaPqtwSA0S0Pv++nEqD+bYXwlrdL DL2Yr/76sT+0NL8TvMziNtHANLL+XfH+PCivRTVw7rVMlf8A0ccrVBh136cf5yOm2M4QAP5xY/1c PjfjSVeKKKs9yLCiqdGs7f1kyIf5p/yWcB/4y2ZeCCiXIqH3DsS/u4SUc0MmXcRB8fp5oiaN6Evh DW6eeeoRUz89XqZMRw38vDnq9Wvl6qslYt0T9Q2M4uP+YNz5r9XMZN98lGX5lNZk7j53/MMsr2Gf vcBVSdSxw7sPo5uj6uHPV6nrDsS+Gh8eer1PlBzVENd1/wDRw/rVI3EcS+oc9XqDTEcS/u56vUi8 RzJ434Q0efyOmnnqvTFiP+8J+jhTXqKjmL/kofr7Oer1Fp9XfUj+pPSQYThf/JZx7gxyOgPnlWW/ ga5bwnDekmMZs/5zOfMT5NOSVj9ne2tkDEP+SD/vrwn/AJINuDSowz2tb71V/i8+sX/OXnLoh0b6 eUOTMZwD/jMf1i/5LmvbkmZIygnEcZ9ahjPM9oguYs7filZ2/wCNZmjNmav5N/3bvDygbVinoR6/ dWMRzaOk/VDFq7OnjlrMWYueqmR53V7ecsN/mWUrcKKO882089GsN/luHkcqsYVvIdtDLiPY8JqO aRv8t/0/4d+HVarrMX/OE4S1ullk7x+v+HKL2V4Uteao3r//0dtbOeG/8a3Gf+9la/BqDUMU85dw 09/1PN16hMw3sf18Oeo2pY4d2HPV6nmg/p56vU74d3H08IKtSF6y9PhnTA0XDyBi+EawE+Pjbhtl DwSqDsNFmetyMOG2ig9K+pH9W8d/lOKePBCtMiKI6NeLYl/v2wvhPQtpYZfzECRhfiPHjDrIVjxq wVS04T16kbX/ANHD+q0q8A/3gX9fDhCKcTVX+ccPHSf1D4zhQP8Avm6tXzQT8RpwasuakzQKUIzO hNw7Ev5Zxyr0JeXcx+Hs5qjeh8y9iNx3+vhC6jUKOAaWnCShHXuer1MmI9z9PPV6iO+v7pthOdei uMZrGE/7+MA/41H3cjTffJJqYOyvOv8AhlVK3TvO3+gfynmPVZb0PmHYl4/eObo+p5/mQ9n8Oer1 M38z8cL/AF8eer1LXDv94R9HNUQ17EcS+ocP61SMxHw+vhBW6DLEe5+nm6PqZv5b/q89RvXv9++G 1/PUUUjMxf77aDhTXqLViP8Avf8Ar8Oer1Ve9dv5v1968YN08yv/AL+f+eW/Pkmbj1F2eVuPehH0 u4T6b+g+TcJv/v55NlY+53ndWW4d/vtwH+a4p/vl4bUCqqh60dNunuJeojBs2YXhND/Of+elP1cG mSVj7vv/AMtKjL4dh2E/IX8OHlXrvp30T6e5bzbjPUHC8J/3849z1G9Guw7Df5lQHhLW69h+G/y3 4jh1trVO3CWt1zw7sOer1I3MH+933c9XqWOTvH6/4covZXhQlcRVav/S3Ic5YdfHsZ04NEmRUX0z Zdw348PKJ6EzDuw+jhLRvSxw7Dfj9XKqVFbp75WvV7nq9TvwkrdEC9VPTg4dX/518sixH/MSH2j2 8Gu76sYO2gdngxp76E9R/wCZUH8p+rl1IB217IaH7EcN+scJqOaV2X8wXP8AK8S0caA8YdanEbau lXDhT3iGHA/C3hzzTuqjUiusAxDctj9fK3LeoV5JiiC+uw4XhuIdHcWOmMDFLJb2WH7eH+7xJJoH 56BT5mHEsp4b/wA5ah45XqBnEev5y2Ccr5Srs6X+HN/yKiL+d0VHrN+Ib6menGAnFsr9EKH/AHw+ GYuGpyGa9/bii09CPxr/AFCdWse/lGKdPMq4Lyn9nR1+01v+3NWh5L/ENzZ/z3fT2i/8R25/jwoO 7vWfbR3/AG4o8fTzrZlPqzh/82yvi1/o4THJooZZHnf8woSOoOXsIzPlN8pYmb/zzDtn3W4Cc5VM 1J2SH+XbK1w+s3RPFugOfP5T/wA4b/nmsxcx/wA7yT+XVmhuPnn8wyyuGXcyfzKg4CqHFPX8yPs/ jz1epl3f9jbnqN6WeHZk/lv/ADlvr56iill/Mh7P4c9XqZsR8Pr56vUjP+Slz1er2Hf77Rz1epJc 9RvQYZ07/r7OFNequ71EZ2/qTlLGf+mzj3f9TwZ5HkdEmeUeH8In0l/y6g/2hM+YT/v5x7/mGuSX kVY+Z5nlbUWXcN/llBfFT/v575by8eShWP2eZ5SOxL/fjjv+/XgzyXJIqMM8zyia5iy3/MutP++v h/Ua0bL+rf8ALKD+nlaGNPWXfDnq9Qx4dhvx+rhGpUUcV1j/AGX6+ab2UUGkbw9rVPWHdhwlrdI3 MH+933cORsrVLHJff6z/AA4SZ3WzQmcIq3X/092rMX+92L/V/AcGbf2iovNNGHYd9Q4eKVFE9O3C ajenyg/p56vU98brde56vV7nq9UbMWGYbmLBcVwnEtY2BD/DidAKVCNhoswIM7aqMrzivRXqzjGV VIOCMAQfh34PELCkgjYaBREGrFOneY/6yYESdLf08Js7SJmhjkdPWIkYbX8KK9Syy7mL+ZUNz9/G lNAma3Ne/wCSbXe2/wBfL4EVqkR1T6JZS60YfhOF5nBIwU77DvqAP2cbZzz8jjwNXOSEwOigFX0m YVl3D7/zY4x8CLcPU5+TRIciimfDst4ThuPX/lNvhw8olofv6k5TzHgIwnFMJocawbhEpcGjutVv 1uejnFvS76h/87HS/Cf+baY8f606cPMiNAbPKMvkz/jbYDguK4X9XDavVcb6JOgeLZHocWzVmdTg 2+6jLw7Cwvc8jXPM7qUNxsio8eI/78a8cIQKlCgy6i9F8o9asBxfKWasKAwlr7cfB1J9g9vCXeDK E322jjcfO8yy7ZWvr136KZs9N+fBhP8Azhv+eaPMZ88yL+X1mduPnn8wpjw7Mn8yoPYfHhHUoV3/ ACz/AE/9fv56vUssOxL6jz1ep656iimXEcS+s89RvXX/ACTfo56vUGv9ZP5l/wAkrnq9XDhTXqDf On8p+Q56vVWr/Uk+rT1EYN09ws/75sB5J+RVGGeZ5W5z6d+imE9N8h4N/vp1wH/mGcuDkzZHkdYk Z5nlGvw7DfH/AJzJ14MKB9I3+W/zHHgfh4cP6A+eUGuXMk/y3PmM4t7eHU0EKEvOf+8R4S0b0jsu +HDqtUPeH9x9PCB3ZRwK45h/3hP6+HGrfaaKTQP/API/9fBLRNSxw7/eEcJKOKDXEf8Ae/Gf19nD qtUsMm/7wjjT2yikUJ3Cajev/9Tdqx//AJLmLfQv8ODFn7BUYK213h38pufb4ffx2ielrxujemjj lar3PV6nfjdFNe56jeuH8wPt5ruhRTNEe9ZnTf8AmWBDqDhf/JZwHw4e5CrGKJM720DXp46j/wAu 0Ot+HC0BQg0SZFViuI2xGg/m3AcIGFDWg1w7Ef5bX8OyK1QlYdiQxL+jhLW6EjD+/CCjgV7Ef+Se eer1FUznhv8Ap/t8bcHNBCljkzEdDpyq0yIrwom34kWI4Thvp5zji3/OZ/55rlsiqmd7aLR+E16X sX/zaDqxnvFb/wA//wCYay77OUz3PcaOdx8jq/KyYfRLho72sDyM6lOeFI/X5/8AlP58NqJ6WOG4 aMOoBhYNxrY8KaN6BXrp0Tyx1qyNjWVMUsMSZV8vHNtmU/fwkzzIhmAAoYbk59/Lsxmta7OXTfFu iebcZyniev8AItQRzH7PMjrOnIs9/mIrrDsSGJf0cIqPKWOHf77fhz1ep6/mP+gft+HPV6kbiOJf 6fe31cKa9TLiOZP+cTw2r1d4d2H0c9Xqe8R/35W4T0d0R31VdSP6k0H9U8L8eHGRUCc7zujw/gi+ l0E5x9TGfMK/3zn/AIy2Wh48yE3HyOsYu1TPa2Wcu/78rcGlQDQlUGHhRc+HjzYFbAmg1w/DrY6S T8bcGLioSTQFApGj/mLcZ+j9vLjZRRXec/8AeI83RtTLl3w56imhkw/uPp407so3FM2YcS/lo/Pm 29leNBt/yP8A18P6CFLH/km0Hjwko4oGv+RD6uHdE9CXk0fy7D/28Yeb1CKsDSz/AJl/rcKoo2r/ 1dtfLvVnCMyY7jP+/bT4clACKhejK4d2HCWt084diXw+vlVJmjelhxDVqZq/DwRcHilp2aJyKbOP 1qnfjdepjOIfy+uI7305ZSQRXga45hwzC8x4Di+Ek3GOCx42lKgR0CrEiqP/APft046l4zlMf9NL g3qLatF6MZ2/mVAfu4T55tob5HSzzDh38urhblW1hSZo5Ir2HYj/AC7T8+WImtUMOA9m4HbnZTiN tLDhZRxQC9RMNB1734NchM0SxQPYdiX8tr+WomogfrcyT1C6kWxX+U/zrBsB54CKIc8ogXRz8S3q r6KsQwXp9mrKP876arfa/iL+w+HDF/dtLgg1bIc+OXVsQemT1pdFPVBlVcYyFiwckbXwKS2/8hwE ZtkC0HbIqUckz8Gjo8ClDOvc9XqZ+er1Ez9XPpxwnq5lIYxhWFh83YGA0bL4i3AXvvkX8wEVMfZZ vwcuVVE2I4b/AC3HjhGKf75eQ1WXdLDDsNt/yS/HhBRxXf8ALT7f48Ka9SN/ln+n/r9/PV6vf1cx b2/r93PV6ll/Vv6fv56vV1mLERlvAf5tw2r1Uf4jlvNnqP674LlPC/8Aks58xM5Wtwc5FtqMM9rd s6MdJcJ6JdJcm9PcL/5I+A4Zryf8jrC/PM8/mGZ0avKNAI0ZzqBpzYFFSRNLbmqNaDGh/wCS630H hvUYjbSO/wCc9w/ompIZ07/V+znq9Xsu+HDqtUPWH9+AajkUkK/h/RPQa4b/AMlE8O6J6d8xYl/L aDX6OElHFBp/yIfVw7onoZcu/wDJP/X28JKOKfeer1f/1reBnbFum2fMZ/6Y38yvpyUKhereOjPU jCcy4BzRFeoytBwmrde/5JvNbaN6V/8AyUaHwueENbpKcP6J69z1erHX89Xq6w7Evh9fKqTNeqtL 1u5J/luP4L1CwvuNDwY7vEkY7aBWeUz9Cc7DDa8/wPLRRHkVWV4f/wAaLAwfbwOuLCFz01KQxFI/ iuq0ssu4iD4/TwkImt0LVL9nhDR6ztpK5kw7+YAacN8qeCNtEWdjGi15iw3+W1/BEDRRXsu/78v9 9OKePbnq9VdXru/Dxwnq1lLGc2dMMJ/39f8AYO8oleMHbVM8yOtcLoP1I6hekvrT/VPFPnsl8OqB NbXXpn9feEZkoMHwnPmLA/8Adw+3hJneQAYgY1J+R78Va5h2I4ZiVF/NcNIKnxHAHCpg7KlPCnzh fVaZ+er1VQet303/APXQsrj4ZlA5GG/GR/8AMbWTPZXvx/zA1Vxl3Ev5b/HkLVkNXq/+jnqN6ecO /m2JHhTXqEvDsN+Hwvw2r1POHYb/ADLvhP8Avm56vUAXq7zJ/Vvpp/3vvZ9PPUUU9/g8elz+smbc Z9QmaR/yQf8AjLZa5NW4+R1jx2qZ5/zA1sfYfhwxGuJww2Hck8k6saKGLD8OWhBAN76c9RtXPnq9 SN/5H/q4b0EqDXEf+S79XD4bKDlI3Onf9fZzdarrL3+9/wCvx56imh7w/vwgo4FI/MXh9fD3JKJx QaZf/wB7z+vt4dnZWq5Zz/3hPPCvUi/+R/6uWooofcOw3/QLX+vhEVQaOK9/Lf8AV5uaKK//19g7 1c9Jf6uZ6xjF8MFsHx8ajkmtLKkgmoYIxpn9M3Uj+rePf1TxT/kjHl61Vx2XsR/mNB34QqHGt0zf 1j/0/wDlWKacsEgV6nghaAHFMNG4EajmiARBrYMU9f8AJRofDjeCVV6mvj9ar3PV6kTiBGHV3w4c IVImvUx9VMt4V1G6bYzhHgRcniZsKS5B2GifPapYy7iWLZbx7+U4p/yWcB4OajCrXug+df5lQn4c CGebak7I6H7MOG38OEoM0c00Yd2H0cO61QiYFXb02ngduESKcQqDT9woo1oGs44dce3w4M7dzUmi cigdw4/y2v8AHj9E9DHl3Ev5lQXHhyihxo4qm78UP8PLCOtuUsZ6sZDwn+TdS8B8P+mtzyHAdlEu eZHVK/pV6tYthtf/AJvc+H/fzgPBhQJq8HoR6os19JR/Kf8AktYNwpzzIqO8jzz+X1cX0q6+5A6s Ua/ynFQcWt7+Xyfe+HhryLs7yMjCpryPPARQ1cKKOqxY/h2FYpQ/yzEzeNgNvLGrGqDvV36bx0lx 7+bYX/zBuPcx6zvJP5dWZfZXvx/MKJriP82uPZ4ffwFVNNCZkzEuer1D7kz/AH5c9RRSzxH/AH2/ Dh/Wqpv9XedsW6kdS8G6e4X+fPV6tor0qdFMI6A+njJuU8LPbDdeZMZHklYJb8Z5/Mcyo4+XcPGG 4IE8SN3N0S13l7E/5iCf8I56vU9c9XqRv/I/9XDeglQa4j/yXfq4fDZQcpG507/V+zm6KKecmf73 /r7OVVsr1DJwio4oM86d/rH8OHuSUTimjLv/ACT/AK+HSq9SMzniP+n4Nr9PNgRWq9l3/flX82TF FND/AMIaN69z1er/0Nzfrp04wrO+XsWwptCQCRwYsqJSCajBQg1SBiGG4tknHv5T2xnAfDggoH1c b6Vuo652ygd//JWGrA+zhHnMzR0JnChk6iZdBoTimGfaGpHKZKsTFVzxPGkd09zr/Mh/KsT+0OGt wzIkba2DQmf8k7/kl6378LCJGNap5/5KHKYIFG9NfHaKKYcxYbeg5qa9TNl7ER/ySuGziBt6KKBV UHq6yT/UnqUMWwz/AJI+Pd7fTwZbvqJTJoD55xpZdCc7fy2v19v7eOZ5squRVaLl7Ev6xYEDwBOg IWFVKQ2Uz8WVWnnD8R+HGnWtVbBoSMPrlaiDH93QcBdHQUQKZsToAVuPu4bZa5pFE4TjQDZiw3wv 9J4JKJa7y7iXjb6BzVG9CV/Lv5jQcJa3Wsb+KH6FcVyTmz/aE6X4T/vlH/MS5e4MsioFZ3kdI7oP 1IwnO2Uv+xz8OG1ElDJiGZMWyTX/AM2yvi1dgvPV6jv+nj8R/F8MOD5U6yDX/sIuA7O8hAM1J+R7 8VcZk3qTlXqNh4xXLGKeYvbTvwCO5RoxjChuM5mkj1DyRlTqPgOMYRiuE3t3Pt+7hVnORfnwATQy yPPP5fVEvWbpL/mlx7+VYofq5j/neSfy6sz9x9+P5jQZYdhv8tvi2F8BVDihky7f/nFc9XqEzMX+ +3KX82+/h/Wqq69CWSv89frvwY4p/wAkbAMS/rSLfRwX7k5LGYk0CO1PPP5fltbgzYeqjB8LJ0UX J+jXk/6sJrBmnWOjxKircTa4/lMg3qpIv214VUbU1ZNy4Mufzex0ft91/wBnCbJBW6V9X9kfXw7V RUukl/yP/Vw1omoNv+c9jP1cPU7KDlBnmH/e8fr7OWoooS8mf7wfX+zmjXqEvhDRxQN5hH8xA04N m0aRFE5NPGH/AO8Q+jlV7RXhRas5Yl/p4++3HqJc820JPSvt9/GnvsNWyHbRgeEtHFe56vV//9He ExH/AHuxngya+0eVReart9XXQH+Z0H+cHK/caW4ctuTgdoooIoqHp46s4r05zYQRcHQ38eOKSCIN FANXgZdzHhWY8DuO3iOB5SFa5FC+cKI/1CP+bnPY/lfjwasua0BXTQQIo13TvqR/WOgvf6RwozvI QKNsjzylp/yTeFG2t08Yh3PG2tlbNNfHa1QYYhhww2uvw5SqRNFFF/8AV5kn+u3Tb+a9sYwHXhpk BhRFEOebKq86d5k/ltfw7oG1bv0Hzr/MqE/DgQzzbUnZHQ+4hoP5rxpqB4aOTTNx6tU75bxH/T7e HGM3RCYq5NCdwG0bUGeYMOuO3BjbOahRQRQbfyz/AFuKKrSxw7EfrHNKTNerjnPJeEZ1wHF8IxXC v5zhB8OJ0vAQFGCatprXy6zeijFeiefMYzZ0vN8FP/MS5e4IEqBEigR/I6aP+SlQey31cN6JaBvE cO/ltfz1eo13Rnq1mzJN/wCV4twpo6/nlXIdCPUhhHUjD/5Tin++XGeAvO8jqTsjzyuPqY6LL1Jy myq18aQgZdF+19eRhvvkX8wFTVuPvt/LsyqnHEct4tluv/lOKHmPv8krM7+d08Yd/vt+PHKPq5dZ s7fy3otnL/vWac1RDSM/AjyT/Mc+dZOoQ1/kP/GW/W3Jm3HqGO3DPMa2hv8AkZ+rg241jTxp05Wj Sm/nq9XueoopHcN6A9Bof+ShjX0cPhWqBz/nPc3RRQ95ew21BxtbmmjcCnnEO5+nmmtleNA7/wAl Kv8Abw/onp4xH/fbgP7eEtbop+YsS+PDugTnlD50X/5IZ5XPNtHuR0NXCajmsf8AMv8AW5qK9X// 0t4TEf8Ae/8AX4cGiNlRfXjh2E5joDhJ7d+UcWU48K8BVOPqZ6KYt03x7+bYXrg2Pd+HyVA7KCND H6Vevv8ALr5SxXlHWgsQaNwaNb13yT/XXKgxXC9MZwLt9/N5GuFR017PBRHenfVr+rVf9H/MS8PK BtWWZKzphGY6G4PA7m7Gg4UNCaWn/JN/70/Cv41Wnzmq9SJzBh38xofo4aMKgxWzQbYj/vywLGcK xT6+H2nxTRPVHuYsN/qTnzGMJxTXw4dVF9HG6E51/l1dgwPjpzSkyIo3yLbVouHYj/MsDv7e/ASW 4cmpRnCmfT/kk8U1Wmj/AJJvN0UULuXsR/mEZP18D2ZshOyjwGTWXEO5+nm2tlGZoNcRw69cD4nh 6hUiaKK7/lo9v8OWrVO3PV6kfnLLm4cbacChNbIop+c/TflPMlAf5WeHlAn+R1Wj1m6J4tkmv/35 4T9HPU5Qb4d/vt+HDaiGh9yZiWLZbx4fyv8A3y89Xqtd6E9fv67UH9U80f8AJa8eRrneR1J+R57S N9TPQL+Zf8azK/8AyWeQtvtkkist+yzfj+X/AOQ1V3/LD7fz5DVZNUU/1d9SP6t9FsZ/7H3N17PK tC/Amy8o9NWcc0k64/mRnsPYLX/jyfNyVxlwHTWMnapnU5jV73D2oar3PUb17nqKK9z1epF4h34b 0BzQb4j/AL7aADh/VaDPDP8Ae4/Xz1FND5h3cfTwgo4pkzhX7ECjw04fZMZNFSlSaSeHdh9HDum6 Y+oeJfy3ATyiOJrZom2Yv+cHw7oE55RsOlf/ACQ8H+vhK59po9yHbQyfzH+W+HCVSQaOaZ/5gvt4 cd0K9Nf/0952v/3t4MGPtFReaZ6D+nj1arhnHJeD51wP+T4rhd8J/wAPErawDBMmrkGJqkDqrknF uiefP+xL/wA81fgkoHVYl6eOrOFZ2wH+U4n3424k7Rto4FEd9XmSf80ubR1Ywv8A5g3Hv+YlHDzI qBWd0svTx1rGHV2Dj+bXwXlFoCkkHjXsiNWj4diX9ZKDgPoa08YdbDf99XbmiAca9WXlq9QYYh/v tr+HQM0UVTf67st/1Jz7gvUK/wDvmx6/bgvyLZUW57QZ9Ks7f6fg39nNVarqejGdv5lgbfdwIZ5t qTsjoTMw/wC+3/ft7O/KNqkUcmmfEuw/Xw47RPTvk7EdLfXxPcN6k0cA0J3CivUx4jhvx+rlkqmv UjeHlap6w7sOEtbp5r+er1Br/wAk2u4dVquOYunGVOo+BfynFMJ04w46UHHZRUBVUHXf03YvkmuH 8rwr/fN7eH/8+og/klFqw7Ejhv8ARw2okofsu4l/La/BsW156vVZV0Z614Tnag/qnmjXGeA/PMjq aMjzyioepjooMlY7/WzCsK/3zY9pYcxh32yYWAkVmj2V77/zD/IaoN/EyxI4b0lwUf8AYy4D8ioa 55WxD+C1hC5f9B/Rzd/zn1bMn1Na/wDDk+5IicvB6JrGPfc/8M6t75egbXuer1e56vV7nq9QaYh3 P08GLWygMaRuY/sj6+O1qkbl7/e/9fjz1FND3h3/ACTxwgo4oHs5/wC9/wCvs4ep2UT084f9kcOH dleFA31UxL/nE/Xy6dlFFE3zniX+/wCwbCeHFAajwZNxH+XYERwoKQaG+RUG2I9SP9+A56t08f1k +n7ubr1f/9TeF/5yH6+zg2qLqyc9XqdMP7j6eNO7K2KAH1DdJv8AOTkM4SP+Sx3BHNoXM9FFJFVF dO8yYt0lzb/KcU/3y+w8PqJqtFxHDcp9fumn8pxQf8l7DfDmtlbqgv8AmWK9AerWM9J80f8AOB/5 ho8FwM0Bqun9PPVkYnQYPhHCV1oLTBocZCcaPF/Mf5jQezgQCQDRxWXlq9TBmDDv5jQ/RwwYVBit miC+rzpwOpHRfOOE/wDOZwH/AI1PBDkZoE53VEnSrO38trxhOKf84Hg3qMaup9M3Uj+ZUGDfT4fT wizzZQyyKrLf+SjQ+PATglVSjSO47WqZv+SbX/RzdFFD3h/+/GhufHgdcXpVNHIFNnH61TFiPY89 Xq48Oq1Xuer1NGI4b/oHx5oKk16usPxEYbXcq62FJg1sGljmPLeE50oDhWKC478ITKPKt7aqI9Q3 pfxbLldjOL5X/wCSN34NGXQtIIoFZ5kUUWrLp/0D/fp/zgfHh3RHQmZczJ/0y/8Aks89XqPz0q6t YT1awH/N5nz/AJLXI1zvI6mncffitdn8bnoli3TfAcm4T/zhsfxL/jM5i5j7/I/5fmVZoZHvx/MM srYm9AGW/wDNv6aOjeU/+mFlrAOTIRWMmef8tKrEaDEAw+nw4243NXBp74W1qvc9Xq9z1eoNMQ7n 6eDFrZQGNI3Mf2R9fHa1TPkzDe/h4c0TFFNDBXsMPoCR4cIaOSmKAfER/Mq/g5AiiWlh/wAiP18b /irdAHnP/fjj37eOCiiib5j/AOY8wb9fAcN6A1H6/wCeU4U0OKLT/wAj/wBfNV6nbm69X//V3bcR /wB7/wBfhwbVF1PH/OP/AF9vPV6nvjdbr3PV6q5/WT0UJH+cLLGE9v8AmJeGlo/rTjtooz4Y0G/p m6s/y2+E8VEUUUjPxIPTf/na6af518h/8xlkPnpxiqZ5tqtP0Z+pD/nE4n/vmxnAfu4L6BGR1sTd KuowxPD9fp4DHGgoY0OgaH7/AJKXCjZRvSO/mQ9n8OHdapF5yw3+ZUA05uibPNtarnqY6b/5k/UR jP8A0xsd/wCNTwXVC+eUeL0q9SP5bXk+PN55so5yKr2+nmYxidBwFOokVKQNexD/AH21/HQZo2pm zF483RRSxyXiWvt8fz5XPNtHBpZ1/CavVk56vUwcOq1Xuer1dcJa3TXiPY/Rw6rVK/L2I3Hf6eEL iNQqwNexHDsKxKgt+fNjVNaogvWX034V8/8A1syx38RwZIz0kY7aBed5HRH8Ry3i2SK/+U4phF+W ojp5w7EcWw3EP5thf/JZwHhvXqOPiOSek/rq6D/5p+qH58hrPMjrIPcffejj5MyT/VugwXKf/TB5 Wj2hMw7uPp56imhFo/sNwqTRyis3K1SsVX9kfXyyquug5xDufp4L2tlAM0GmYu31ft47RRSyybh1 qD6fHjD7ukUcAV7MGIWGn0Dl20aRRQTSQw7sPo4fVWnfMP8AvtoOEgNbotOHf78q/GcW4eUT0WfM WG/8a3BvDhxRLRycN/5IJ/Xx4T0dUWv+ZfyzNv8ARzVeoSN3/Y25aiWv/9bdtxH/AHv/AF+HBtUX U8UH9PPV6nvjdbrhh/cfTzTuyvCmXMGHDE8PxfC8SNwwuCOeQQQCNlbIiqcc55J/zS9Wv5T3wY8P wZFBCj9dOsRwrMmUv5TinPV6tY71udJsV9Jfql/rZhX++bJufP8AjU3HDcEGgNVrnpm6tfzLAcGx bC8V5uj6rSMu5k/mVAeE9DGnjMX+8H++vv8AHnhRTQMZd6kYTiX++r7uHNElVq/iZdJf6ydNR1Bw s/7+cB0/Pmsjohzyqh+jPVoZbr8Fxb+PBtQMrZx9O2dv5lgWDafE8BOe1J2SUbHEP9+NBpwmAihp TR/yIfXzdepkw7/fbX89RTQlf8lGh8eNYJVRvXXHa1Xuer1e56vV7nq9XLEPsnjbWytmusPH8urj yrqdaK8KWvCevVixHDhiNAcLOn08aCgDqq0UWvqH0mwnO2A2xQ8EQUJiiT+Q1Vx1EyT/AJpa/wD3 6/8AJG4dUTUtOjPUYZJx44rhmK3B7342tAUIOw1TI/8AhdVu+TcyYTnfAf5thfbgNJg1N1PvCOt0 iDnXCf8AfziuKYt/zk/6q24UULcioYcn5zwjMtCGwxawgd963I56vUsav7I+vllUVroOcQ7n6eC9 rZQDNIvjtFFCVQKMPoAD4cIKOQqKDfMX+936+3h6nZRNXeHdhy1epGdQ8S/ltBw2a2V40DmXf+SD /wB77jlE9BliOG/7/u9+HNEtGZwz/eE/SeE9HVE16h/77ce/Zw3ohzylX/Mjs7f7jf8A6Oc3Tlf/ 194TEf8Ae/8AX4cGiNlRfXdB/Ty1ap743W6aOOVqnfjdbomfq76cf1jyoM14X/yWcB/p4eZErxRR RntFr9O+dv5biH8p4c0UUGX4snRM9WfTxjObML/5LOQv+NSOVQmBHRRDntVdfhm9R/6yYDjOU8U7 YDidzxyr1sH5M/32UHK0d0JX8yPs/jwprVVddZcyf5petOC/9MbPnjw3oD55Rx8Qw3CerXSXGcp4 p/znsM1PN0fVqJdVcNxbpvj2csp/9MHEuDWourYl9EfUj+Y5Dybi3f8A323/AD4RZ5soZZFVyWXc S/mVBceHAYocalGmf/km13LVqvYl2H6+HN0UUr8vf7wD9fHiV/aKORT/AMLq1TFiH2Tw2a2V40y8 crVe56vU8c9XqZ+er1LLDsS+H18I1Jmt0+crXqReIf73D6+HLH2ivGgC6h9N8JzJ/vpxT5EccSqR NFFED6h9E8WyTj382/5LXDmiDPKH7079Wv6t14wnFNMG8eE2eZHR3uPnlWJ0H9PAPUq0jMR6cD+Y HFsLxf8Akt+UGTpJwo3ih7y/hv8ALaELfvrwsFbFPnNVWg0zB3HBZa/bQHVTPh2G/H6uKFKitU74 h/vCeNo+4140G/8AyP8A18EFE9LH/nH/AK+3hLW6LV1VxIfIezh1Wqd8N/5Jx5uiikd/Lf8AT/28 Nq3Ql4Z+9wprVFO9RP8AvtxAfHhvkVEWd0Cf9Zf0H/frv/5Ec1RJX//Q3bP5l/p/58G1RdSxw/uP p407srYp4/l3x/jwlrcUz4h3P08OmtlaNNfHa1WLEcN/mVD/ACr7uVwGNFNVE5zy5/mm6s4zhQ1w Y68O0qBE0UUcj+W4T1I6aYzlPFP+c9hnjzderVB9M3/NgvWl1L6T4p/00+HNElbRnSrEj8h25Wju hLxHDfqPCmtVWj+Ijhv8t6a4Nmz/AKYOJduG+RURZ3Rl+hGI/wDGSwfx8R9/PZ5RHkda4H4qn8py 36h/5ThX/Oe/41PDaimrEvRHiX8t6Z5N5ujbI6vd6d4l/oGDePw4ECJFDqllmLDfjzQM0bV7m69T xl3t9X7eUc2VsUJf8vPs4R96K3FM/wDLf9Xjk1qkZw7rVe56vV7nq9Txz1erlh/2Rxt3ZWxTzQcK a9TvX4eCLg8YadmtkUG2YMubu3jw8ZeCxWiKBvMWW/5lQfynFOO0T0RzOeW8WyTX/wA2wvXhzRLR +ug/Uf8ArJgX8q/m2tj24Cc7SNtSTkdD9/zj/wBfbwjoR0r8v14dSp8fy5VSZFbSYNLXhVRrQaZg 7jgstftoDqrrD/8AeEccX9wrQpnx/sv18u3sooNM+H/ZHDl3ZXhXsRxL+XUHfhTXqKjmL/flm3BR /Hh1WqEnDe5/Xx5uiinrLuG/zKvvf6eVUqBNbpZDDf5b255Kga9RHfVThv8AviGLctVM820Tn+ZD 2fw4bUCa/9HchzFiX8sr+30clCoXpY5ezED38eNPMhYrYNDDQV4cWOnAXRylUVk56tUy/wDJO+jh 1gsVqmvjtFFEx9XOSf5ll/8ArZhf/JZwHThqwTpFez3bQbdCM7fzLh5RRVHf4kOSf8yfrw6N9bsL /wCSNnzm6JKur6M4n/oFrfXzVHdGvw7/AH5UHCmtVXX+JFknFsydCBhWF/8ATSy/w3yKiLO6H3p3 hpyTkLBf+9Zw3ojyOtUT1M52/wBpD1h4z/K/9/WDfzL+q2nNVurqOlWG/wBSaHBsJ/hz1eq17o1i X+gYOPz4TkSKG+Q0Zj/kQ+vhTRxTPhvY/r4c9XqeMP8A+Sh9XKr2VuhJw/uOETuytiufN1qkXiPY 8cr1M/8ALR7f4cOq1XHnq9Txz1er3PV6nrDsS+H18I1Jmt0+crXq9z1epEY/l0N28eGltchYoqUm KLV1Ey3/ADKg+Hw4I6IqLVkzEsW6b58/7E3t5UijjI88q0XDsS/rHgIxW1uAgQkwKlOnjLv+9/1f s4SnZW6EzhTRtQN4j/vf+vw4NEbKA1PX/Ij9XKfx16kbiPY8drVPNBz1FNBpnPEf9A56vUWrLv8A vyx7GcW9nfh1WqGLDe5/Xx5uiihLy72+r9vG3NlHAp6xHDfz8OFFeom/qZw3/jJYzbh1RRVXX8z/ AOxSeG9Aav/S3Us5YbevvwaJMiahig1/5JvDytUMmXcRB8fp4SETW6WP8wPtPG+6FG817/koc9gg V6vfy8+w893or0Ujcw4aMyYDjOE4p+XLiiiqu8mf8YnPmM5T/wCmDiXjwZ0UUWn8YfJP9dvTTg3U LC8J/nOM9JcS/rRworVDD6ZcyfzLKWTcW/6b2G8OaJaPJh2Jfy2g/jytHdFP67dbMJzJQf1Twv8A 39ezm6IM8otXq76/f5k/TTjP8r/5jLHsN/qtlrhtRLVUPoi6J/6B/nCzRhH+/nHvAc9XqtEw3uf1 8eer1Hh6EYl7D9Y4U0dZHR+8OxH/AED48JimTQ1poxL/AJKI5uvVx56vUJWXsRuO/wBPCFxGoVYG nznqNqZK/jlFFMnDqtV7nq9Xuer1e56vV7nq9T3QcJa3T3xuvVw/5KHNYIFboNM45dDC4Oh14eZG sTRQRFFO6iZJ/rJQfyn/AJzP/PM8O6I6e/Tv1I/lv/GTxQd/bwlzwY0Mcjzyjw4d3H08BFDuhFoP 95V+vhWnZR0nZQdV/wDvbwWsfaKARrv/AJEfq5v+OvUiuO1qnz/nH/r7eeopoAuomJf6B/Dh1WqD Xp3hv+gfzbnq9Qk4b3P6+PN0UUMmX8Ot4cS3LulNHKRT1X8Lq1ROPUV/yQMZ+jh0KKKq44c0SV// 095rMNACtx4/lwYZS5pqMSnGgHxH/fbX8EFEtPGXcS+HNETXqE/hNRvWP/km81topr38y/1ueivV k5uvVX/6hsuf1b6l4Li2Gd8e04btL1JmiXPdtNHWbJOEdbPTx1K6e4p/znsM5erUTX0zf8ZvIeTc JxTvgOGXvw5olpZ+pjO2bMN6S4z/AFX/AOS17eapvPKBz0zdN8Wy3Q4zmzPmLfXw2oloAeu/TfFv Uh1L/m2K/wDOtMB1y1z1eoZcuZbwnDaAYThf++X6eeoopZYZ+9z1G9D10ZxE/P8AfhVR9Vl+TMRv QcJFJmhlT3iPY/Ry1apmw3sf18Oer1O+XsRvp7OUcRqFbFDJwE0cU0cO61TJX8coopk4dVqvc9Xq 64S1uu+HVarlh/2Rxt3ZWxT7wpr1On8wPt413Qrc17EO555rZXjQN5yy4D/v19nDptwKwonIoteY sN/luPYNmzC9eO1qjjdPMx/1kwIH2cD7ggzUoihKy92P6+HCReyrCmev/wB7eHbH2ig2a9iHc/Tz bWyvGmvjtapixHEhhv8ARz1FNE36q4l+fhw6rVLLLoGG4D9HPUUUJWGf73H6+br1CVzVG9M+YMx2 +rjTLIQK2TRUuquJfzKgxnjtE9V1fyz4/r9/DiiH+eV//9Te0xDvw3qMDQO5i7fV+3h/RPTThv8A yUTw6rVCTQf08JaN69iOG/H6uVSqa3TN/Lh7OWoorjw6rVFq9Q+G/wAyyGP+xD4c9FE2ebaR3SvE v5lQe3w14b1eizYbkn+W1+M4Tb/kg4ly1ElcuomW/wCZfybCfq5qm88p6OSf5l/zb3C/+SN/z0vN US0ss59JcJwzAf5ThfPV6ib4jh38tr+G9er2Gfvc9XqEjp3/AMl0fr48KqPqtIyZiX+gflfhNR3S x56jamj+WD2n7+er1d4b2P6+HPV6hdwKu3ptPA7cIkU4hUGnziejakfX8MKJqZOHVapn56vV3/Mf 9Pt+fNRhXqW3Cajek/z1FNKDnq9TF/MF9vDbuhXppmOYxh3NraCtteBrwxH+Y/28slIFapF506cZ qxGhxgYXherfZBPfhJ/Oq9/IjTN0ZxL/AJxGKezmzRxkVGv/AOSb9HCGhHTR/wAj31cOv4KDldYh 3P0881srxpr47WqDHMWJcOQIooop+c/9+WbcGwnvzdeoSsO/3g/X483RRS0y74c9XqWOI4l/dzVG 9I3MWJc3RRQB5z/35f0c1Xqr0/lOLefb/sZ7P/Ie/DegPX//1d7OvoA4uNOG9RipMUkMQy6Dpw7Q 6FVUig1zDh38u+vh4hYUJFFFPOXcS8PAfnwnr1LL+Zf63NRRvWTm61TFiH2Tw2a2UUmgb6iYb/Ms pYzhP/Yt8OOUT0Wfox2H08OaJae/5b/xvM5aW8eVo7rhmHDf5bQYxi2KctRJS06VZb/ltB7eapvI 6EnMOW/5lQc9TlVrdRMt/wAtx72cNqIaDTDP3uer1CTl3/e/9fbwqo+qxXp3/wAk8fr4cJ6OqGPm qN654j2P0c9XqZOer1LDL+I38eJrlvUmrA0tuFVG1e56vUx4jhvx+rlkqmiikbw8rVcv+R/6+er1 OvCWjeu+HVFFP/CWt1j/AJb/AKvNTXqZf6uDhl+aTW9NcMnjC8PxvCkXR2VlUnwJvwrzvZRvkJpZ ZNoMUAxn+aNW3/mJZdx7ga3+jgMqT6BrMGGNlvqQuK4bhQOE46AGZe17cGWTpkRUZf8ANyowP/Ih 9XCShBSO/wCch+vs4f0G6yc9XqYsR7Hnq9QaZi/320HDqiiib64lm36eer1DJ/M/9A/X7uboopZ4 diX8t789Xq6/mX8yt+zmqN6ZsR7n6eboooM8xdv19vNV6iif1XxX5q382rv+S15X/kFfhzRLX//W 3tMQ78N6jA1z56vUjMw4b/Mh+XDtvZWjQbf8k2u4fUT0scOxL4aHx4S0b1w56imu+HVapIZi/wB4 T+vs56vURvp3/wAl7GP+9mP4cOaB1DNiP++3Nv8A37OVo7rj1Ew3+ZYDg2EfVy1EleyZmT+Wf76L annq9RmMOP8AMaC3CUmKO6I712yT24cTRBnlEf8A5Z/rcN6JaWOXf97/AK/28KqPqP30qxL/AEDQ cJqOqMxh3YfRz1G9OvPV6mjEcO+sc0lU16mfDv8Afb/RzdeoScOxL4fXwjUma3T5ytG9cMQ7n6ea a2V40jsRw38/DjtFFMvDqtU9Yf8AZHG3dlbFcOFNer3PV6lBz1ep343Xqx4h/K7Dda/hb6OUb18a 2YrxxLFcOoNbEj6OEqcmSdho4/ntI7OWHhsPDDUYH7w4fIIInponIihJw7/khDhDxoc0D2HYl/v+ 7cEFBunnEex5uimmTnq9Qb5zxL/QLfnw6rVFQy7hv+n4zbnq9Qj83RRS1w7uPp56vU+c1RvTPz1e pEZj+yPr5uiii3/1c9//AKH/APUPmq9X/9fe0xDvw3qMDXPnq9TL/Lz7Dw670VqKDXMOW7/XxwGa KK6y72+r9vDhzZXhT1/yTeFFerhz1epIZixL/QOHUVqiB9O8S/mWbc5eP+/PhzQOoy2I4Z/Mq/X8 uer1PJy3/WSg5qa9Ra8O/m2G498eG1ENH5yb/vCOAx7ZQ5FI7qplz+ZYfyza5FeNVcZ0y3/La/4c PKJKZ8u/73/X+3nq9R++lP8AvBwmo6ozGHdh9HPUb0689Xq9z1epqxHsfo56vVxw7EfrHNKTNeoS sP7j6eELuyjgVz5uvV7nq9SLxHDfz8OOUUVx4dVquuEtbrnh3Yc9XqWnG69Xuer1e56vVwxDueaa 2Vs0z4j/AL8qDlwmK1Txkv8A5Jx4SZ5soZ5LtoM8x/77cQB4d5JRJneynnh5RNXuer1AN1D/AN4P 19nPV6gayZhv+gflz1eoS8Ow367+HPV6hKw7Df8AQO3wtz1epo56vUyYj3P089XqDXEcN/Pw56vU G/73/Q7/AJk56iiv/9DfM/l/x4ad4KCek17+X/Hnu8Fe0msPyq8vRD3JpK4hhwPwt4cOGndVNEUG v8txbDf7OPUT09fy3/QP283Xq6+QxX/pljhn+Zb/AKVeg0jsw4divyHt9vHgoHZWqrq6D4bi2JZ8 6l+H+/Ox4dUDqWnWbr9/mlz5g2U/ZhnhzVEOeZ5RrMu51wnEsifzfwtY8bKDrB4Uf0VPDv8Afjj3 82/hy9EFHIyZ/vAfr4U0OKErEAMRoThVuJ0tgKKqOJojvXbJVwCMJ0PD1KgRIoE55RUMu4b/AKf7 eXpyj+dO8N/0D6e3Cajqh+/lo9v8Oeo3rjh381vzSo416nrDsN+q3hwmrdexHDfz8Oer1MvDqtUs sOxL4fXwjUma3Sww/vwio4Fc+er1MuIdz9PDprZWjSOxHDfz8OO0UV7D/sjhs7srwp4w7Dfj9XCd Sor1PX/Ij9XKfx0b1y5uvV7nqKKaOOV6sf8AMv8AW5qK9Tpk6vDHFvHad3GM7Rs6qOshVFBv1E/5 KA+gfx49klVzvZT3h3+8I5aievYh9k8NmtleNFp6rf7wccrVM+Hf77b+HPV6ljh3cfTz1epZ4Z+9 z1epn56vVxxLuP18eer1BriOG/H6uer1JH+Wnf2/3f8A6h89Xq//0d/jnq9Xuer1e56vV7nq9Xue r1e56vV7nq9Xuer1JPL5yy0Z/q2lDGPH5Axsf+TLc9XqRWaF6SHFIzm2TAVx7aPKXNApPM2+F/Ov y5ONBlTdtP3CfI0sNuW/5b9qj+Qt/q+V/wAq83IjZXu7to+4e+sV8n/4aD/kKP8Ao5TCjLRbdNPX l0n/ABf/AMmt/RzVGlTOer1J7HDlkRD+sKUTr4fzAxj/AKSA8urrouKLecTSN2dFf+Lssf8AIOHf 089Ioq7u2/pD2GldSHKFv9EWhP0GMfxB5oRRmEW3TTrtwL/Gv/J39HK0Z1k8uk/4v/5Nb+jnq9Xv LpP+L/8Ak1v6Oer1dbKX/i0/c3PRRVotv6VcNuBf41/5O/o56jWsG7L3+CL/AJN/p5vCizu7b+l8 ad+aozr3PV6vc9XqaN2Xv8EX/Jv9PN4UWd3bf0vjXD/fD/x1/wAmf08tKeiivu7X+l8akWwX2r+f KwKMtFv0162C+1fz56BXtFv01H/3w/8AHX/Jn9PLSnoot7u1/pfGur5e/wAEX389hTOjJv6Q99Rv +Mp7Kf8APi7Xc9B91V05N0j317/jKeyn/Pntdz0H3V7Tk3SPfXDBVyoEP8jeFh4+SG/5m4hSRSlL dt/S+NexpcqFR/O3hUeHnBv+ZeeURXlN239L41z/AOMp7Kf8+Ltdz0H3Um05N0j317/jKeyn/Pnt dz0H3V7Tk3SPfQU5gg6Et/yXK2lT/iaz/wDMqHhmHLz+jz7af7q1/pfH8K4eV0M/5Sab/o7/AM0c tru+jn20Rdzu9/T+P4U6eV0k/wCUmD7pP+aOb13XRz7aN+7yX+l8fwr3ldJP+UmD7pP+aOe13XRz 7a93eS/0vj+Fe8rpJ/ykwfdJ/wA0c9ruujn217u8l/pfH8Kh+R0Z/wCU2D/kGf8A5o57vLr+jz7a 9oyXp+P4U1/JdH/+mwP+idR/1L5fvLj+j76Ke53d/p/H8KRv8q9O/wD2E1T/ANEa3/qRyve3X9H3 0o/LZd/xz3H8K//Z ------=_NextPart_01C8E823.DA10E9A0 Content-Location: file:///C:/8E69C634/Classof2004_files/slide0110_image011.jpg Content-Transfer-Encoding: base64 Content-Type: image/jpeg /9j/4AAQSkZJRgABAQEANQA1AAD/2wBDAAoHBwgHBgoICAgLCgoLDhgQDg0NDh0VFhEYIx8lJCIf IiEmKzcvJik0KSEiMEExNDk7Pj4+JS5ESUM8SDc9Pjv/2wBDAQoLCw4NDhwQEBw7KCIoOzs7Ozs7 Ozs7Ozs7Ozs7Ozs7Ozs7Ozs7Ozs7Ozs7Ozs7Ozs7Ozs7Ozs7Ozs7Ozs7Ozv/wAARCADnAI0DASIA AhEBAxEB/8QAHwAAAQUBAQEBAQEAAAAAAAAAAAECAwQFBgcICQoL/8QAtRAAAgEDAwIEAwUFBAQA AAF9AQIDAAQRBRIhMUEGE1FhByJxFDKBkaEII0KxwRVS0fAkM2JyggkKFhcYGRolJicoKSo0NTY3 ODk6Q0RFRkdISUpTVFVWV1hZWmNkZWZnaGlqc3R1dnd4eXqDhIWGh4iJipKTlJWWl5iZmqKjpKWm p6ipqrKztLW2t7i5usLDxMXGx8jJytLT1NXW19jZ2uHi4+Tl5ufo6erx8vP09fb3+Pn6/8QAHwEA AwEBAQEBAQEBAQAAAAAAAAECAwQFBgcICQoL/8QAtREAAgECBAQDBAcFBAQAAQJ3AAECAxEEBSEx BhJBUQdhcRMiMoEIFEKRobHBCSMzUvAVYnLRChYkNOEl8RcYGRomJygpKjU2Nzg5OkNERUZHSElK U1RVVldYWVpjZGVmZ2hpanN0dXZ3eHl6goOEhYaHiImKkpOUlZaXmJmaoqOkpaanqKmqsrO0tba3 uLm6wsPExcbHyMnK0tPU1dbX2Nna4uPk5ebn6Onq8vP09fb3+Pn6/9oADAMBAAIRAxEAPwDAkm2s eT1qvLdH+FjUM0pLt9TVcvzya6oruS2WRO56sfzqRZieMn86pB6njOTVNiSLQlfs5/Op1uHA/wBa 34Maph8UufepLLwvJR0lk/77NBv5gM/aJR/wM1nmQ1GXY1pGJm5Ft9SvC3F3OPpIf8aQalfDpe3H /f1v8ahC4XLcZ6UbOavQjUtDU9QwP9Puh/22b/GpF1fUu2oXWP8Ars3+NUwuakRKWgWZcGr6pu41 G6/7/N/jVhNZ1QD/AJCV3/3+b/GqG3HNOJ444qboqzLja5qynI1S7/7/ADf401vEOsAcapef9/m/ xrOcgnrSYzTsgL//AAkeuf8AQWvB/wBtm/xrL1nXNVuBD52o3Mm3djdKTjpUhjINZ2qKR5X4/wBK ynaxSJpJAGYbRncece9V3YZqWcYdjnuf51DnPWmnoDQ4emalRsAVCB2zUqKSaTQ0yUN70pz0pAPQ VIiEjJqVuUIF461o6To02oSjZGSM8kjir+geG59Yn3N8kK/ff0Hp9a7HUYbTSNONlZnyfly7A8ge 5/pUVK3Loi4Ur6s4XWYYNNHlsyNJ7Nk1S0iKPUr1bcyKhY/KWOAT6VX1i6gSRtrL/vHv+FYX22eS 5jEBIYNlW6VEakipRjc6jVYRpl3JbuwMiNhgOn0qK3uopMc4PvWLrurT3k+5l2sAAzHue9Zcd66k Zc8e1UpyIaidox4NQsTWRZazwElO5R1I6itdWSVQ6MGVu4rWM0yHEjXJJqRaesQ9eKd5YHeruTYa SB35rN1Yg+Vx/e/pV6ZgvvWVqbZ8r8f6USWgX1Lk0QLH1yagEfqKuuuST7moiuDUobIliIqZIzxx UiDcRmpgg6g9KbYJEYj45Fa2laUk3+kXjbLaP7xB5b2HrVSBMnewAUetJeay0jbYztSP5VA7muap PojaEerOuTxFBaReVAohiiGcJ/D6fVj69q5HXPEdzqLmJX8uEnO0HqPU1k3d48S+WpHqSfWqttE1 3Oq+pySTk1gl1Zq29kS2mlS6recAspPLsc5rp7PwnZ2xWSQtI46DOBWjouliGBdq7jjrW9FYM3O0 Z6cVzzqt6I7KdKKV2cffeCobqTzQ+xjzwa5zU/CE1iCSCU6hl5r1oWEnA4602SxDgq6A9uRRGrNb hOjCR4YtvNbS5Az6Vo2108JDopVSfnXt9a63xF4Y+zF7uxiyBzJCB+q1x0skDJIF4JHSuuE+bVHD Om4aM24byOSMOCCDTnuRtOK5vT7wxt5R+6T+VaysCCc12ws0c0m0SGQseao6l/yz/H+lWwc1U1L/ AJZfj/SqnsRE127/AFqMjmhiefrTWfJ5OalbFjlzU6DcRk4FQIcVYgVT8zkYHYdahspIZqVylva7 EYmRh6foKxRKULbScR8bj1LHqaXUbxZbgt0AJIA71SMoVFAPJGa5Xrqb3S0FLGSUsSSx6e9dR4Ws fOlDsvA5JNcvCm6RSG7V3nhkiC1Bxy3IzWNV2RtRV5HWW0ZQKFIA9hWnE6BcFufrWNFKAVMsyJn3 zWtAkcqho3Vx6g1zJM7dC4hTGdx/A0vmquc5J96i8hjjB605rYAcuPzp6kuxRuk80nI/SvKPHGip YX4u7ZSsUx+cAfdb/wCvXqtwRFNtEkbEjoWxXKeKbQXdpNG68sp4PYjpVQk4yIqxUonkxO1gw4Oa 6CzkM1skhJwRg/WufdSDj0OK1dEkyJIm7civTpvU8qSRqqOeaq6jjEX4/wBKvKhxmqOpKB5f4/0r WV7EIvuSSeKbkDmnyZweOKhbP0qblJDg5BqWeZo7KRyuCRgGmRAqwz1qtq90TEkS8DPOKznLSxcV rcwZXMkp4OM4qNnYyEjtT1by2YDnimxkgngH61JLNLTYXup44x1YhRx2r0fS7O1sIVe8kB29mOAB XI+D4AlyJ3XnHyiu7fTIb2RZZk3qTnZ2Brjqy1sehRi+W5KPEfhsSC3knCuegEZqwktuAZ7KVGX+ JR8rD8Kgk8L6Vc3K3csUvmpyMNxTbq3itxNKFZS49cAe+Kzk49DWKl1N22uGlhD5yMVWupVEbPcz rHEOoz1rJ0u+le3bB4zgfSrpjS62sV3MhznPT8KhM0a7FNfEvhzzTb7yXBwcwnGfrTL2KG8tmmtJ dyfmKvW/h7R0uGujaZmbq5OadPZw20TLAgjjb+FRgVTcehmlJ7nies2otdTmjUfLvJWl0cfvy3Ts a1fFcAXUOBlu9Zem5jEjY5Ug/hXdCVkmedOHvNHRL0rP1TGY/wAf6VZjkLdOhqpqQP7v8f6V2PWN 0c2zszRflRUJAzzn8Kt/wj6VXlXHOfwpdCxVfALhcewGayb073ZiD8ozmtXP7sgKw/HAFYt6+FIB +8cfhWEtZGi0RnucAgc56nFMQFmwM1IU3Zx3qSBQsqg9T1qXoJI63SsxtGE4AGK9C0ja0akjJxXn 2mjkexrvNJuFSED2rhqHp0tjadMISO9YmsYFuWmccDhB1NXrjUOPKiIBxyT2rlbproTO0qM+49zW aV2bPRGjo6M9sxHfnFals0LMAX2OOM9qy9F1J4S0ccBkbPQDJFWxb3MkzmZFjjJzjPNJqw07m7FC WAPGf51DqX+rwBxj8qzLa9ksLhbaSQvE3+rY9vap7+7XyGO7r3oFY858bW0SrBcA/O7spA7+hrnd LwZmQj7y4rs/FK20mkiGXIuCDKhxwB6Z9a4qyISZSp7812U37pwVF7xpRkwnac4BqHUWY+Uccc/0 p1yzRHd1qldT7ki28jBwT+FdUJ2jY5Zx1udGR+7B74qtIdpyecVI0n7pR7VFjd16VbegkRT3BELd BnjHc1hzKZZtqfQc1e1Gba+MfdFVtOj3F5iDtXj6msb7sveyFjhCA99oqoZxEWBTLDofStKQ4iY4 7Z/wrGbcGbdyaSdxy02O00d/MiDj+IA12OlBpYBtPOK4Pwzc/wCjhTn5TjHtXd6e32K8jXrFNh4y f1FcdVWdjtou6TIb2+FldfZijM+M/KMlvep7G8klRStlK/X+HNT6/AHkVhlePldfvLWRpia3Z3Bx qEbRbt4bYcHjHIqEk0bvmvodNbXU0ZQx6ZIu/wCZQq4zTLm7v5FL/wBnOVPPBFSWt5fIyB7+2ZVG OIWz/Os/UU1G5Ah+3yxx8ZMcYQkegosF5dhtpcpq0csflSxmNsHeuMMKj1Jmhtijk7gMn2wK2dPh jt7QJ90Lycn9TXOeI7kQ6Rc3Jb55shB6DpSSvKyFN2icL4i8U3muR26TxxRi3Xy18sfeXPesm3cK xI7YPNQuwAYEULx2znFd6SWh5nM9y/cXIk/LFZszngBuOcc1IzffX0PrVeQdKpIiTudbjKL9KaZC gbPbrUiISq4JGR1PAqreO0UTE5I74qpS0GkZV27XE+1erGrp2w2qIgIjX82NV7GJp5mlIwo7VPdS DzNq4JHbsKyfYtdyvcuVjEZ5d+TzVGdNrhc/eUGpnZnnJxnnFT2mlXGo3YijQheAWNUlYiTuJosr W+oRAcrINrDNej2cv2jTzbMwEkJ3wt/SuZvNDj002e3kq3J/Cti0ztHNYVVqdNBvlubM18bmKF+4 XDD3q9pojhcrLyh5GDXPspU7kJ5OSK07O6SULGzBSPWuZprU7ITT0ZvQCJ5wpZhk9VNF4EMpCsSF 4560lo9tGOSpHr3qpqF7BE7MrgZ6AUrXNLq4k1ziN4843dT7V574u1kXkpiiIMEXAx3NdTcXDPHL K3AwcA15tqDuFZWRs564rpowV7s4cRN2sjNdgefWnbugJ4qPG7FLtPTFdSRxDgRvOeaZJnA4p4C5 Pp70yXAIw2adtCTu7KGTCskDv8oxjnmm3Wk3t7Ixa3ZFHomBWp4Ys9evIFlsIlMC4y8rYXP1Na86 +KLlWtnjjKE/8sQOfxrnfPe503ha1zjLm0isINg2+Z2GelY727kHapZj3zXbDwXrc9wS9kSW/jaQ Gug0P4cMkyzaiyjbz5anNXGLM5TRxPhTwo+o6hCs0TeWxJJxxkdq9Wt/BllbW4McYWQDjHateHTr WwuLdbeNUQA7QO3FaIwTWyVjncrnlPjHR5bWDzQpIjYNWTacxg9q9i1LSoNStXhlX7wxmvMjoM9j dS2TjmJtoPqOx/Kuauup24WW8SoDngU9YQ54HNalvoRZslhVltMEP3B8w/WuZSOtxMqOwvpB8sjI v1qZdP8AJXMmSe5Y5rTjMicbahuwxAz37UXDlMq7jUwlW+63Bq7p/hew8ReHfLmjCzwsyCUDnrxm q1+hVNo9K2/AtyitfWbMAyyBhn3Fa0H7xhiY+5dHkXiPwteeHtQ+zzJmMk+XIvRhWS0JxnFfQniP Q7XW4UgnO3a25WA6EVyGpfDJwVubB1lR/vxsNpB9RXbY89T7nk7RlQeOahkyABtFeqL8LrqciOR1 iz0J5xWFr3w6vNLaHdPE6yFgpGe2P8aHcakmeuadAkmm2kMaiKBIUCxqMDoK047IRLlV49qg0mPF jb/9cl/kK1o1IpmRAgjkA3Y/3lqURMh9R61Hdo0I+0xDp/rFHcVJBOrxqwOUbofSgVytfhkWOcD/ AFTgn/dPWrEcikjBqVkVyUYZVhg+9ZULtAWRj/qmKEk+n/1qa1E9GbI5Fc74ktAs0d4q8EbHP8jW kuuaajiKS+gWU9FLjJqa5jg1KzkhV1kSRSMqc4PasakOaLR0UanLJM5iIqFGae6q3I6iqUMroWjl Xa6HawPWpknG/GeK83Y9q10K67TyDg+1Up03MGAP41cmckcGqjBupNNsFEz71Q0oHvWl4I04PNe3 ZXdBNNsBJ67R/jmsXVJnBMcILTS/u41HdjXb6LpX9l+HI7GWRi3lEFkODk9cf41vh1d3OXFySjYs XdtBFIrLjepyAWyR+FWLUhpZYz65rnrDwtYqYbkef54bcZWkJZvrmunWIRt5ncjBr0bHjXb1GSKA 5PXArlvHSBY9OGP+en/stdY4Gwn1Ncv48Hyad9JP/ZallR3Oi0tQ2nWv/XFP5Cro+Xiuf8M3kjWc VrP99I1x7jAroQw5BOf6U2FxeMc8g1lQt9i1B7R/9U/zR+3tWmfSszWIi9utwv37c5P0poiXcvrI QdjdR0NR3Gn27h5QnztyeeCfpUVrMt3arKv3gMGr0TbkweuKT0GrNHM+ItOs5tJ+1eWsdxbHdGyg Ak+n41r6Lpv2Oy8xjmWYAsAcgfSku7SGQmGZA8bdQa5sy6h4O1EbZGn0u4bChzny29Pam7tWQo2i 7tG/rmifaojc24C3KDJx/GPSuWRju5Ug9wa7qx1O21CMNE/z45QnkVi+IdLMTm+t1+U/61R/OuCt S6nr4Wv9lmE8gGOuKj+Z8n8qki/evgkce1LqS/Z7Fwo/eSYRAO5Nclmz0dhnhbT11TWpNQkXMFqd kX+056/pXdSwDYARxg1V0HSo9K0yC2HBQZc+rHk1pSjj869GnHlSR4tebqNsoFQoiUDAAqxLxFio WGZE+lTT8IB68V0HGQSnEaj1rlvHh+TThz0k/wDZa6iQZkVRXMePlx/Z/P8Az0/9lolsEdy9JbPB Z2Wo245SJPMA+g5rVe8R7eO9i5Q8OKfpoVtLtgRkNAgI/wCAis54xpV4YmGbO44/3T6UIGbMciSI GU5U9KZMgOdw+VhtYViWV22nak1hO2Ub5o2P8S1vHDJjOQR1p2syb3Rg6XMbO+ktHPAbFbm4xniu Z14tZajDc9Fk+Vj6EVvW04ubRJQc8c1cl1Jg7aFqZBJHkdaqXNpDqFlJZ3Kbo5Bg1ZgbIKHtSkYP HSoWmhZxcmm3umApvY+Wf3cycEj3rX0rxA00Yt9QAcH5d+P51tSKH6qCO4PesTU9F8ofabNcr1ZB 2qnZ6MnWOsStqOnfYrnzI8GF+UYfyqvAq3viHS7fGVVmlYf7o4q9aXqSW5tLrJiboe6H1qtpFrJb +OSJB8kdmSrDoct1FcMqHJNdj1qWK56TvujtNikc+uabL93PtUgORkVHL0FbLc45PQqICbj6Cnyk tIB6UQD94zHpTC333/KtVuYFeN99/wDSud8fn/jw/wC2n/stbVsxF3Kf7q1y/ji4dxYlv+mn/stO SFB6naaV/wAgy1/64p/IVLd2y3ds8Ld+h9D2NQaRKp061VuD5KfyFXmHfPFSWcnqVtJeaU5UkXtg SyHuQOo/EVoaFqn27T43J4K9anvUFvfJcAfJL8rj3rF8Px/Yby+08/dhnJT/AHW5H8603Rlsy7ra JqNpPaAfvoxvT8ORVbwjqX2q1eBjyhwRVq5jaPWIpeiCFtzfQj/69c94WfF7c3K/LFNOdg9qroZ/ audwMo4b04NTHOPaoTzhvUVOgDJWbNhmRToz1XNMZSDSjtRuMoajpUcm6SHCSdfY1DpFyFk+zzpt kXhCw5A9K2cB1wazr+yJAkQ4deVNG+jJ+F3RpJMwkCbCQe9Pm6ZqpZXJnhVujqcMPQ1bm6KPWs7W Zu3eJDgJER3JqC5O2IJ3Y1YflwPSqVw++4VeyjNWjJkcUeJ5Gx94YrivGkuBZqTyrSD/ANBrv40B Ut3rzfx2Sl7Cvbc5/wDQap7ErdHoNmmzT7Rh/wA8U/8AQRV4E7c1BYIraVa5H/LBP/QRT0YqShPS oWqLI75BPaOuMEDI+orEaLZqIvE/5bRKrfUZ/wAa33+ZTWXCoZFB6KxWriRIybiC8vbecNIcyZGV 42J6fU1DbRLbKiRjCoAAK6K0VG3xEck81j3UBt7plxxmruZWOggbfbqe+Kngb5sGqentut1q0QQd wqGbImdcc1HkVIrBxUbrg57VKGOGVNKzIVKtTc45p2wMORQBSVfs10HX7rnB9K0SchQajZAYmQ9x xQzfLH7jrS3ZS0VhHO0FqzkbdNIx9cVcmb5CT2FZ0G7H1OapEs0TII4+K838ec3lufXef/Qa79sk c1w3jmPM9o3qH/8AZaHsJbno+mR/8Sq05/5YJ/6CKle2LNkMAaKKxuzpcUxptWII3iqEel3UKqEe JsyEtnPT2ooqlNkunFk8enypctLuQA9hUWoaQ93hkZAw9aKKOdh7KNia10+SCIIWXI9Kn+zNjlhR RS5mP2cRUgdO4xTzFkY4oopczDkRH9nbPUU/ymA7UUU+ZhyIQxOfSmvA7RqBgEHNFFHMw5Ehk9rK 8ZVMZPvUEdhMgHC8e9FFNTYezQ9rOZs8D864rx3Yyo1iSBz5nf8A3aKKHJh7NI//2Y== ------=_NextPart_01C8E823.DA10E9A0 Content-Location: file:///C:/8E69C634/Classof2004_files/slide0111.htm Content-Transfer-Encoding: quoted-printable Content-Type: text/html; charset="windows-1252" CHSAA Hall of Fame
Sally Stewart
(Greeley Central HS)
nA pioneer in t= he northern part of the state who helped get girls’ sports going, Stewart coach= ed 7 sportsday sports inclu= ding basketball, volleyball, field hockey, softball, track, gymnastics and tennis. She coach= ed tennis, track and gymna= stics as varsity sports when = girls’ sports were recog= nized by the CHSAA begin= ning in the 1970s. During her coaching career, Stewart coached gymnastics 20 years with = six conference and/or distr= ict championships and finis= hed ninth at state twice.
------=_NextPart_01C8E823.DA10E9A0 Content-Location: file:///C:/8E69C634/Classof2004_files/slide0111_image012.jpg Content-Transfer-Encoding: base64 Content-Type: image/jpeg /9j/4AAQSkZJRgABAAEAyADIAAD//gAfTEVBRCBUZWNobm9sb2dpZXMgSW5jLiBWMS4wMQD/2wCE ABkREhYSDxkWFBYcGhkeJT8pJSIiJU03Oi0/W1BgXlpQWFZlcZF7ZWuJbVZYfqx/iZaaoqSiYXmy v7CevZGfopwBGhwcJSElSikpSpxoWGicnJycnJycnJycnJycnJycnJycnJycnJycnJycnJycnJyc nJycnJycnJycnJycnJycnP/EAaIAAAEFAQEBAQEBAAAAAAAAAAABAgMEBQYHCAkKCwEAAwEBAQEB AQEBAQAAAAAAAAECAwQFBgcICQoLEAACAQMDAgQDBQUEBAAAAX0BAgMABBEFEiExQQYTUWEHInEU MoGRoQgjQrHBFVLR8CQzYnKCCQoWFxgZGiUmJygpKjQ1Njc4OTpDREVGR0hJSlNUVVZXWFlaY2Rl ZmdoaWpzdHV2d3h5eoOEhYaHiImKkpOUlZaXmJmaoqOkpaanqKmqsrO0tba3uLm6wsPExcbHyMnK 0tPU1dbX2Nna4eLj5OXm5+jp6vHy8/T19vf4+foRAAIBAgQEAwQHBQQEAAECdwABAgMRBAUhMQYS QVEHYXETIjKBCBRCkaGxwQkjM1LwFWJy0QoWJDThJfEXGBkaJicoKSo1Njc4OTpDREVGR0hJSlNU VVZXWFlaY2RlZmdoaWpzdHV2d3h5eoKDhIWGh4iJipKTlJWWl5iZmqKjpKWmp6ipqrKztLW2t7i5 usLDxMXGx8jJytLT1NXW19jZ2uLj5OXm5+jp6vLz9PX29/j5+v/AABEIAjgBzgMBEQACEQEDEQH/ 2gAMAwEAAhEDEQA/AOkoAKAF7UAFABigAxQAUAFABQAUAFABigAxQAYoAKACgAoAWgAoAQ0DF7UC CgYUCEJoGBNAhC4oADIo7igBpmX1oAY11GpwWA/GkMQXcX98fnQFiRZFbowNMBDMoOM5NADt2RkG gBd2OpoANwI4NAChqBCM4GCTQMRZFboRQIcKBi0CCgYvegQtACYxQAUDCgQtACGgAAoGFABQIKBh QIKACgANAAaAExQMSgQUAFACgcUABoAKAEoAKAFoASgBaACgAoAKACgAoAKAFoASgAoAM4NACFqB jGkCjkgUgK8l5Gn8QNFwsyq+pjswouOxWl1Jh0OaVx2K51OUHg/nSHYik1KZz98/hQBF9rkx99qY DftTj+I0WFcet9KONx/KgCRL+QOGLE0AXoNUOc9QevNAWLZ1KMr6E+9MVhI79dy7uhoCxZkuUQA7 hTEUn1FXkxSGWkZGw8Z5HWgCxFKGXIP4UxEiuDQA7NAhc0DFoEIaAEoAKBi0CCgYUCDpQAUAFAB2 oAKACgAoAKBiUAIOKBC0AFABmgAoAKACgAxQAUAAoAWgBKADFABigBaAFoAbQAtACUANaTHSgZXl uEA69BSAz59QA4QZIpXKSKEt4zn5m/CkNFZ5y3SgYmT3pkjDL6GgY0nPU80gEoEKzjYqgDg9e9MB hagA3dTQK4b6LBcUNQMUOT3phceJG4y3SkA/7S3ALE0AIJ8NnvTEWIr9kwR+NAFyO7DcocZ6igZb juiuD1X2oEXY7gP3FMRJvxQBIHBHWgQZzQAtABQAUAFAwoEFAC0ABoASgAoAO1ABQAdqACgBKACg AoAKADvQAtABQAUAJQAtAB2oASgBaACgBKAFFABQAhOKAIpHwuScCgDOub5QpCn8aTZSRmS3LOcA mpuXYqSSHdQIiJJ5pgBbAGPzpAJkmgBDx9aADkcnvQAhamTcaT70xCZoAKAAdaAHUAKOKBhupAJm mAuaBC7qBj0lK9OKALUMzAZBpDLsd4yjBx7GmFi5HqCso7t6CgViX7YAuWVh74phYlS9QnBYCgVi wsgIyCDQA4GgBQaAFoELQAlAAaACgAoGFAgoAKACgAoASgAoAKAAUALQAUALQAmKACgAoAKACgAo AKAAUABoAaTQBFNKkYJY9KBmNeXxkbCmpbKSM9iSeTmpKGSMTwOKEgImAUe9MQxjTEJSGOVSeFH4 0AKwCDnlqQERPOTTQmN3c9KokTp2pgB7UAAHtQAo5pDH4xSuOwhOKEJjaYhM0wDOKBCg0AKDzSGS oxAoGSCTPXpSGSpOU+6cGgC1Hd8Yfn60ATiQSDACsD2pgSQXAQ7TlaAL0c5A55HrQKxYSQMMg8Ux EgPFADh0oAKBBQAUAFABQAYoAKACgYUCEoAKAAUAKKAFoAKACgAoASgAoAKACgAoAMUAL0oAaaAK 9xMIkySKBow7u7MjEA8VDZSRTLbm44pFAxApAQsxqhEbEnmgBPrQIVFLNjFA0Sl1iJCkFvWiwXsV 2ck+9MlsaaAEoEFMAApMCRE3dBmgqxKIgBk9am47Eb4B4OaYmRMcmqRLYc4HNMQnPFAB260DCgQo pAPDkKVBIB6j1oGAPrSGPDUDHq5HQ0gJo5SO9AyysrMOTu470wLNvcZAA4PShCsW4pChyB9RTAux SBlyOR39qCSYEfhTAdQIKAFoAKACgBKBgaBBQAUAJQAvagAoABQAtABQAUAFACGgAoAKACgAoAWg AoAr3E4iUnIoGYN7dGVsZqGy0iizYNIYi+vtQMRzxQIhLelMQUAKFHU8D1oARpP4VyF/nQhNjNpL cA59KYrCldvXGaQxrYpgNoJAUDFXnk0MEWPN+XHRR0ApFDWcuOOFpAQM2D7VViWNz0qiQ7igYoxj k80aIAGaAEzzQAoNIBaAFBxSGOU0MEOUmgdxwbHQ0hkqSHpQBOkpByOKBl6G4zgMfofSmmKxZLsm Gj4PfHINMkuW84kHoe49KALSnimIWgQUALQAlABQAUDCgQUDEoELQAUAFAC0AFABQAUAJQAUAFAB QAUAGaAIZ5vLWgDCvbsyMQDUtlpGexJ68VBQoXI54FAxCVUevtQBC3J680yRMbaAG5zQAMS3UmmI Tp2oAac+uKADpQICp9KYwCY6mgLBtycL+lAChcfWkwQZJ6nNAA7cAfypoGRHmmSHORQAd8UAAFAA KAF70AHNABmmAD8aQWHcikMcD2oAXNIY5Wx3oGTxuD1NIZYjbB4NCAtRSEDg4NUIsBiCHHHvQKxo wzb0B6EdaoksK2RQAtAgoAKACgAoAKACgAoAKADtQAUALQAUABoASgAoAWgAoATvQAUARySbQaAM W+uy2VBqWykjMY5NSWIKQxsj4OKAGnABOaYhhbbQBGSSTmgQhOOKBBmmApHByfwoAbx2oATJJoAM kUxBk5oAcBznOKQxD7CgBcHOaAsMbrzTQhMUBYPSmIPxoGAPQUhAM4pgHekAZIpgJQAucUgHZoGG aQxcmgQuaBjgSKLjJkkx3pDLkThhTTEy1E+BhuR0pgTwv5TjacjtQBpxuGwR0NUQTUCFoASgAoAK ACgANAwoEGKADFAC0AJQAtABQAUAJQAtABQAlADWO1cmgDKvrvOVBwKTZSMiaTLVDKIlzyelIpAx 2rxjNAETt+NMkZmgBh4oAdjC+/pTAYTigQn40CDp1oAM4NADSaewC9uKAFHXoaGMcRhv8aQD1OO1 AxGJJwB+VACiIBhucA/yoERGhAG007isGznNK47CEYxRcLBTQhGznimITsaAFA9TQAmaLBcXNIY4 HmgBcZpbAApgOFIYopFE8T4oGXYZAQKaEyyPmHHrTEXrSUEhexoQmaCnIqiBaACgA7UDCgAoEBFA BQACgBaADNACUALQAUAFABQAmaACgBCcUAUrycKh5/CkNGFNKWb0qWWkVT8zewqRihscYFAxjOc0 xEROaBBTANvGaQWHTx+WAM5OOaYMjVTjJoYrBjFIYh5piG9iMUxBtyBmi4WJCQQAAAB6UihpFK4C j86YChW7A0gEJ2ng800DGqaZI4HpSKJBsBGSD9KAEZk7UhjKYhpBBpiGk+1AhB6jpTEFK4wxRcBe 9AC8g0gFFAxaAFpDHDNADwOMigZPExoAuQykgimhFpTtdSvQimBr27741NNEMlpiDpQAUAFABQAU AGKADFAC0AFACUAFABQAUAFABQAUAQ3EojTOaAMO8mL96lstGa7ZzUlCDhOetIY0NzmmIY/XigBo FAhSPmANMB0jglVWgAlGZCOtIAcgKB7UDIicD+lAhpJpiAL6UALznGM0DBht69aQgyTxQADjpQMX cT7CmwQ1xQhMaMjqOtMVhwfAxjrQMQ/exnP0pMAJwcUIGOHIFAxDzQA0rjrRcVhAMUMQtO4BikAu OaB2Fxx9KEwAUAKaQCimAuMUiiRGwORQA8kjB7GgCRXIIxQBftJFkVV7g00JmrYvjKHseKoll6mS JQMWgQUAHagAoAWgBKACgAoAKACgBRQAUAJQAUANY4FAGVqE/bNJspIxpmJqNy7EGMtz0oARz29K AG5xwKYhvbNIBc8cUADDHXr3oAZznrQBNGuQWPXtRcaGyn9KAIuc5oEIOTTEPzlOwA/WgYzzCDhT jNGwrhQwFCkigBcDGByaBiCkwQjdKdxMQjOKAAD1oAVVyRQFhXHSgbBelIAwce1FwGkdKaEwxTEA FIYuMUrjsGKAFoQCEelO4hQKVwDoaAHA0xjugpAOVzii4Chj1FAyxaybZ1PvTA3oW/fgr04NUQaP amIWgAoELQAlABQAtABQAUAJQAUALQAdKACgBKAA8UAU7u4EaGgaRgXE28kk1m2aJFR3z3oATO1a AI2piFXgZ5oAa3GBSAUHZ2yaABVyeaYCMADxQBYcbEVOMgZNIZAfmYUxDD6UgGnjimIHbJ4GB2FM BoFK4D8YHFIYoHBoGIB17UCFwBQMTGR60IQmOg4oAcF6UASKBwewoGI4G7igY1FycUhDihAKntTA iI5oEKF+X3ouwEAoGP28UuoxCvpTEIOhpXAMADApiChgKeeaAEHHNADgaBjs96BDkbnnoaYDkO1/ xoA3dOk8wDPXFNCZsKflqiRaAFFAgoAKBhQIKAFoASgAoAKAFoAKAEoAM4oAjkk2g5oAwb+5LuR0 ApMpGdI3BqCyHnGTQIaWoASmAmTjApWAAMmgBWxkYoAUEj6UwDGE3H14pAPaXcG5zxgUwGA7VycZ PSgNiPrkmkCGmnYTFAoCwdTgUhjwM0DHhQBQMYBSEGMimABCelABjnjmkAoGRQOxNFHkDtzQOwqR BnOelAyFBiQCmySWVSpB9qQ2V+ppkj41yhHOaBobjBpCHquVNIoULxTEMwBQIaeuaYBjPNFgFA70 rABFNCAUAPxxTAaODSAlAOM00Bs6JgsfpTQnsbijgVRI6gAoAKBBQAZoAKACgAoAWgAoASgAoAKA ENAFS8cLGaBnO3D5YmoZaKznJpDGljQIYxxQAnamISgBQcdKSGKx7CmAgzg5oYgzmlcYp4OKYDWO Tk0XCwDOKQCEcihAHegBQKBkmMCkMkI7Ux2IyMHApCDAGOKYATxtHHrSAAh4Pr0oCw5FOcUFWLB+ RKBkiJthHHzGgLFRl2ygelAizOAyj6UwZRxzSuTYkh+8RjtQNCFPmNAEkK5BoAVFxnNADGUbeKYi MjHFAhPUUAHagA6ihAHtTEL9KAAjn0oAngwRtNAGnoRxJIPQcUxM316VRA4UAFAC0AJQAUDCgQUA FABQAUAFABQAUAIxoAyNTlA4zzSGjEkbINQyyEnpzQMaxpiGGhCEoAOgoAWgYDJPFK4AxwKABM5z 6UwHc43cEmgBHGCBSAnjQBOePemMhblsj1oYhAOaQxwGTxSuMkwMUDHkACgY3AGe/NAhqgeZk9qB CAZf6mgZa8slQW4xwKBi28W+Y46CgYky5kVR0zQBZHOBQMqOv70fjSCw/qpFO4FXb81BNh0a8k0A iQJlz9KAFjXANMQxnHNADVOEPPXtQhMUkH0PHNMRGwwQaQDTmgAB7UAOcYUEduKYhp+7nGPSmA3N TcB8bENxTA2tDT94zc+lNCZvCqJFoAWgQUAFABQMKBBQAUAFABQAtABQAlADH6GgZz2pvmbbmpY0 ZshqSiLODQAwmmITPTnmmIBSbGhRyRSCwNxQA5F4zQMYRQIcuQhoGOjXdQArYEg74oGORjIdo7ZN MQwqAT1oAApIJApDFj6+9AIl2lmx+NBSHOAPvEdKAGAj0xRYVxActxxzQwRPBHhwaktInY5AHYHN MY6EFEL/AN40ARoC0wJpAWQu1M0wKu3L5oAAuBQAzyst+FCQmMB8piCKZI4ttIbgg8UIGMaTDACg COXhqQEfagABO0n0FCZLE3/KV9KdwFzk0ANzQIXcQKaYBnAxTEJSGPT7wzQB0ulRBYQR3qkSzTFM QtAhaBhQIKACgYUCCgAoAKACgAoAKACgCteSGOElfSgZy1zKXmyT3qWNFeQ0hkZNAXG96YhaTGAF DAUdaQxwXJFAEm0rHwOTQBDx60AKeDx0oAVWwKYA5y2R0pMB0LBSfU8U0Aj9/egBRIVXaCaLgJuX A9RSuMekhRTx170DGMxY8mgQqNnvyaYFgIABjrSZSLEfULSLHMF37V/GgY9yAgVeKBDEwMDuaALD 8JxQBWDjOKBDXkxx6UwIXlPUUriI5Tnax70MQxn4x6UDBj82aAHsu4Z9KQyPHJHtSEMzwRQhDelM kXvVCDPFCAbmgBc0xB3oAeODQM6XR33QgelUiWatMQUAFAC0CCgAoAKACgAzQAtACUALQAlABQBX vVBgb6UAchL/AK4/WpZaGS8mkDIT9aYgFAhc0DFFJjFXrQgJ448KS1Awk7gHGBQDK+KAFNIBCcfS gBMkmmCFzg8UXAViSck0rgJ1pXAlii3kegoZaQ6XaowvX2oBkBNBJJBGWYHsKY0i4oPHHFI0RIox 83c9BQAqjByepoGDN3/KgB8C7nyegoAdO21Dg0AVEPzA+1IQ0n5uaYELHNAhZDkKPQUEkYyaAJCM sMUhlhEyDTKIGTHJ7UCIWxuJFIkaaYhKZIlAg6UwDpQA4c0hij6UwOi0DmI+1UiWbIpkgOtAwoAW gQlAC0DCgQUAFABQAUAFABQAUAQ3XMLfSgDj5xidvrSZaInPPvSAiFBIDGeelMBaQw6CgB8a/MPS kUiR5OSKAGFvlJ9aBDM8CgA6UhhjNAAcA8UAJ1oACaAY+JC7YFA0i3IFt4wA3ze1ItlNmJpkDo4y xyeBSGkWohjjpk0FomC5IC/nQNE6RbcFuTQMa+Ac9AKQyFAZn4HAoEXUjCAYpgQXRDLgZFAytHyw x0pCIycq596ZLZEoJNAhXQ0BYVYiFzigLEywkgcc0FWLITavSkMieLg8UCKskLLyBkfyoE0QsDig loaVOPpTRNhuaZIN0BphcO1ACqaAQ8CmB0uhEfZuPXmmhM1aZIooGLQAUCCgYlAhaACgBaACgBKA CgAoAKAK92QIG+lAHITN+/J96RZHJ0xSER0AJQAd6AFAyRQBMwCjtRYZETg1IBmmAq/eANMBO5pD FPQYoegDTSAXoKQwC5NMSLCb0XCjHvSLsHkM55JJNA7DltSMDHJoYKJIYiuBjgUDsTRQNIeeFpjs W0jWMdOnegAYkn5RmkMhaJ5Gxj8OwosBYigEaACiwXJCvFAFOZfkY96BlXaRGNucmgQsVs7KV6Af rQKxZjtQp6dqBifZtznI4FAWHmEYXjigBwUDHHNAAwGaBjGXNADCvFAiNolIxigTRC0WGPFBNipL FtOR0pkNEXWmSApiHDHFKwx44oA3NBc+Yy/jTQM36okKACgAoELQAUAFABQAUAFABQAUAFABigCC 6XdCwoA4+dcTEe9IoiPWkMjJosIQHimITPNMB4ODUjHE9zQMYTz0oFcVcZoAN2RSYwJoQwFIELwK AHJEz84wPWgaVy3HEARxSLSLSIPSgqw7bQUg6c4zQAKmWBcD6UCsTBsUx2Hr82M0CJQnSmkTccEA GBQAoI4oAaR2pDIXjD/TNA7jVgVAQKLBcfCACRjtQDH7MGnYQBcH6iiwXGEYBzSGMA54pDEOBQA1 qAQw0AMIoEMI4oFYhdM9uKZLRVljwc0zNkOKZItADgc4oGjV0R8Xij2NAPY6YdKokWgQUDCgBaAC gQtACUALQAUAJQACgBT0oASgCKf/AFR+lAHH3n/Hw3PekUiu5pWGyI0yROlAhRQMUYAoGLnikAh6 0CAH1oGH8qQx3WkMljhLUikidIFB9aZViYL9MCkOw9OvPagY8tg80hihxTGLuI6CgBVJzyKAJUKk 4/KmId5qoP8ACgQ6OdWHpTAlR88g0A0JnFAAG5pDG7qAsDHigBIfvUBIlZuaCbEe7igqwwnOaAG5 xSGMJoARsdqAGEgCiwDC1Ahu7mgQh5piZXmX5aaM2U2XBpkAaQDgOKYzT0dT9pRh2NAM6gdKokWg AoAWgQUDEoEOoASgAoABQAUAHagAoAKAIbjPln6UAcjejFwaRRVfPSkAixk9qGNIDAwXOKExuLGk elMgBx1pAKelCGwC/JmmA3tSAUDFJjRPFHlulIpIuBQgwKRaACgofjFADwABnFAw27jSAeqAHkUx 2JNvPSgESIv0pieguygCMw56mkBAyMpoAdFKVPWmBOkpPFILDwc0AJQMN2KAFh6k+1CCQrNTFYYD SGNLUANbpQBDI+AcUCbG+YcYpk3E6g0hjSpoAaQRTEJuxQIbJyKaIZVlXmmSR4pCHjgCgo29CiLZ bHANNCZ0A6VRAUDCgBaAEoAWgAoEFABQAUAFABQAUAFAENwT5Z47UAclff685pFEA2kgUhloIo7V LNYjmUEUimUZwA+BVGLIWpkATmmA7PyAYoAQCkMkRMmkWi5EgXFSWiZutBQnSgByjcaAJyAMUDGj g0hofQMGJ3e1AImVgBiqJYqk96AAUhCEA0AQSJzwKAEQkACgZKH6UDFDYpAKvNMY9RtzQJkbtxQA wN8tAdRm8etAXGyy4HFMm5APnOe1BO5OqgDjmgpD1QAdKQwZRQMiYYNAiJ1zzTJaIyDimjNkE44H WmSQYxQIf2ApDOo0OHy7FW/v81SEzTFMQUCCgYtAgoAKACgAoAWgBBQAtABigBDQAUAMdcrigDn9 YtVUFx1oGjGXrUlI0UUOgapNkhkhMeaBPQoSZLHPWmZsixTJDFMBR1pASqAIug5oGiaBPlyallos qKRaJMcUDGnvmgCSPigCQ9MmgaGrwaQx+M96YC8A+tADgVGCxApk3Ee6jQH5s0E3IDeouOposHMg W6y3SixVyaOVXwO9ICQ7TTER4weKRQ9RSGPWhCFbgHFMZXc0hkLNgUyGxoGc96YgaPPXpQFiJpFX jPNMm9hPNcEYP45p2FzCi9kUYdQR6ilYakTR3SSHjg+lKxSkhWNIq5GaZLGtzTRmyC4HyUxFfvSE WLOEz3CL15pgdZaxeTbonoKoknoAWgAoAKBBnFABQMdQISgBaAEoAUUAFABQAlACGgDO1KAzRkCg aOYlQxylT2NSMuWL5jKHtUs1gx0oxIaGUZ8qneaEZtEJHXiquQIO1AgHXt+dAyVRnikUi3GuAMUi 0TjpSKJAKBiMvFADkGDQA8+1A0FADWbbzQFyu9y3IjUn3ppEOXYptM5bLHJ96ozuOkkQ+X5RJ+X5 8+tN2JTZbtLVJ4suD+dItDmszE37s5+tJlociMACQR71JZIAwHOSKADcRikDJUPFICRT3pgK2MUw RXk6GkNldRvfBqiCxtjiXPU0BYTymbrx7UDuZ12myQgDiqMnuRTGLZF5Jbdt+fPr7UdBDrZTI2GJ IpICSe1MXKNmqASCdidr9fWpKiywelIpiFaZBHcD5M0xMq7O9IRtaDbcmRh9KYM3wOKokWgAoAKA DpQAUCF70AFABQAUAFAC0AFACUAFACUAMkUEGgDmdYg8ubcOhpDRXsD+9xUtGkNyaQ/P61LNSJ4d 2cClcGipJGVPIqjFoiwQapEhjmkBYiXnpQUi3GMCpNESAUDJBSGhcUDFABoAdimA08txQMimUnjt QS9REwq4IxVIkgmtTnK9D707EWGRWhLgMwANFhWNVJoIIwqkcUwSZG9zv+70qGapCKzFNvY80iyW L0J4oEyO4IyMUALGcAfSkMkDYpAOLZWmIryd6BsjhxvNMi5K8RY5z1oKuOHmjqxNMWhUvImY5IB9 6ohopGAhvSkTYtwCOFeTyetUFgluFbikPYrgbnBA6UmBZU8CkUOFAhsoynNUiWRom5UQDlmxQI6e 0iEUWAMU0QyxTAWgQUDCgAoEFAwoAWgQtABQAUAJQAUAFABQAUAIRQBha+BspDRkWJxPzUsuJZx8 5qWbokC5pDILiInoKpGckUimGpmbFVfmPFAidV2n3zQUiwlIskHA/GkMcODSGPAB5zQMdhRQA0+1 MB4UDjvQAMueKQELQ5P400wsBj3cHpVXJsH2bI5yT60XCw+OAKBxzSuFhVt1BzjFA0KRgjFIYvSg CJlLNk0MBegpDFU5oGSf4UCIpOhoEyDo2R1qiSwj7hQMkVscGgAKqwp3ERSQA0XCxG1uo7A0XFYi MAB6DFFwsKI9oNILCKMHFIESkcUIYyXlatGbLOm2+6YSMPlXp9aESzeQYUVRI+gAoAKBBQAYoGLQ ISgB1ABQAUAJQAUALQAlAC0AJQAUAY2uoTFnsKGNHPQtsmUipZS3NWKLfEWB6VFjpQKMUiiTYGWm ZszJ48SHA6UzNjU4PPrQSSd6CkTL7UiiX+GgYo7UMaHDnikMkwAPU0ANPHU0AH1pjF6n2pAGeaAF GOuKAJF7UybDxmgBpHNAyM84oGJg0gEOMelAEZbnFAAODQA/PFMYxjxSEQnqaozY+Jtp56UhlnaC vBpjGkFRSGJv4oHYaTQIZgnvQIQjkUALsx1oFYG4FAEcgJWrRkzU0kBomHpQhM1BVEi0ALQAUAFA BQAZoEFAx1AgoASgAoAKACgAoAKACgAoAo6pHvtmHtQNHIkbW+hqRmpbyYiwKg6o6kqMN3NIpk7t Gkfy5JqjPUzXXJz60Esgfg0EWHgEMBQNEyDjpSKJB6UDFHWgEPBx0oKQ8HAwOtILAoxzTGLsLGgY bMfxUCADFIY5enSmIkBFAgLYFMCPcSeKQ7DguAM0hDCRmgoYx9KAIxxmgQtAx45FADGXGaYiJhQQ xQKARLG+3g9KBkpIZaBoTHrQMaRxQBGRQAD2oEOye9AhGAxTEySKEuvSqRky9pibNwpolmjimIKA FoABQIKBhQAdKAF6UCCgBaACgAoASgAoAKACgAoAM0AQ3S7oWHtQM426XZO4PrUjJ4W/dCpaN4PQ mUmpNLj9+UIpibIzjyx6imZsruPmoJHgd6Q0TL7UDHdKAHDigdxyigpDu9IaHg9zQA7knmgYbfam AY/CkMXb70xBg0gEC8igQ4YFMBrNSCxHuJ9qBjaADHHNCASgQ5TQMGOaAI3FNEMRaBIdjg0FDlJF AyRCO9AD9oIoAayADigCNl4oAaRQSFNCNKwTMNUjGW5djj2VRJJQAtABQAUAFABQAUALQAUCFoAK ACgBKACgAoAKACgAoAZIMoaAOR1SPZdN70ihlocgrnpzUs0gW1wOv4VNi2x8ce7mhlIZOmw8dDTJ ZXI5oJFQUhko4oGOI5zQAvU0CHA4HvQUhQCOTSKRIopDJB1piJABTATFIY3vQAEUAJzQABSRmmK4 MhPSgBBHzzSHcQoAKBXI24oAb1FACgUDHdqAGOKaJYwcUErQlQZpFC7QCaBjgMUAOGaADPagBjcU wI2NAmJTM2bWnri3FWjKW5apiFoAKACgAoAO9ABmgAoEGaAFoAKAFoAKACgBKADtQAUAFABQAhHF AHPa7BghxSY0Y9u2yYZPBpFJ2Lw5apNWXYQNmRSKIbj5koQMqd6ZA5RikMkFAxT0oAUUAhe9Axw5 PWgaHA81JRIpoAkByaoB2M0AJtpAN5oAcFNAh6rjrTExrMq9KGBC0nNIYzfzQgI3PPFAAvNADx0o KHDpQIRhxTERnvxTRDEjYg0mhpk2cikUhw5FAxw4FAhDxQCI2oGRMaZLFTqPrVGbN+1GIVHtVIyZ NimIAKACgAoAKACgAoAKAA0ALQIKACgAoAKACgAoAKACgAzQAUAZ2rQebbmgZyhBViPQ0hl+BtyB s/WpNEy1C+DipNBJOhoBlQ0yEKKQx460DHHpQAA+1AIf296ChAeaBDweaktDlPNAyVTyKYiVaoQu OaAExSAOlAEby9hQFiLJIzSBkQOTQAooGIRQFhVFAIeqljTGSvGVX2p2JvcjbkUhkTUEMaDg5FMk kRqRoiZelIBSeKAGsaBkbGgCM8GmQxydcVSM2b8H+qXHpVIzZLTJFoGIaACgQtAxKBAKBi0CE70A OoASgAoAWgAoATvQAtACUAFABQAlAEc6b4iKAOPv4vKuWFIofZtmIjPINJlxLSZzioNkOkPamJlb GGoZA7FIY5aYDs8UhiD71AIkPIpFDe9ADh1oGhwNIolTsKYiVTimIXdQAhekBE0lAxqKXOe1NCY5 iNuKBEA4PNIaHDrQMO9AAOKAJI2waYMsPPvTafSquQo2ZA2AKkoryEZNCJbGDk0ySwqYUVJaJFoG DdKBjCeKAI2NAhp600RIVfvCqIOgt/8AVL9KtGTJaBBmgYUCCgYtAgNAxKACgQlAx1AgoAKAFoAS gBaAEoAKACgAoAKAEIyKAOX12LbOGpMaM+2k2S89DxSZUXY1Lcb2wOTUm19BFG4k0D6EUgw5FBA3 tSGOB9aAFNAXADmgaH9fwpFhQAopAKDzQUSKaYChjQIUMeKAELUANRS5ppCZOAFGBQIQgGkMidAe RTAYUOKBDcN60ABJHWgLihsd6Q7jt+RTAY70CbIxyaZO48AUhomUgrSKFU0ABNAxjGgCNjzQSxua pESHpyyj3pknRQjEYFUZD6YgoGFAgoAKAA0DCgQUAGKBimgQtABQAUAFACUALQAlABigAoAOlABQ Bka1aGWIso5FAzmSMHB4qRlm3umTjJHbNFiky9E2Kk1TI5z+9JoJIwKBjvekIUc0xijg0hodnikW L3oAVegpAHemMcDSAXJpgGaABQWNAiZcKMUxCFqBibjSAbmgBCaBioOaBMdIoxzTEQbcUCG84NAC EHvQIBwKBihqAHK2KBkmeKQwzxQAxqAIyenemS2JjJpkMsWq750HYGmhPQ316CrMh1AB0oAKACgA oEFAwoEFABQMdQISgBaAEoAWgBKACgAoAKACgA70AFADJEDqQRQBzuq6UyMZIunpSGZcERe4VMd6 RSRoahKYp1iAUFRyR3oGnYjY7gKRQgHNIY72NABxikMXtQxoeewpFC980hi9hTAVRQMXHNABnFAh F5NAE6DaKEAMelAEfUmgYooAO9AABzTAei96BMHoBEZ6UDAAelArDGFA7DCKBMaaCWIG5oESBs9a RQoOaBinpQIjIyaZLDHNMTL2mJmUt2pozkbIHFWQFAC0AFABQISgYtAgNABQAGgY6gQUAFABQAlA C0AFACYoAKACgBaAEoASgDO1RiU2L1PFAzONgke1uQ3rik0UjPvU8u6I3FuAeaQx0LZQUmNEmORS GKevFAxKAFHWkykP70ihRyKBj/T60ASIKBi7aBEbcnFACrx0oAcGOKAELHNAhoPvQO45eTQApIFA Ch1BpgP3rjrTFYRyp6HPFIaI8daBinGOtAEbMPWgYwsM0EjCRigkQUySRelIoei5PFIY5xgUARDr 9KZId6ZLNbS4/wB0W9TVIzkaFUSFAC0AGKACgQYoGFAg60AFAB2oGOoEFABQAUAFABQAUAFACdqA CgAoAKACgDNu2/fqMZ5oGJOPumgqJzt0/mXUjep4qWA6I4AoGicc1JQUDGmgY4UhoePvUikPWgY7 0+tICSPj0pgPAyRQBGVw3SgBAMGgCKSXbnuaZNyFJy74xjNOxPMOLsCVGDiiwcwpaQAHjnsDRsUp XACRscUBzIk8iXZu4xnGM0IfMgWGVhkCgOYfNBNDww7Z4NAKaIgZCDgE0DuhD5pB4NAcyQ2SORCQ 3BFOwuchlLIuT0osTzjEkZjxmkC1LMamkx2sTrEaVwLEaAJTGQynikBEB8uaZIAZIHc00SzftI/L gVfarRk2T4piCgAoAKBBQAUDCgAoEFAwoAdQIKACgAoASgBaACgAoASgAoAKACgBKAM+Yb7kUFDL xgvTrg0AjnM7mP1qWMVDg4zQBYQ1LLRJgYzQMYRg0AAzmkNEgPzUikPUUFj+MCgQ5OKAJU5NIAZf mBpiGuMikBXMYORTGQ+WY2+UcVQnFMjA/eE/dqkzJwaHRhkmbcwOOtKwiwk4EmCuFx1pDLiurLwQ R7GiwD4SpXIwRTBjpAGBoENjUKhA4BoG3chl2jnpQhFa5lXY2Dk0wKDu0qgHt+tA1EkiTA6GpNVo W4hSAsR8ikBKw2jFMRTkPOKAbGngUCJ7GLzbgZ6CqREmbqjAqzIXNAC0AFABQAUCCgA7UDCgAoAK AHUCCgAoAKACgAoAKACgAoASgAxQAUAJQBVdP3uaBlHU8qMr1oBGCOCRUspAThhmhATRnIpMpMmU 0ihGGD7UANBoYJkoPSpLQ5evtQUScYxQADkCkMkQ89aAJG5TNMkYeRmgYzHWgYwgZoAjaPPbtTAi MRyccUwaQgVloFyIUAjPy0C5B8UksfCvgelAciJGuJsH5h+VAciGrcTAY35HvQHIhjtI2csTQgcE ReWSMHpTuLkFEYHFIp2RIABQQ3clWkUieLNIB0jcUxIrn5m/GgTEfhqANPS4cJvPerRjJmh7VRIo 4oAKAF7UAFAgoAKACgYGgAoAKAFoEFAC0AFABQAUAFABQAUAJQAUAHagAoAYyjNAGdqiAxGgaOdY 4cipGMJyaBk0Y4pDROn0pGiJGXIoEQng0CHxnnmkWiQHmkUhy0hjlPamA5TyKQyTdlaBDQePpTAT 3oGNbFADcUAJjPagBRGDTHccIQR1phcX7LhSd4yO1OwcxGyADg0h3GbcUBcCtAXDbSJbGke9MhiD g80CJUPFIZNGcGkMbK2KBMZEfmyaZI5FM0wUdzTQmb0KBEAHYVdjEfTAMUAFAC0AFAgoGFAgoGHe gQUDCgB1AgoAKACgAoAKACgAoAKAENABQAUAFADWFAFS9TMJ+lAzl5UIkIPrSGREYOR60hk0JoAs gdMVLLTJB1GaRZHImeRTJGqcEUAiQHOG71JaJlHQ9qQwxhs0wEDc0hkyHigA6UAIOlMBp/pQA3Hp QACgBw6UAOBx0pgITxQAw0DEApAKRTEMNAhhoEJigkenSgpEuQCKBkchycUIlh0SmI0tMt8DzGHJ 6VSRnJmkBiqIFAoEFAwoAKBBQAUABoGFAgoABQAGgY6gQUAFABQAUAFABQAUAFABQAlAC0AJQAUA RyruUigZhajYMDvUUgMmUFKBodFk5PWpGiwrUFolU8CpKQ4AHrQMgIw1MkfEecUmUiZDg4pFDyAT j1pARsNpApjHxnikBJTEN7UDDrQA3HFACquKBARjNAxwoACKYDSO1AxvrQAlIBppkjTQIbQIeOBQ NDielADOpyaZJPbQmeZV/hHJpomTNyNdigAYqzIkoAKACgA6UCCgAoGFAgoAKBgaBBQMKBDqACgA oAM0AFABQAlAC0AJQAUAFABmgAoAM0ABoAjkQMpBGaBnNaxEsb/KMUmCKVsM5pFImxSLRKjcikNE gNItDWXNANEQ+VsUyUTqdwB71JRMp6GgoHXcMjggUCGRt+lAyUnvQAygBwNABQAA80wsFAx4oEHF ADGGKBjW6ZFIY3pmgQ0nNMQw/SgkKAFpiEY5NArh6ADmgGbdhbeTCufvHk1aRi3cuCmIFPXjFIBa YBQAUCCgAoAMUDCgQUDFoEJ0oAKAHUAFABQAUAFACUALQAUAFABQAlABQAUAHegAoARulAHN64f3 gFDGilAoRPeoZaJByeKRaAcMKAJVakUhw7UDIpFwcimS0KjYpAiVWpFomVhgUDGMu07geKBDgcig Y3pQAoNADh0oAbQMUUxjgeopCsKMYpgDDrQAw8ikMjPWgBtBLEzTEHQUCGk80yGA9aANDTLMyN5z j5R0HrVJESZsYAFUQIvAoAdQAUAFABQIKACgBaAEoAKACgYYoEH0oAdQAUAFABQAUAFABQAUAFAC UAFABQAUAFABQBHNIsaFmOKAOavZhNcbuw6VLZcUVweaRQ4GkUKc4BpDHKcUDRIvIoKA80CaIiNr e1Mkcj4pFJkyNyKQx4YHjtQA0/KTQK4hOaBgDzQA8elAwoGKBQA5RnPFMB+wgcUCuJ60DGHqaAGN 0zSAjPHvQJjTwetMlgxwKaEyMnIpkXLdha/aZOeFHWhITZvogRAqjAFWZi4oAMYoAXpQAlAhe1AB QAUAFABQAdaADFAAaACgAoAdQAUAFABQAUAFABQAUAFACUAFABQAUAJmgCrc6hBanEjgH0pgY15q JumOMrGPbrUNlxRRJyRzUl2DpQA5etBSHr6UhiYw2KAJEPTtQMf1oGNZcigTRGOODQSPUkGiw7jw cjrQMdnIwaAZGSQTQIA1A7j1bFIY8HigY5TxzQMehwaYMcW4piI89aQxOtADWPFAEbfWgTGZ560y Brt1polsao9aZJraL1ehEyNfpVEidaBC0DCgAoEFABQMOlAhaAAUAFACUAFABQAUAOoAKAEoAKAF oASgAoAWgBKACgAoAM0AVrm9htUJkcD270AYF5r80rbLcbB69zTApKrM2+UlmPrUNlpEmMofrUM0 SGjg0AKc5oGKDQCHrxikMcRmgYDrTEiUHNBQ4DOM0DGlMj3oE0MwQcGgkX6UDA57UCDOaBDScdKY CK9IdyRX4oHceHoKHBqBhvNABuoEAbFADCaQDGamJsidsVSM2xmc0EknRRQBp6K3zSDvTRMzXzxz VEhmgBaAFoEFABQAUAFAB3oAKACgA6CgAoADQAUAL0oAWgAoASgAoAWgBKACgAoAKAGPIqKSxA+t AGJqOuhMx23J7tTA5+WeS4kJdizE9TQBPDFt5PWobLUSY9ahmiQAcYoGAFIA9OtACKO1MCVegpFC qe1MYuKBMFNAIlU0ihwoGIUBHvTJaI+VPNAh3agBuKBWEIpiIyOtACDIzSAcHI7Ux3HeacUrBcDL xQO4ebgU7CuL5ox1oC4xpaAuMLEjrQS2NHNMkeoxzQNDgPrii4yOWaSAB42KkHqKaImXrLXXAxc4 IHcdaog0YtZtZDt8zaf9oYoEXldWAIII9qAHZ4oAKAFFMApAFABQAYoAKACgAoAKAE7UDHUCCgAo AKACgBaAEoAKAGSTRxjLuFHuaAMq916CIFYvnb17U7AYN3qc9y3zsQPQUAUyc0ATwICckVDZcUWh UGiQuKCkHfNIBcYJoGIe1AgHWmA5e1IY8g4zigYq9KAEK4OaYh6GkMepoKHL1zQArgMKBWIsY4pk higA20AMI4oCxGeD0oEKARzQA7OOwoCwm0GgVhCB9KYrDNu4EUAOCUgArQOwg60xDqYC9qTAr3PE dUiJFNwVXORVGYxWPFMEXEvJrfb5Ux47ZoG2XofEMyYDqrfpQIvReIYGx5iMtAFyHVbWXG2UDPrx QFi0kyOMqwP0NAD89KQC0ABNABQAZoAKACgAoAWgAoAWgBKACgBMgUAVLzU7e0HzuC3oOtOwGNd+ IXYkW6bR6nrQBkT3cs7Zlcsfc0AQlvWgVxARu56d6AFJXnrigNCzasCuKzZtFlrFQaAaYBjmkAp4 HvSGJ1xTATHNAD+hoAeOlBSFHyn2oBijPBoEIV24IIxTDYVWzSKJFagBQaBi7cigTG+1ArDcc0BY CAD7UAMZfbigVhqrgUxCgdaBi7cCkAxvSmSIoxmmKwp6UhjaBMAKYhT0oAUHCgUBYbhS2H5XvigT KM8BQEryKtMzaIQjDnbkelUSw2kYyCKAHeXuBcYUZ6ZoCw0kkD24oFcA/SmO5JHcSRn5HYfSkBfg 126ixuYOB60Aalp4ghkGJh5Z/SgDVinjmUNGwYe1ICTOaADPNABnmmAuaQCUAOoAKACgBrSKnLMB 9aAM671q2t8hW8xvRadgMO61m4uCdrGNT2FAGczkkliTQIYT70CBjzQMQmgLiHk4oAkQR7cuWz7C gaHwyLHL8udtS1cqLsXxyAQRWZugJyaQAOcUDFNAC4xjnORn6UgEA5pjHAdKAHLSGPxkUxiAdqCR QcHaaAE2leR0pgOB4pFCg0APDUABAI60AMBwTmgB23cKBDCMcUAJtI+lMQoGKQDWFMBhGKBAKBCE 5oAbTEKKAAdRQAE80AM6mhEsCNy0xWKk0RQ5UnB9KpENCxy4GHUMPemJEMhBOF6ZpiERWKkjoOtA hhODTAM0hhkjmgQBuOKYXLEF3LD/AKtyvtmkO5rWfiCRCFnAYeooA27a+guB+7cE+lICxnNMBaQB mgBc4oAr3F/BbjMkgHtTAxbzxCSStuuP9o0AZE97POcySMfamK5XLZpAGeaAGk80AJmmIQH8qBik DNIQnPSgAHNHQfUnS2G0NJIqZ/OkUlYsW0q/c3ZA6VDRrFlkioLAe1AxQM0hhjGeKAFHamA4CgBR SGPHSgYmM0xARn2oEKpyMUDEIKnjpQAoNAxw4oAUDrQAmM0AAJU0AOOGoEJjIINADcY4pgNIzxQA 0jigQw8HrQJjGPYetAhVpiFxxSGKRgfWgBp5oEIBg8UCAHHGeCKBDWUMpFUJopyFoyVxwfWrTM9i uTzTEJkgDFMWwA5FJgmHvQAfWmFxBSAU8dKAbFB45pgSRzOjZRiCO4pBc0rbXLmEYZt496B3Ne01 y3mADnY3v0oA1EkDqCpBHtSA5m916abKw/u19e9MDJeVnbLMSfU0BcaTnrQIbwe9MBM+9AATQAZx xQIbk0D1DuaAEBxQIXOM0guGc0xihjnnJpDJ4IZnO9F4HOe1J2Grl6KTzEHNZM2TuSqM0ixcc0DD FIBB+lAD160wFWkMeBQMOlCACM0xDSMHIoAepyKBiBc9ODQAgOOtAC5oAdmgAoAQZU0CDdQAGgBO gpgNbGKBELUCEA9aBAP1oAkC9zQOw2Q0CYz0oEA6UAHcZoASmIhuI96cdqaZLRV/d+XyCH9a0MiL 9aBCAsvfFAbBzQCDoKYdBB0oEO34IwBj+dA9hpPpnHvQIUEjpQMXNIbY4MQaYtS3b6hcQAiOQgel IdynuGeaZIZHrSAQn3oGJTJDPqaA1A8CgYmaBagMCgYpx2pBcQdaYhDzSAXjFAwQgNQCZYmumlwo +VQMBRRYpsbBKY2GM+4pNDi2jVjYMikdMVk0dCY8DikUHpQAoHtQAmMdO9IBVNAyVeaYBigYY5pA GOMUwGYweOlAhcEUDF4PWgBuMdKAAGgA3UAKDQIVjigBCR2oEMJxQA0tmmIYaBCdaAJFXuaQxzUD IW+tMlgOcUCFPFACe9ADcUxCY4oAoTx7ZD71cWZSRJbRBJ1Ew+U0xJal25gtymBtBpobRlnCZXg+ 9HUjYYcDrTFqGOBzQAn9aQXAY+tAAMe9MA70BcUk55oDUUfWjYVwBNIdxM0DEPWmLqHTFAXFzQF2 Nz+lAB0oAKAAii4B0P0oTBhRcAouADigSDFIZeUxWsCsNryMPypbl6JDba7KHB5XNJocJmmjBwMd DWbN0xcc0igApDHdqAECigByZoAeKYDgO9AMRqQxCKYhvagYn0oAKACgBCvFAhvIoAN1ACFqBDST 9aAG5OKYgwTSuA9QAaB2HmgYxzxQJkJPNMhjwMKKBoDQAnOMUgEpiEoArXS5XNVEiSKm9gMbjVmV xCzZ5OaYridaBXFYDIweKBjcYFO4rCdDzQAtABtx2pXASncBSefSgA6dvyoAXPvSB7id89qA6hxm mAuOKQW0GnrTEGaAF7UkNgce9MNApALgEdeaAE6UxCCgYfWgBQeOtACZ4GaAuWLO3Nw+M7VAyT6U mVFFiO4SGYqpLR5qGjSMrGjG6uAVORUNGqYuKRYo60ALjmgBwWkA8AEADhqBXFximAYoAQrQMjcU AMzjikMXoKACgAzximAdqAG4pAIRzTEJge1ACDFAAeKBB+NAIdzigBjdKBMiA+amSSHp1oKEpAGP 0piGtQAdhQBFOuUNNEspxvCqskqZ9COorQxIX4f5TkUyRhfBHPFIB4BZSw7UwYnamDDPrQIOlDAB SACc0wYHj60A9Be1AAOvSkMP0oAAKBIQHj8KB3DvRcVhM8U2JCmkMQHnNMBTyKQ2KMAZxTFYT60g A0bgIKAQZoAO1AE0Ny0UTIoHzdTTKTIwcHOKkRcgeW2VZGU7D60mrmidjTjkWVQykVm1Y2TJAPSk UKBzQMfQIMUASBg2A5PApCEZdvcGmhjSKBkbd6BjKBCUDDsaAFGaQBTAQmkA0tQAwmmITdQIM5oA cBSAU9KY2RtQSNA5oEO9KBgcUCAdKYARwKADHFAyOQZBoJZnmJpJCijJrRGLREwKnBGDVEsY3QUh CgkDrigaAe+eaYhR70ABPNAmA+lADwMdeKYgPI/+tSAYBTHa4uORSGITkc0gF4FAXE+nNMQd6AuJ TYgNId7gRQOwc0aAGTQLcU4yMde9ACEDv1FACYxigYuc0CEOOKACgCW3USTIhOATzSKVrlm/n3S+ UD8i8cU7DbIYZnhcFTik0NSNq2uEnTg4OORWbRspXLAAxxU2KDGDQMXH8qAFIoAVSehJx3pAK67V B9aEwIG5zTKGbaADpQAdqAEHpQA7HpQAxiB+NIBp4piI6BBQAq0ASD2pDDGBTBkXU0CEIxQIQmgB cc0CHAUANY4+lADiMjIpgMfoaAZmysVmJU4I9KuJjLcdERdXEaS9zgn1qidy5Lo6gkpJj2NA7GeV +zTFXUMPehk7ERALEjgemaYgwO1AmB4oAUMB0oAO/WgB2W6cUCY3OM0x3sGeeO1IYmTTEH496QIK YBk55osMM0CDNAATQAhNABk0rB0F70AJmmAZJoAM0WBBmlYAz0pgLyCDSAXO4ck0B6l6wgRlaaX7 i+tItEAujHLuiO0DpRYOaxq2WoLMAHIVv51Diaxlcug5qDQXOKAFH1oATJpgAORjPFKwxrLkk0WA YRjpQMTHFAxDQIToaBhnFIBpHemAhHtQIYRgUgGimIUAZoAlUigYGgCMgfjQIYx4oEJ3GRQAooEL mgAGKBjs8UwI3PFAiivlm5Pm7ivtWi2MHuNdPImVozuUHiqFsWl1Zv40B+lFguU7iRbibIymaGhX ISuwkHn8aBbBu9OKBCdqdhiUCHZosGgE5oCwDjrmgLLqIDyelIAyc0ABPWgAH3abCwn8VIYUxCk0 gCnsFw60mOwcCgBO9Ag7UwFAGQM0AgIHrSCwmMCmACgEHGaQahnA9aARYW6xafZ8YGc5oLuRECgk ttaNBbrM5256CpL2LVpqSrhJTkdmpOJamaQYFQQcg9KixoKGpDHEZFMBgBGRSGLQAzvxRYYbQQee R2pAIVOAexp3BDcUDE70AL2oAQigCNl4oEMxigQuKAHA0DFJoAYRx0oEMYUCADIHpRYQYxQMO1MB VHFAhcY9aAuMc0IT2M0xSSF3RSQDzWqMdyLc3Qk0zPUaRQBJEhc4HJoHuJMm09/egCM0CYueOmKA D6UAFADlXccUAPMRHvQDTIhigYH07UAJTEGaAuGeaAFPFA7h1oF5iZ9KAFJ6j9KQXYg7cUwD60AG aADvSC4d6AuFMAGKADNAB0xSBBx1oQySHbvTfwuRmgFuWtSuRNMFQ5RRgUFNlRFJIAHOaTEi9DcS 2knlyZ29cGla5opWZpRTJMuVII/lWbVjVMsBsD1oGOBzQAjDtSGhmKBhjFACH9McUWADgnn9KQDM cdqYBQMTFACHpQAwigQnagBe1ACA496BAzUxDTzyKBWDpQMDzSADx0piGgnvQMXJzxQIguH2xn1p omTKUdy8TBlOPUVqY3sNmZGkLJ0PP0piYzcOw6UhD4clwKAQ6UP1agGQYx1oEB55PNMBKAAdaOgE qEo2RyPUUgJRJ7ZosFytmgBM0AH+NAWAUAHegBSfSgAHNGwCUAFACjtQFhDQAdqAAH3oAM880wQd uKQwFAkFACUxC0h7C88fMcCgYHOOOaLgkXdJQPdZboqk81JcSvdTNLO7E9+KYmPtjMrExZyOeKkp M07W+EnyPgPUtGqlcurJSKHZBFIYh4oAYDQMUnigAHI5oAQgdqAGmgYHgcUhWGnlT60wGYNIAI9+ +KAGk4oEIGzxTFcTnvQA4CgYuOKBCdBTAbQAmKACgRRvJP4RVxM5sT5LmDgBZUH5iqM2rlQjB5pk hQJjlJHI7UMaJDIZAM44/WiwXIW60WExKAAUALmmAFjQFgzjuaA9AxSGNIoFcU9KAuApgHfpQAoz SYwpiDkdaQCd6BoBmgQd6AAA0wACgAxzQAY44oAMUAGOaADBNIBMegosO4vODigSYuTyMUDGo7xE lSR9KQ7ihiT0oA1NPKxWdxNj5gMA0FIztxDE856k0CuX7eSdIDMctEDjk1LiaKTLUF9G/wDFg+hq LF8yJzKGHWkWg3ZNAxc5oC4oNAAKAF4xQIQigaY3pSGKOlMBrCgRGwoBkY+ViGOCD0osQTSEsFfA AYdfXFAIZ0oGO64oGBFADcUCA9aYiKZwgzTsS3YpR+XPMRKSu7ofQ1olYybuROrwylehHFBPUfFZ zSn5UOD60XHYkm06SGIu7AY7U0DVioCQMUyUw3YIIpWE2I3LZx1pgJQAtIYlMWwYz3oAWkAGgBKY CnFIBOn0oGGTnmgA60AGaBCE89qAF7UB0EHFACj1oAM4pgHtQAE88nmgA7UABIHNK9gAYpiAj0pA KPegYYxRcLCUMEIQMYpDGE9aBliK5dLd4QRtk65oGRAeppom5pTybNEhRT95uaRp0MzPAwaQjSu1 NnBAUc7nGSKVlYrmaIYNQmLhcg5OBmlYaky7c3j2sgSZACfQ0co+cZHqHmuERPmJwOaLD52LJfmF zHIhDDtmjlDnH21091IUjAGBnk0WDnKU19IxKlsc44p2JcmXrNi9sJAxfHDL6e9JoqMu5aDZGag1 EoGNb0zQIjaNWPIyaBWEC7RgdKYh1AC5pAANABimBHLIsYySKdiW7FAziWZfMGEzzirSsZOV2Nuo hDN8jbkIyppkssWy/bJ0YgAIPmJ70PsC1NZrqGMgFwPxp2LehnaleRSxbI2yc00iZPQyyaRDE7Uw AdMUCaExSAUYoBiUXAPxpgHHtQAo5oASgBTyaQBTAaTg0gD0oAM8ZAxQAdaQwB9qBBkCmPoLigQd cUAA4xxTASgBQRSF0DHrRbUd7IKYhe1IBORTAM4NIYgOc0AITgUAIRx2pWGJ2PTigYBjg/yoEPNx I0KxE/KDkCgd2M7/ANKQzS1KYTW9vtPKrg+1Mb3KEJxID0wRSBGhrozPGwOdyCn0BlKyk8u5iPow oBFvWV2XpbHDAHNAMi06fybuM9BnB+lIES6tbeReFgPlfkVQMZps5iulH8LfKR60gTNcDy5Hj7Kf l+lZyVjaErhnNSaASKBDCQeKAE6UxCA0CE3ADmgLkb3CJ1NOxLlYi+0NO4jiGCfWq5SeYqea6Tfv MkqeQauxnckvogrJNHwkgyB6ULUH5ETzh4ERh8y9/amIYsrIMKSM+9IV7Cb2JJJp6BcTJPFArinr xigBO9AxD7UCAZoEL/OkMTvTQBQIKACgYZoAWgA5PTigBfLJz3pDGsu3ntQA0mgQZ544oGICc0AO GKAYZxRYQo6UwAHBoAD19fegQACkMKaEKOvNACUgAE5pjEz6CgQEUhik+tAxjDrSAQn5aBgi72wK ABhtOOPwoAVNufnJC+3WgBDk9xigYKCTxQK5NcXEkwQPj5RgfSgdyMAgA55zRYVyzd3P2oRnBBUY NHQq5VVipFAi5cXxuoo1dclO9MGyCNvLlBIxg0gWhpG+E100hBAxgD1pSRcZWHNexrwc5+lTymnO gS7V+FBJ+lHKLnRE18FbG08etHKLnDz5GhaRF4XrRyi5yAXkhYAnAquUnnH3qPCUO8srDIOaaQNj rFUuI5YmA3FcqT60NCWqKiO0Uyt0INMnZk+pbftIZMYdQ340LYJFd52aFI26IeKYrkeeaBB2pBYU HFMQn5Uhi9BTGFAhOc0ALnnn1pBYMkH6UwE3UALmgQhNAH//2X== ------=_NextPart_01C8E823.DA10E9A0 Content-Location: file:///C:/8E69C634/Classof2004_files/slide0111_image013.jpg Content-Transfer-Encoding: base64 Content-Type: image/jpeg /9j/4AAQSkZJRgABAQEANQA1AAD/2wBDAAoHBwgHBgoICAgLCgoLDhgQDg0NDh0VFhEYIx8lJCIf IiEmKzcvJik0KSEiMEExNDk7Pj4+JS5ESUM8SDc9Pjv/2wBDAQoLCw4NDhwQEBw7KCIoOzs7Ozs7 Ozs7Ozs7Ozs7Ozs7Ozs7Ozs7Ozs7Ozs7Ozs7Ozs7Ozs7Ozs7Ozs7Ozs7Ozv/wAARCADSAKsDASIA AhEBAxEB/8QAHwAAAQUBAQEBAQEAAAAAAAAAAAECAwQFBgcICQoL/8QAtRAAAgEDAwIEAwUFBAQA AAF9AQIDAAQRBRIhMUEGE1FhByJxFDKBkaEII0KxwRVS0fAkM2JyggkKFhcYGRolJicoKSo0NTY3 ODk6Q0RFRkdISUpTVFVWV1hZWmNkZWZnaGlqc3R1dnd4eXqDhIWGh4iJipKTlJWWl5iZmqKjpKWm p6ipqrKztLW2t7i5usLDxMXGx8jJytLT1NXW19jZ2uHi4+Tl5ufo6erx8vP09fb3+Pn6/8QAHwEA AwEBAQEBAQEBAQAAAAAAAAECAwQFBgcICQoL/8QAtREAAgECBAQDBAcFBAQAAQJ3AAECAxEEBSEx BhJBUQdhcRMiMoEIFEKRobHBCSMzUvAVYnLRChYkNOEl8RcYGRomJygpKjU2Nzg5OkNERUZHSElK U1RVVldYWVpjZGVmZ2hpanN0dXZ3eHl6goOEhYaHiImKkpOUlZaXmJmaoqOkpaanqKmqsrO0tba3 uLm6wsPExcbHyMnK0tPU1dbX2Nna4uPk5ebn6Onq8vP09fb3+Pn6/9oADAMBAAIRAxEAPwD0XSNH 01tGsWbTrUk28ZJMK8/KParv9i6XgZ020/78L/hS6N/yBLH/AK9o/wD0EVdAzzQBQ/sbS/8AoG2n /fhf8KX+xdLJ/wCQbaf9+F/wrQ28dKQDFAFD+xdK/wCgbaf9+F/wo/sTS/8AoG2n/fhf8KvgYo6D OeKAKP8AY2lgf8g20/78L/hUcmmaPApMmn2aj1MK/wCFRa54gtdHti8jjeR8qA8k15hrvim/1Hd+ 8MSH+AHgVMpJFxg2d1qGseFLHIa2snYdkgU/0rBu/GuhQn9zodtIPeFB/SvOXnkZ87yT6mmTl4jl 2IY9j1qOZmnJE7Wbx3bk7otAsVTPG6FTn9Klt/HmmsyCfQLJF/iKxKc/pXnTzs3fiiMszDrVak6d EewQ+LPCcrIv2K1QN97dbr8v6VOuv+G573yIbSyAA++0C7W9uleOGUx8A896Rbog9TTVxOx9A2kW gXQAjsrInHTyV/wq8mkaSwONNsz/ANsF/wAK8M0jxJdWhDeaxCYxmu103x/JIoWVkV8dSODRcOW+ x3v9j6X/ANAy0/78L/hSnRtKP/MMtP8Avwv+FZWm+Korv5JQEf1U5BHrW7DOkyhlIIPcVRLTRX/s bSz/AMwy0/78L/hR/Y2l/wDQNtP+/C/4Vd+lFBJS/sbS/wDoG2n/AH4X/Cub1XStPXUpQun2wHHA iX0HtXY1zOr/APITm/4D/wCgigDY0YZ0Sx/69o//AEEVfXpVHRhnRLD/AK9o/wD0EVe6UALTacRm kHAoASsfxH4gt9Fsy7ENKR8ietW9U1GLTLKS4lPCjgeprx7XNYk1bUXkkf5R0yeBUTlyo0hDmZBq OpXWp3TXM7k5Pc8D2rGuZTI5J+76mn3N18+F5AFUpGYrvbPXA9KwVzodtkP8wRcoPm/vHt9Krud+ WJZ2PUmkLMFOR+dMG52O0HgetWjJgI2yMr/9arb3Kx25WNQnbPc1BGBj5s47+tLJHG2RuxjovUmh u40rbFQuzEk9TS59B+dT/ZJCm7GF9aiZSoOevvWil0M+VoFfAFW4ZyO+Ko575qRHzjJNKQ4nSaZq 0scigMAQeOetehaJ4jZVTHT+NP8ACvII2IPWt/RtUeCRVc8Z4PpUKVma25ke721zHcxLJGwIIzU2 a43wvqoEqxFwY5D8voDXZZrZO5zyVmFczq//ACE5v+A/+giumrmdXH/E0m5/u/8AoIpiNrRhjRLD A/5do/8A0EVcqnox/wCJHYf9e0f/AKCKu470CDHFMZgqlj2p5Nc34y1d9O0hxGQHf5R60DSucf46 8Qm7uGtoWBjQ44PU1w0kxU7epHJ9zT7u4aSVnLHPbNUDKc5B5Nczd3dnSrRVkPwMM3vUsbNKjSOo AQkgdsmoAwUqRzT/AD/3OzGVzuz3PrQMrPl2AOQDTdyglVySOh7UsgZ/m6ZNPgh3MeMCi+grNsaC ynO7k+lRPnzCw61ekt9r8dMU0W5zlQWx1OOlK9iuR7FYpKULknqKSVcrk9K3ItN8yDaSchSxH8qq 3NqRYwycHdwRj0o5inTaRkrH2p4QAGry22TEwH3hg/nipJrIqMgcjI96ObUn2dkUFyOSOlW7eXYO CSD+YqERYPNORQre1ArWOr8MaoyajHC7EK/3SexHSvZreTzbeNzxuUE1896eSs4bdgxsGHPvX0DY gfZIsdNoramZVCz2rmdX/wCQnN/wH/0EV03auZ1f/kJzcD+H/wBBFaGJs6N/yBLD/r2j/wDQRV2q Wjf8gSw/69o//QRV2gAOO1eW/EnVFbUFtFkz5SZYDsa9Srxf4jKF8V3GOhiXIqZbFw3OOlm3HAqN Rk80zo2elTwDc4z90csaya0NE7sQxMIix4LHAp8YXYwJxtX9afczrMFVUwB0FQHJGc4qSyy5ElvH jAUZAH9aktwiuVZ1Ho3bFUQzEADPJ4FXXjS3gEaASTOPmKjO32zSbLiTb1uHZYwW5+la9np6/Zwp GWlblj2qjpGnP5hJUtKw4A7VvS27WqKPvSngKvPJqWdNON9WEMCs1zNgKMYAHTA6VmXFrEIAskig ZzWxc28lppT7j+8cZJA6Vz1wss5EUKl24BA7UjRqyGedDCuzaCy5A9++aq3E0okLqeCMircel3k0 5YxHBOKv3Ojv9lVQAHUd6G2ZqDaOcebexDD8fWmedgBTjjmprjT7qI8wnjv2qgWwemDnnNXFnLNN Oxp6OiS6pbxyMQjSBSfxr6Gt1CQIo6BRivnXS2Bv7cudoEi5P419FwkGNCPu4GK2gYzJa5rV/wDk Jzf8B/8AQRXS8dK5rVyf7Tm4/u/+gitDI2tGH/EksP8Ar2j/APQRVw/nVPRudEsP+vaP/wBBFXAM 0CAivFviWix+KpWBPzRAmvaDxXkPxRs5Y9bjupI/3Mq7QQe9J7FR3POmkJYj16VLHMVjIzwa3LnT bWGwLmLGVyretc8SQSAOKzTubSg4MesmPrVu2tJrrJQfL6npUVvbNcSg8fMeAK6m2tlitlVRwOvv Wc3Y1ow5tyrp+jxROGlPmHr04FbUUVtt/dRAY9FzRbxDyC56nsKuRDag2gDpWZ3QgktCS0WOBCcC MHliV5NaVtJYyfPFsZwM89aqS3ltFGDPJEg9CRmqYFrcyb7OVQ2ecHg1V7A2ma93HBcpskHyngio 7W0to/NCxqoGDnHJqukkh+QgZFSyN5EBOeWpXKtoLOIguEAAqjM6ENjFQSX5LYVSxA6Vmi7h81jd SEMey87adrkuaiT3DRMSCQa5vWLFI/3sY69cV0jmxuIy9vIsmOuDWVewZicA5GDjPanHcwr6xuYN ru81dvqMV9GaWzNpdqz/AHjEufrivA/DunyajrdraopbfKpbA6KDzX0JGFWNUUYCjAFbxOCWw8et c1q5/wCJnNx/d/8AQRXS5GOa5rVz/wATOb/gP/oIqzM29GydEsD/ANO0f/oIq6OOtU9G/wCQHYY/ 59o//QRVvvQICc1yvj7Rk1Pw/NKR+9t1LofTFdVmqerW32vSbqD/AJ6RMP0oBHidvm80eCI8khlz 7ZrAv9OktbjYRnPSuh0F440uLecfNG+F56c81e1y3t57aHy2DOPmLAdK5b2kem6anSUjndGtTuDO PpXTwR5XBGc1kWPLLgYwK2YmGQamWo6KsiwkXloBgj0GKrXsM7YBZ0Qjnyzzmr6jfjbxgU7Y46kf hzSTOnlurHOadpTQ6gjXbPNBGxKqqZLn3J7VsJbw+azxWhgUngE4/StSHy41+Yj6YpsgDgsRtA6e 9VKV0ZwpKDKYkWK6YIWKAdT61YuZ/MteBVWdgSAvTvSfM0BAPSszawyzUNAApTO47wwwT+NY2s6J cyXjvEoWGQgnaMkY9K0rVjDOSRkdCK0fvj9052kdK0UrGDhzqzOXngAmiNtBJE8YAZjxu+tXPL8y MsR1BrQlhbcdwP1oS1890gh6ucAU+a7M5U+WLNf4a6CkMk2qMh3EeWhP6mvRKxvDNo9posEMi4dc g+/NbIrpSsjzpPUO9c1q/wDyE5v+A/8AoIrpea5vVx/xM5v+A/8AoIpkm3op/wCJJYf9e0f/AKCK umqOj/8AIEsP+vaP/wBBFXsCgQlNYZUj1p1Jz2oA8N1G2/svxffWkgwruXX+YrQntV/s0zgkMe2e 1X/inYi01Wy1VBjf8rkD0qijPLYkKdyv93H0rnqLU9DDyvFozbSPaf5VoIcN9OapxLgjJ5q1G373 vjFZM2iXrd8NliTmtSNUdBhcmsOMlSea1LO4CKCxqVudS2JzGxIGOfpTZ7dVizLJjvilmvlVflUE npVaeGaSFmbJdu2elMGV7h4VUmPNNiXP41GQAMMpH4Vas54E3+YgbK4HOMUJBcpyL5UpY9KuwooO Y81SvJFeTbFknvmrloPLRctnIzTZEd2iW4Py/NzineHE+0a9bqeisSfyqrdS8dau+Eju1+LHo38q qG5liHaB6Kq44AxS0ZxxSjius8m4lc1q5P8Aac34fyFdLn0rmdXB/tObj+7/ACFAje0YY0Sw/wCv aP8A9BFXKp6N/wAgSw/69o//AEEVd79KBDT05o+lOpvSgDB8X+Ho/EejPbFgkqfPE56A15PYNc6R byi7ZsJKI4lH3TnOSD6cV7dfHFlMR12GvKvHOI4bK1XAOAzAD0H/ANepkro1ptpmWv3ie1TRN83W q9o4miHODipIshyK5pI76b1TL0fPTk1Y2tGvOcVHCBtzx1rR8pZ4sjHBFZHYQ2+APNc/N2HpQZmk J+b8qp363KcQFcLjPGSRVFLuUSFXkaJeeeOn0qkrohz5d0bsMLPIGPIFV5rdWlbGV55xUlla2s7R gak/Iyw3AGnT2BjWR/7RAVW46ZxVcpPtYPczJI/LYkGnW902CuKzL+VvtPk2s7ycjLHpitjS7NZA odiWNElYFJPWOwy43MAehNdD4Ftd1/NORxGmAfc//qrG1Ar9o2qMKg7V2ng6z+y6P5rjDXDbvw7V dJanNiZaHQA0uaB7UV0nnsK5rV/+QnN/wH/0EV0tc1q//ITm/wCA/wDoIoEbujZ/sSw/69o//QRV 2qWjf8gSw/69o/8A0EVdoEFNPWloOaAGSIHQqwyCK8s+JVqYb62mVDhl216qTWVr+iWms2Dx3KZ2 jKsOqmk9Rp2Z4vpTFgeTweRWjOhikEij5T19qzbWJoZ7hVPCSlVPritdHE8BU9+K55bnfS1RYtyX B29OtXraXlkGMkVlWcphlMTHG09fUVoEBXSZfung/wCNYNanbGV0TSruBz1qk9tHK2HUH8Kts/z4 7UYVT06imi02VxptqF3EsCOmAKrmyQlsDj3rVRVKYqrMNvPvVXKTZmvAsZ+QY/Cr9jJsXceOMVVk +Y8dKTzNq7QfrT3OeTs7s0NPtpNUvUt1XJlfk+ijqa9NhgWGFI0G1UUAVgeEtHaxshdTptnnHAPV V7CukHTmuiEbI82rPmkAGKKKMVoYB3rmtX/5Cc3/AAH/ANBFdLXNav8A8hOb/gP/AKCKAN3Rv+QH Yf8AXtH/AOgirtUdGP8AxI7D/r2j/wDQRVzvQIdTT1oJAyc4Fc1r/j3QdBRhJdrczjpDAdx/E9BQ B0jMEUsxAAGSSa5DxD47062gmtdPmW5ufulk5RPx7mvONZ8Zav4uumhaY2tgP+WERxke571FHCsa hEAVcYAFZzny6G9Kk56vYcjkvngbjmrcTFGDdmqoY8EdqtxjKjjg8VzOVzvhGxPNEXG9PvCpre6Z V2sPrmmQOyMUb8KsPbiQF0IDDt60XNuXqiN58MMcjsfSp4p1kA/xqo0RbPGM1UZZIX+ViM0WRKk0 dHG0QQkn5u1QTurAntWT9on2gBlJ+lMa8uGygUfWixftUiaaRY25PStLwdbQ32vxi5UOqqXCnoSO ma55leST942akOp3migX1hJ5cycAlQQR3GK0hY460nJNntuATTsc15dpXxgVnKanpu0KMGSFuSfo f6V1dj8QvDF/jbqaRMf4ZgU/nxXVY886al4x1qC2vLW8Tfa3EUynvG4b+VTcUhBXNav/AMhOb/gP /oIrpetc1q3/ACE5f+A/+gigDTs9Rs9N8O2U97dRW8a20ZLSMB/CK5PWvi7pNorR6VDJeS9A7DYn 19TXjlxql3eqj3dzLMVQAb2JAGOg9Kq+YTz0q0iXI6bXfHWu64zLc3zRwn/ljD8i4/DrXONITzzz 3qEvnucU3OM4Jp2JubOk3Pl3IfbIyEYkY9F966UDLDgYrhYJI1lHnb2j6sqnBNdXod8Z0WOZPLDZ 8ncfvD0564rmrQe6O7DVV8LNHy8nnqT3q1DHzg96XyhkCpYhtcBhx61xnpoQpxg/n6e9TI5Q7T1H 61L5O7gcimFCvykZUdM1RaVh8mHXIXn0qOSASrkY9we1GSp4ORR5w3c/KaAZC8OxSMc/Sqb4jDZq 9LOqjOc/WqMp82XgZJ7CqRlJIYozyB1pshz8oGVxirLIIIST97+VVgvy7uadzGUehhXthDay+bsB hb0JBBrIeZGJI4OflAFdbcQiaJ4mwVYYrnI7W1e5lW/uxbBAdpRM5I6cV1U53OCtT5XoV7bUrqyk EtrcSwODnMblT+ldvoXxb1exKRaki30Q6sflkx9e/wCNcBKqqSFYsM43Y60wsSMZ4Fa2Oe59EaL4 +8P61sWG9EEzceVP8pz9ehpNWOdSlI/2f/QRXz0spBznpVttd1IHH2+4wAAP3ren1pOIcyKK8xqf bFDYxxx601WO1eQOKQseO+aaJaHZAxS8Yzx14pmfpRyM9BQLoLkBsZzirFpcRpcrJcl3WNTsUHv2 HsM1V+Zj2pOc8imNOx3uia19pgijvQInfIikJwJMda6KOEEjdXl1pcRTXMK30pEMS4GODgcgD6nv 711nh/xRMkOzUY8Wofy0uCc7T1wfXiuSpS6o9OhidOWR2MUakY4U9s9DUVzGFQ8YqaOWOVFKMrKw ypByDRLmRdrjG3gVz2O5MzM/jQwDLzU7RZ5AzUJBA29M0jQqTGNe2aYhDHCLj1qS4hIXI5xUcA2v kjg0EPcZdksu31qPIwB6DpVi4AJyBniqqAj5iKZnJaitHk+2K5jWYWW6mCRK2VDFv4l+ldUvJLFf aua13y/tjM6SEKg2unRWzxmtqV+Y5cQlyamCrtl1OTjkY7fWjI655rV1HVZdb2K9rHFJEDl4hgsM d6yS2eMYrrVzzHboShNw5IBxwKib733RSpuJ2gZJ4FDwShyChzVEojB+VRjtQD0JpV+6O/FI3y4x S2GOpvUHnmmljjrilByeD1ouAufbPFHfvRk/pQMkdaYhM1YN27QRW8kgEEb5Ax0zjJ9+lQ+n8qaW ycAUmOLOp0nW57S9uRYbZNPgBfY7H7owMj0J9Peuy07xDY6nCPLlwzfwtwRXkMdxLbiVUchZF2uo 7jOcfmBVltTMtvZ2yqyLbsxJB+9uIJP5CsJ00ztpYhx0PXWmj3EDGPamsVfBHWvPbfXZf7T1EW98 wt1ike2UtxkcqOfal/4SbUv7GjvBc/vfPMci7RgDAII/WsfYs7Fiodju5BxjHOOtVZFaMZxXOxap cL4jt1a4aW1vY1MOW+5uHf6EEV0ZmSVA27giolTcdzWnWjUvYgDs6K2cLnGKUrhcjkVA8kERJ3qg JyctjNQS6vawhv3m/YMsqDOB60JN7Cckt2TufLVnY4HU1yOoXDyPK4aRHkPyqeVkT2/EVoalq0tw rKqrGiosyoxyJkz0z/T61S0/Xk0y6eWG2WfGRAJekYPX611U4Nas4K9WMtFsUYmkt5czRsOPutlc iq8pHmHb0PNXNV1afWLxrq42hyANqjAAFUc5OOtb2OJ26Co3lncB81Pe8mLH5qjPWo2PzGgm41Sf l57VZhPymiih7DW5SYneee9KpOw89qKKlD6D8njk9KcCfU0UVRLAk5HNNBO3rRRSBEMpP6U6ckSA g4OwdKKKg1QL91/pTiTgjJxtHFFFMOoQswjyGIIbjnpWms832i3XznxgcbjRRSZpAbuZrO73MTiR cZPuauF2+3j5j81hzz1+SiinHYOpl3bMYLfLE4iwOenzNVcE46miirMGKCcde9Lk5696KKOgDMne eaYxOTzRRQT1P//Z ------=_NextPart_01C8E823.DA10E9A0 Content-Location: file:///C:/8E69C634/Classof2004_files/slide0112.htm Content-Transfer-Encoding: quoted-printable Content-Type: text/html; charset="windows-1252" CHSAA Hall of Fame
Anita Stites-Rowland
nA three-sport athlete at PVHS, Stites played basketball, track and volleyball. She was one of the state’s finest girls basketball players during her years at PVHS, leading the state in scori= ng and ranking in the top five = in rebounding. She held seven= state records and ranks in the t= op 10 in 13 other categ= ories. Stites scored 1,895 point= s in her Colorado prep caree= r, was 2nd in rebounding with = 1,100, both are PVHS school marks. She scored 225 point= s in four years at the state tournament, and scored 34 point= s in a single state playoff game,= all highs when she gradu= ated.
------=_NextPart_01C8E823.DA10E9A0 Content-Location: file:///C:/8E69C634/Classof2004_files/slide0112_image014.jpg Content-Transfer-Encoding: base64 Content-Type: image/jpeg /9j/4AAQSkZJRgABAAEAyADIAAD//gAfTEVBRCBUZWNobm9sb2dpZXMgSW5jLiBWMS4wMQD/2wCE ABkREhYSDxkWFBYcGhkeJT8pJSIiJU03Oi0/W1BgXlpQWFZlcZF7ZWuJbVZYfqx/iZaaoqSiYXmy v7CevZGfopwBGhwcJSElSikpSpxoWGicnJycnJycnJycnJycnJycnJycnJycnJycnJycnJycnJyc nJycnJycnJycnJycnJycnP/EAaIAAAEFAQEBAQEBAAAAAAAAAAABAgMEBQYHCAkKCwEAAwEBAQEB AQEBAQAAAAAAAAECAwQFBgcICQoLEAACAQMDAgQDBQUEBAAAAX0BAgMABBEFEiExQQYTUWEHInEU MoGRoQgjQrHBFVLR8CQzYnKCCQoWFxgZGiUmJygpKjQ1Njc4OTpDREVGR0hJSlNUVVZXWFlaY2Rl ZmdoaWpzdHV2d3h5eoOEhYaHiImKkpOUlZaXmJmaoqOkpaanqKmqsrO0tba3uLm6wsPExcbHyMnK 0tPU1dbX2Nna4eLj5OXm5+jp6vHy8/T19vf4+foRAAIBAgQEAwQHBQQEAAECdwABAgMRBAUhMQYS QVEHYXETIjKBCBRCkaGxwQkjM1LwFWJy0QoWJDThJfEXGBkaJicoKSo1Njc4OTpDREVGR0hJSlNU VVZXWFlaY2RlZmdoaWpzdHV2d3h5eoKDhIWGh4iJipKTlJWWl5iZmqKjpKWmp6ipqrKztLW2t7i5 usLDxMXGx8jJytLT1NXW19jZ2uLj5OXm5+jp6vLz9PX29/j5+v/AABEIBB4C6AMBEQACEQEDEQH/ 2gAMAwEAAhEDEQA/AK1UMXNADs0AGaAAmgQ0mgYw0CGk0AITQA0mgBmaYCUAFAgoAWgBaYBmgQZo AKAFoAKAFPBxigABoAcDTEKDQAZoAUGgBQaAAUAOFABQAtABQAlAC0AFAC0gFpgJSGFADTQAhpgA pCHCmMUUgFFABigBQKAHAUAPFIYopDFoAUUAOFABQAUAFACigBRQA6gAoAKACgAxQAUAFABQAhoA KAENACGmA2gApAGaAEpiEoAaaAG4oAUCgBaACgAoAQ0AIaAExQAHpQA3NACUwCgQUhhigBwFMBQK QEFIoM0AOBoAWgBCaAGmgQ0mgBhNACE0wG0CEoAKAEoAWgApgFAhaACgAoAXPGKAEpgFIBRQAtAD hQAtABQAtACigBRQIdQAUwCgBKAAUAOFAC0AFIAoGIaAGmgBKBC0xjhSAUUALigBcUAOAoAUUhi4 oAUUDHCgBRSAWgAFAC0AGKAFAoAUCgBaAFoAKACgAoAKYCUgCmAlABSASmAhoAbQAmaBBQAmaADt QA00wEpALQAZoAM0AGaAG0AFACGmIQ0AJQAlABQAAUAOApDHAUxCgUhlXNAwoAUUgDNAwzTEJSAY TigBhNACZpiEoAKACgAoAKYBQIKAFoAMUAGKACgAoAKAFoAUUAOFABigBRQAtACigBaBBTAWgAoA KAFFACikAtAwoAKAENACUAGKADFADgKAFAoAUCgBwFIBQKBjsUAGKBi4pALQAtAC0AKBxQAtAC4o AWgAoAWgAoAKACgBKACgAoASgAoAKAEoAaaAGmmISgBKADNACUwFpAJQAhNABmgAzQAlMQUAGKAE oAQigBMUABFABigBQKAFFADhSAUUDKVAxQaQC5pgJmgAoAM0gGMaAIyaYgoAKAEzQAE0AJmgBc0w FoEFAC0wFpAFABQAUAFABQAooAcKAHYoAKADFAC0AFACigQtABTAWgBRQAtABSGFACUAFABigBcU ALigBcUAKBQMdikAoFACgUAOxSGAoAWgBaACgAoAdQAtABQAtAC0AFABQAUAJQAZoASgAoAKYCUg EoADTAaaBDTQAlACUAFABQAuaAGmgBpoAKBBTAWgBcUABFACUAGKAExQAmKACgBaACgBRQA6gCjm kULmgBM0AFABQAE0gGE0AMpgGcUCEzQAUAJQAUAKKYC5oELQAUAOoAKAFxQAYoATFABQAooAcKAH CgBaAEoAKACgB1ACigA70CFFAxRQAtACUwCkAUAKBQA4LSGO20XCwu2gA20XAUDikMXFAC4wKAGF j2oAVWI60hjxzQAuKLgHIoAN1AAGBouFgZwvWi4WBZQTwaAHZGKYDgaAFoELQAlAxaBCUAJQAUAF ACUwCkAhoASgBDTATFAhMUAJQAlABQAmaAEoASgApiFxQAooGLikAUAIaYCUAFACUAFAgoAKAFoA UUAUM0ihc0AGaBADQAuaBjSaQDCaAEJpiG5oGGaBBmgBKACgBc0AGaYhwNAC5oAUUAOFABQAtAgo GJQAUAOWgBwoAWgBKACgAoAdQAtAgoAUUDFzQAUAFACgUDHhfepuOw4KPWi4WFC0rjsLt5ouFg2n 0ouFhDRcA3YouFhC+aLhYTf6UrjsNyetO4CNJxx1pACTMHx2pgSmTNACGQnikAA8YoACxUHFIZHv J680AHQ5FAEyOCKoRMpoEOpiEJoGJuoAXNABmgQUAFMAzQAlIBDTASkAUwEoEFACUANoGIaBCUAJ QAYoAXFABigBcUALjFAC0AIaAG0wEoASkAUwCgQUAFABQACgCiDzSKDNAC0AFIAzQAhoAYaAG0xB QAmaBhQAUCEoAWgAoAUUwFFADhQIeKAFxQAUAFACUAFADhQA6gBaACgBKAFFACigBaAFoATpQAwz KDipuVYBOo60rjsP85D0pcw7ArgnrxRcLDy47HNK47DPNApXHYcsp7UASB2xncKAF8xiKAEMhA6U BYZuJOaYhCSaAEJ2jk0gI2k7CgBquQc0wJkPIJpiH5FAEbSbTxSGJ55oAPNJFAxwPNIBeKBCqdrU wLUbA07isPz6U7iGM1IdiJ3ouFhqzY6mncLEySBhQIkzTATOaBC0AFACGmAlIAoASgAoASgBtACG mAlAgxQAuKAFApALimAYoAKQwNMQ00ANpgJQAUAGaACgBKBBQAlACg0AUR7Uihe9AC0AJQAmaQCE 0ANNACUANpgGaQAKACmIM0ALQAUAKKAHCmIcBQA8UALQISgYUAFAAKAHCkA4UwCgBcUAGKADFAC4 pDCi4WFHNFwsQTuR8oqbjIO9AxFQtknpQA7p0qRj1+tIYpbtQMFNAiVeO1Ax+OKAHL0oAU0AITgU AM3Y6UAMwWOTzQAu32piG4xSAQyY9qAFEp/CgBMhutADRimA9T2pASnGARQMQNQAFqAJo5Fxz1ou A/zP7poAYxJ70AROTnFADAaBC7yh4PFO4FmOXcKokfuNAD1PrTEOzQAlMApAJQAUAJQAUANoASgA xTAKQC4oAcBQAUAFABTAaaAEoENNMBKAEpAFMAoAKAENABQAZoApA4NIY4fnQAmaAEJpAJmgBpNA CGgBCeMUAJQISgYUALTEFIYCmIWgBRQA8UxDgaBC5oAUGgAoGFAC0gFAoGKBQIcKYC0hhQAUrjsM MijjkmlcaQokwecCkA7zR0AzQMUEYpiK8v8ArOlIYwqT6AUAObAXAoERyfLjikMRWwaBjxg8ikBI nTmkMlFAC7s0wFzkUAIWwMUARl8nFAC4PAoAeMUAL7UxEb8NSGMC7xxQIaVK9TimAoZQKQC71oGI ZVHagBTNnHFACFs0AOHOKQAXw3FACiTHemA7zs8GkAM3pzQAzcAelACqQaYEsYCfxU7isOM+KLis IkxLcmncCwkgamKxJmmISgAoASgAxQAuKAExQAmKAExQAtABQAooAWgBKAENMBpNACUxCUAIaACk AUAJTAKAENACUAFMRSBqShc4oATNACE0gEpgNoAKQCGgBKACgAoAWgAxQAoFMQuKACgBQaYDgaBB mgBwoAdQAtACgUgFFAxcUALmgAJxSGRvJxSGIsmRwakYnSgBjH0oAcj8YIpgO80LSCxG0gJyKQxA c9TimA1jg8GgQx2LHrQAqigZOi89cUhkhwOM0hgXoENLHtQA5XIGTTATfk4oAF4bFAEh4oAax2kU APQ7hmgCKRvmxmgQkOQ2M0wHTp8ue9IZVzimIQuaLAIOetMCQdKQD15NIZIeFpAQseaYAGzxQAma BDlfFAxc55oAFODQBKZCgzjIoATzFYe9AhCaAEErKaoRegk3rzTJJqYCUAFACgUAFABQAYoATFAB QAYoAKAFoAQ0ANNMBDQIbTASkAUwCgBKAFoASgBDQAmKYgxQBQzUlC5pAJTASkAUAJTASkAlABQI KBhQAtAC4piFFABQAUAFACimAopAPFADgKAHAUAOxQAtAAOaAAtikMhd8cUmOxCzEikALntQMeHI 60hhjIJBoEG3K8HmgBu04oAZt59KAFJwtAEecmmA9R60gHZ7AYpDHx8DmhjAvSsA0Nk0wH7qAGtI aLCuLkgUASxHP4UDH5y59qAGuQRQAFwiAUARFwe1AhUfnpQFyR5A0fvQMqN1pkjcZp6gPUUhi0AT oMDmkMQnd1pAL5OVpgNNuVoEHl4oAY3FAwHAoAB1oAlIytICHlW9qoRITlc0gFHPBpgWLdwDimiW i0DTELTAWgAoAKACgAoAKACgAoAKACgBpoAbTASgAoENoAKACgAoAKYBQISgYYoEJTAzqkoWgAoA SgQUAJQA0mkMKBCd6Bi0CFFABimAtAC0AFABQACgBQKAHgUAPHNADgKAHAUAOxQAmMmgAzjgUhjH OPrSbGkQt6VIxpU/SmIVCq9aBiOAx4pAMUlDg0wHgjORSAmUqaBjWjU5pAR7CcimICmKAGt93igY iHd9RQIexxSGRk800hAOBmgBC9CGNDkmmIkD9qQyeM4FIBC+M4PWgY5DkZNAEUjAseaaENGPU0xD kaMc8mkAGVewosO40yKKYgBJ7UAOAHekOw9WA7Uhj927tSAcoGeaALMZTH3c0ADBD2xQMjZR70CI WjHY0ARkYNMBq8nigCV2wtIZGMPTJHDhCKBiA4OaYiVSOCKALccgZapEskBpiFzQAZoAKACgBaAC gAoAKAAmgBCaAGmmA2gBKBBmgBKYC0AJQAUAFABQAUAJQAUAZlIYoNIBaYhKACgBtIYlACUAFAC9 KAFoELTAKAFFABQAUALQA4CgBwoAkAoAcBSAdimMOlIQnagYE7RSbHYgY5qSiPNAhC/GOtMBh60A OGQRSAkKZFAxm0g0CHKTnmkMlXOcEZFAxdmDmgQ1hjtQMhYYNMQijHNIBrMaEAmQeowaYBuGOKBE THmhBcTOGphceOWFAEwfCn3pNAMds9KAHFyExQMhZsGmK40uc0BccHISgQKxP1osMkAHHFIB44HJ xQMDItFgFEg9KAFMg9KVguKsnoaLBcmWTjrigZKsuO9IY/KkUANbA6YoAhdRg4oERpxk0wAnINAD Yl564oEiZunGKQyE8cVQiSNgB1oAfG5WQelNCZcVs1RI8UALQAUALQAtABQAlAxKAEzQAlACGmIa aAEpiCgBaACgApAFMBKACgBKADNACUAZlIBQaACgAoATNADSaBiGgBKAHDNAC9qQC0wAUCFFAC0A FACigBRQA4DmgB4FADwKBjhxQAbqVwsLmkMjLgUrhYheTPFIYwtxQMYSaYgHNADgPUUAOBA60gHB vQ0hi7h3oAcrqKBkgKkdaQBuHrQAh5WgCtIOcVQhuTQIjJ680IYxjz1piGnjv1piuIetAAfxoAer YFAClsYoGCtzmgBGbJPWkA3FMQ4RFj1oAf5YQDJouA0daBjiygd6QDSxPsKAEHJpoB27HFIBwJNA D1z6UAPGaQxQSKQx6ykcGgLlhNsgxnBpDI5YSvegCsSVODVEiBuDQAm49qAJEfjrSGDLmgBAhGOa YiRDyaAJ45MHGapMlotK2RTEOFAC0AKKAFoAKAENAxDQAhoASmAhoENNACGmIBQAtABQIKBiUAFA CUAJQAmaYCZoAzgCc+1SACgAoAD0oASgY2gQZoAAPWkMUdaBCigYueMYFAC0CCmAtAC0AKKAHAUA OApAPApgPFIY1mxQwQg60hinpzSArO3PFAyNmoAAcmgCQJupANI2jimA3zCKLAHmA9RRYBfMApAN MgJosAokBGKYCeYynjkUrBccsu49OaLBcmSQMKVhjHBNAERYg4piGnnp0pgRn8qBDO9MAPWgQZoG OB4oAXvRqAooGLkdKBCgg96BhvA6GgBrNnNAhu7j3oAUA9aAF+tAC7ucCgByoeppDJBgUgFDAc5o GPEik80hkgCsODQAnlUrgLgr0pgL5rYweRSGRNhuRTEQscCmSC0wJAMCpKQByKBXHBu4oGLu7imI crc8UAW4ZARiqTJZOKYh1AC0AFABmgAoAQ0DG0CCmAhoAaaYhKACgAoELQAlAwoATNACZoAQmgBM 0wEoAz84qRiUCCgBCaAEJoGJQAUAKKAFpAFAh1MAFAC0DFoELQAopDJFpgOA4pCF6UDFoAhZvnpD HbwvNAETTE8ZpARhySKAGuwLUDEBOaAHFyB1pANZ+KAGF8E9KoQgbPFAC56ZoAbnmgBQeeeaAAkq eKAFU5IoAnVse1IBDNhuaLDEJDc96AIzweTTENbigZH3oJDrQMKGAoNMQpOOlIYhagAzQAbsDmmA oJ7ZxQIUnigBB6UAPB2jpzSYwB9qAJECj60MYMxoAQYNIB+MdBSAdnj7tAxVOKQyVJCpyelFgLUZ SUe9IY2SDAyvNAim4IaqAjcChCBRgUNgSdqSGRnrTEAfBoAm5PSgBueaAJEkKkUxF6JwRmmIlFMQ ooAWgBKACgANMBKAEoAQ0ANNMQ2gAoAUUCCgAoGJmgBKYBQA0mgBKAEoAz6kYUAGeKAEJoASgBO/ pSAKYCg0AKKQDqAFxTAKBC0DCkACgB6mgBy0APFAC0AITSAryNhqQyMsWOORQMTHPNAD1XpihgRM ME+ooART3xQAvXigA2EdqYDSjelAhuwjtQAFsdqLgJv9qAuSBgeQORQA0yD05oC4bhkdqBAG59aB iOxoAFY0ALnIpIYZpiGkd6AGigQGgYvQUAJmgBM0AANAgzQA7PFDAQmgBQeaBilj3oAVW4phccGw KQC7x0oGODDpSAejUrDJA1IY8EGgA2g9DSAMsh44pgSJdtjD80AJIVbkUhlZhg0yQByaYDmO0YpD EUfKTQIjP3qoRYhPzbTUspA67WNCExM0wJ7eTacGmhF5TkZqiR9AAKBh2oAKYhDQA2gAzQA0mmIa aAEpiCgBaQBQAlAxKAEoAU47UANNMBtABQBn1IAaAEoASgYUAJQIMc0DHBcUhCgUwHAUALQAUAFA wpCAUwHCgBwpAPFAC5oGNY4pAVpWBagYi0ALjmkBKgHFIZG+OeKAIQeaoBwBz0pASqPWkA/aCaLj EaLjIY0XFYhkiPsadwIhHz6UxAvyN3oAbIuDjPFAAF5AU0xCdG+lICQqCpJPNADRx+PSgBM4oAcx 4HHSgBQRjmgZGw54oQg/nQAY9aYCUgDFMEGKAAigAPWkAYpgIBSAX6U9QFoAVSQOaADkmgY5frik CJQB60hjx06ikA9QRQMeOnWpKJVweG6UAJLBgblORTQiDnoeKYhGpAMHytkUwBjuOTQBITsh+tLq MYmOtUSKrfvM9KQyw4DLuHNIZFxnNMQ5Dg8UCL0LggA1QiwCKAFzTAKYAelAhpoAbQAh4piGk0CE pgJQAUALSASgAoASgYYoAKYDTQAmKAExQBn1ABTATHFAw2nHtQAmKADvQAc0gHjpjFACigBaYBSA KACgAoAWmIUUgHCgY4cUAL2oAhmY4pAV8k9aBgBn2NFxkgYg4NICVeFpMZHKoyTQhEY96YEi4Hak A8OPSkMfkAcUAGRigYhoEROQO1UhEDvntTEKGVhgigA27AT6+tIRGeTnAzTAXJIouMDkcUANzg0X ACTmgQmaAFzQAEUXGJnNAgOKACgBRTAO1ACH1zSAKLgJ9KAFouAp4FMA6GkAtAC9Me9AwDHpQFx4 bB9qBkqv70mMmTBqWMnAzSGSxsAMGgCOaAHlelFwsVym0dKYhmfUUCAAE5xQA1/m4poBvQcUCHLy KAJ4m/KkUI6jPHShMQi8cUwLCHaBQInSYetO4EquDVCHZ7UCFNMBKAGmmIaaAGmmISgAoAKACgAp AFABQMKAExTAMUgExTATFAGbUDDNMQGkMQ56UAIKYCZNAC96QDhQA4GgAzQAtABQAUAFAhRTAcKQ C0DAGkApNAyCegCDOaAAE5oAeCeuaQyWNuOaTGOYZJH5UgZEV/A1Qg5FIB2aAJByv0pDG7qAGu+O M0wIGY+tUSREn1oEHNACls4zQMMEmgQ8DauepoGNOT1oAQigQmDQACgAIouAUAHagBKAF5xTAcPu 9OaAEo2AafekAtACd6AF7daAFzx1pgIORSACTQAAmgBQeaAHggjrQMcvFAydGxUsZOj1IyUMDQMk TcOnIoARwD25oArPGM9aLisQuccdBTQDM5NMQjdaAHIeOtDBEqcCkNCFqBDd5BpgTAlh1oARD82K Yiwsm09aALEb7uaoRLQIKYDTQA00xDDTEJQAUALSAKACgYUAGKAFoASgAoAaaBhQBl5pABNABu46 UgEJpgIKAF6GkAucc0AANACg0ALmgBwoAWgBKACgBR1oAcDQApPFIBoYAUDAv7UgI3YFelAyEjjp TQCZ4oEKDxQMejcUgJAeaQx+0MOOtLYCMqQaYhCMUALG2DRYAmG057GhDIGY+tVYkZu9aLBqN4oE GPagByoSOlAx+0IvvSAQk9OMUwE3gUWAazkmgAyaBCUAL7YosAlABnigAFAxwFAC9aAEIIoATb7U wADikIMcUAFAxOaBC9aEAhoAAaAFoAXHSgZIox3AoGSKaQE0Z561LKRYCZ6cUhki5jOe1ADmKuvo aAKkmVNMRExBoAYeDTENxk0CJEXAyaBjhxk9akYoHNMBjKc0yR6kryaBir8zZ6UxD1wTigCdCU6d KALKOCKoQ6gBDTENNMQwimIKAEoAWkMSgBaAAUALigAoGFAhKBjTQAlAGUTSAXOKQCZ5osGoZyaA FzQAUALQACgBR1oAUUAOFAC0AFACUAKKAHZoAYz84pDEHApAMaXHAosMCcigRGTTshgOV9qAFUUM BQcZpWAeppWAfu5yBiiwwLg9eDSsAmPxFMAwPSgBQAV2npSAie3I9xVCsR+S1PQVmAhxy1ILChTn 5RimOxJ8qrz1pARHJOTRYBjMfpTsITOeKBCdKLDEoELQAtACUWQai0BYUD1oGLmgBwBoCw8LQMRh 7UCG4xRYLCEGiwCbeelAWF2nGcUBYaQQelAAfWgBPwoATPtQIUNx0pDJA2R9KYyQEUgHDrmgCxHK w4PNSUWA4IpDGu4HGKAK8h5poRCRznFMQgyRQA9UwMmkFgPJ4osAc0DFB7UxDgMUhgx4poQIMc0A OU/NQBLk9KYiWBjTQiwDTAM0wGmmSJQAlMQUAFAxKQCigB1AwoASgAoAQ0ANJoATNAzKOQKQg5xn NABQIKBiikIWgYGgA5zQAtAC0AOFAC0AJQAtABQAtAEePekMQ9MUhkTDmmAuSBRYQ3NAD144pMYv Q0ABGeaAGjimxDgc0hjsfjSATkHg0wHKzdxSGSggjgYpAO6D2pDG7kPYimAxoyTwQaLiEZdowBye tO4EZAHXmgRHjOaYDHGO9MQ0UxAaQBQAu3A5pgFIAwaAFAoGHfFAXAcUASDigBVbJ9qBjmHGaAGn gc0CADii4x2OKQC8CgCJ1welMQw8HpQAYzQAmPrmgQYNAxRQA4UATI3Y0h3JM+nNIYqyY9aLBcf5 mRSHcYxBoAYSAaYhAxB6UALuJNAXHR/KwJGcdjQAo5NIBP46YDj1pDFxigQlMAXrQBLupiJoxjFN CLAPFUAUCDFMBDQISmAUAJSAKAFFABQMKACgBM0ANJoAaTQAUAZX4VIBTAKBC0DF6UALSAKAFFAC 0ALQAooAWgAoAKADp1oACaQDM9hSGI1AyNvemIRulFxjO1Mm4o6cUtBjwc8UDDmgBu7jpSAM56Uw HbiO9IBQ5oAcCfQUhjgxAosAvmEdTSC4eYKYXHBsKTQBA8jHoadhXIycnqaYh3RD60DIv4qYgPJ4 pCE74oGPUDrQJAQSaYxCOaQCgUAOxgUAMIxQAZp3AWlcABNMB2eaQCk8YpgOWkMkUjFJjEOA1AhJ BkZFNAQGmSC9cGkMGUg0AID60xC4x05pDFBoAcKBkqMRSYDiueRSGNB5wcimITr2oAUDvSGO20AG MnAoAccAUgEzimAi9M+tAEi8mkMGFCENINMAGc0APHHNAE8TgmqQiwDVCFzQAUxBQAUAJTEJQAUh gKAFoAKAENADSaAGk5oASgAoAy6kAzQAUAKPSgBaYC0gD+dACigBwoAXFAC0AJQAtACUAFADSe1I BqnvSKGseaEIbnimAhHFFxje9AhOhoCw7NFwFDetIEGPagYmD2FO4gII9aAEBNADgx9zSAeAe/FA w3ADAoAaOTQA6R+iikA00wBF5/nRcLCH7xoAQrjNFxWGfSncQ5VyaGxj2GBwMUhiYxTuAqr7UXAf t46UrhYaelFwsNK/hRcBu2ncQBTRcLBgigLCgEc449aGwFz7UXAcppMY4NigBCTQAmecUAMbr0oA TGD707iJgoeP3FK4yBhg0CFHtTAcAfSkAox3oGSqvGBRcB65H0pDAgUgAAY9KdwsKSMdaQDSemKY Bz9KAEOemKQChfWncAJoAcvApDFJyKAGFiKYhymkA7kCgB0Jw9VcC2pGRzTuIk6VQhKYhaACgAoA TFABigAxQAUABoAQ0ANoATFABQAUAZRFSAYoAMEUAKBQAooAO9ADsUAAoAcKAFoAKACgAoAKAEpA RucUDEB+X3pDGMeaaAQGgQrHmlYY2gQlMBR9KADHFADgKQxdpzQAYJ60gDZjrTAM4PAxQAZ55NFg BsAcGgQ1OpNMAzz6mlsMcPpQBJjCfWkMjxincQnBQjuKQDQtMLEijC5pMBOSM0xhjHNFxDkHNFxj 2FIBjAmi4BsouAbcUXAQjjIp3AbzQIP4QM4ouKwlMBy0hikc0AKM5xQAbfSgBr9KAGjJpgSxEhsd qlghJk7gUXBkHINMQ9XIoAeGzQMeMdqQx2fakAEZ9aYBsouAoXHakA7bntQABTQA7YAMtRcZGxJP tQIbyTTEKWxxmgY5fumkMQimIVe1ICQ8LQMEpiLEZ5qkInzmqEJTAUUCFoAMUALigAxQAmKBjTQA hoEH4UDEoASgQGgBpoAzMYqQDFAC4oAKACgBRQAuKAFFADqACgAoASgAoAKAEpAQyH5uKBiHgCkM SgBDx2piAGkAY4oGHTpRcQnNAADQMeCaAHcnqaACkAmc+1MBpPPFIBCB3POelMQmMnmgB6jsBQMc sZ3ZouBLsCJ71NygA45oAY60xDQmRmi4DgmeKLjFcYAUUkwAJ0FMBQmTSuFh5XApXHYQrk0wDZmi 4WHbOKQWGkU7gJtxyaAIjVITAR5PSi4hNvPrRcB6rSuA4JSuMXb1p3CwqphaQ7DGTmnckaFwadxD 1TDdKVxkjAHg9DSuMqyIVOKq5IwjFAg7cUDHqSO9AEgbJpWGPDcc0rDuPU570gHAgdxQMUuv1oAa ZcfdFOwrjCxY8miwDS3YUCG96YhyoSaLjJcYFIYjdKAEUUxEj4IpDFQYNAE6gDFNCJlFWSO4pgKP pQAuKBC4oGGKAA0wGmgBpoAQ0AJigBKAEJoENJoGITmgRnGpAKAEFAC0AKKAFFACjpQAUALQAUAG aAA0AB4oAbnmgBrNgcUAQZJNIYpzigAB4oGIc0CDgMcHIoAXNAC4oGG3vRcAx60CsL3FIYoH4UAG ffigBpyx9qAAgj60ANxzzTFYfzxSGPxgYouCJY1yeelSykhzDc2ewoGIBk5ouKw1xzQAqr2oYD0X kmkMjIJegB6rzRcCQR8fWkOwrpRcLDSvQUXCw9U+WgYFMCi4DCuBzTAj78jNFyRgXJp3CxIFApDs MVMtTuKxJs20rjsKqZouA/ysA0BYXZhKQyILkGmKw3ZzTuKw9UpXHYVk+Qe1FwsMZQy+4p3JsVnT FO4rDcHFO4rCDimA9STnFIZIG9aQDhigBRxSGKMUAKADQINlAw8v6UCAJzTuA9YzmkMUj2oAay4x QA0YFADgc0AOUZIoEWM4FMY+M8VaJZIKYh1AC0wFoEFIYhpgNNADaACgBKAGmgQ00AJQAmKAM81I CUAH6UALQAUAKKAFoAWgAoATODkHmgBM0AL2oACaAGjpQBFIw9aAI85oAUe5pDAH8aAFPB5NIBpF MBAaBDwcUh3FGTTAcB9KBh04pAGQDyaAGlsdKAFB4zQAnJJI60xMEJJ5oBEoA71JQ5QS1AFhVwMV JQOo6CkAhXAxTGNK80CADmgZMq/KaQDAlMB8a5NICYLyKBiOnFADCuAKAJFHBoAZtyT7UhjHGelM RHtoAAmD0oAcUwKAFhTgmgBWXL0ASIlAyQoNtAhvl4XFAyNY+tAAI+TmkA0L81MCVk+U0hEASmBF LH+VO5LRCVxVEjCKAG9DTESA8UAPU0hjwDSGOHA6UALz2WgA+Y+1ADgDjnFIBwH4UABOKAI2znrT AMdzQA3GaAHCgBy8UASbvkJoAdFJVollgHiqEOzTAUGkA6mAlACGgBDQAlACUAIaBDTQA0igAxQA AUAZtSAUAGKLgFAC44oAXFAC0AFACUAGKAEoAWmAhpAMyQPegZA3U5pXAbii4DuwoAUc/WlcBT24 oGJ2p3EJxQAoFADweOBSuMU8UhiNwKYhvXigBcBTSAGPGKYDMUXESxKMYouUSsOMCpGSRDHPahsC cdM1JQ0DLUAKeaAGkc0wFC0ATqnyGkBHtyfpQMkiUUxDwMNSGOcdKQEbgcUDHqOKAGyLzx3oAAgx TAb5Y9KQCFfm6UAOZMJmmARLtj+poAUJlicUATpGNtAC7c8UAGwYwaAIxHg0gECfN0oGRumHoAlI BXpQIr7dr0AI8eR7UxFZkp3FYjKe1MkTYBRcBCuBTuIAxFAD1YemKQ7kg55oAdu9zSAUZILdh70A JmgAyaAE3evNMA2n8KAF25pABXbTAaDzQA7d2oAcW+XFIBqNtNWhFuJ81SETUxCigBaYBQAlACUA FADTQAhoEJigAxQAmKAFxQBld6kANAgoGL+NADhQAUAFAAaAEoASmAuKACgAPFAET8E5pAQkZNK4 MSgAB9qAFBoAcDngigYhGDSATOKYABRcCRaTYw3YOKAEZqBDQ3NAC9TSGI9MBRnNMViePnpUspEh HNIY9fakMlPSkMVVwtABigY3BzQBJjpQInRflP0oGRAcmgBY+GIoAkx81ADiM8UgGOtAxYxkGmA8 LlaBAFxmkMNvNAEbJjmgBzLmOmAIvyAUAPjXJoAnVOKQw28igBrCgBqDPWgQm3mgY2VelACY4xQI jkTnNAC7PloAryxY5FAiJkpiE2U7hYYyEU7k2I8DuKYg2+hoAAWFAC5J70AKDSGSA0hi5zQAoHot AhwwB81Aw3AAmgRCxJ60wEyBQIVcZoAUmhDEqiS3brjmqQFkCmIcBQAUAFMBKAEoAKAExSAKYCYo EGKADFAC4oAxu9SAZoEGfoaBiigB4B25oEAoGGcdKYCZoAAaBBigYo6UALQAYoAhmHFJgQcZoAQ0 gCgBAaAHBu2aBjs54NIBuKYDwDQMcegA4pAMwc0XENbrTuADgUAPANA0IwwaBBH9aTGiePipZRNj NIY5BSGS9aBju2KAFxQA0A0APxxQBLH2pANAwxpgIeGoAcD81ADwSDSGKwyKAGEYPFAEq/doAFoA cBQMQpmgBuPlINAhIgBnmgCeNeaYEyjigYhGCaQDXGKAGIKAF20ANkXNADMfLQAMuY6BCRrmPmgB jJxQBE0dMRCU2mgBMA0CI2j5p3ER7CO1MQAUAGB3oAAMdKAHjmkMeF/CgAyq980AIfm5J4piGO4A wtAERYmmIBQIcDikMWmAqctTAvW5HSmhMsgVQhcUAJQAUAIRTASgApAIRQAYoAMUCCgApgJQBiZq QF7e9AB1FAC9O9MBQTikAoNMBc8UAAoAAKYDgKBCgUDDFIBKAI5R8tJgVW60hhQIKAG0DFoAX8aA HA0AOzxyaBi55HrQAMeaQEZ570xCdBQBKh7UhiNnNAAvehjRNGeKljJlPakMkXpSKJMdKQxe9Ah4 60wExzQADOaAH9BxSAM/MD60AOZcj3pgNB6UDJAaQDscYoAaetADwCKAFxzQA4HmgY8c0AMkTvQB HGBuxQIsRAZNAEvtQMCKAEcfLQBGoxQA4LxQAMOKAGbeKADbxQA1FxkUAIU5NAhjJxTEQMuDQBE6 4PtQA2gQ0tjqKAEyoPSmIRmX0oAYxz0OKAAc96BCjI+lMYfJ34oEIx9DxQAzA+lMQ3AB60ABPFAC DOfSmIVm7CgB0ZoAvWgy1NAy8BVCAigBMUAJigBMUAJigAoASgAoEFACUAFMBKAMOpAWgBaYC9qQ AKYCjrQAoFAC4oAUCmIfxigBcUDFxQIY3BpDInPBpAVf4qQCUhhjJpgKR+dACHrSAUCmIBQMUdRS C9hTTARjkUgENACUASRnBoY0OcdxSAEXHWhjJVqRkooKJl4pDJKQwxzQA8c0AOPSgQ1snnNAxf4a AEzxigCRDxQAjLg5FACg0ASA9KADHJoAkX5hQMcFI4oAMZoAco7UAO28UAQFcMcUCHx5FAybPNAD 6AGt0zQAgXIoAcF4oAQigBhFAC4oAaBhqABx3oAaV4oEQutMRXcYoAjK0CGFcjFAEZHFMQ0DPemI QjB9qAG0xDgCV680hjCp6UxCrkH2oEIeT6UDGkYOaBAc49KAEpgJQBKlAF+yHBpoRfAwKoAxQAmK AGkUAJigBpoAKADFAgxQAYoASgBKAEpgYm0EVIBgA0AGKAFH0pgOFAC4oAcBigBcUAKBTAcBQIcB QAtACMKQyrOMAkVIFU9TSGFABnmmAUAKaAAcZpAJ70wF9OKACkAnUUwE/CgBcHGaBAOtIZKpyMGk 9ykOxzQMkUVIyVaQyVeKBkq9KQxx6UAKlADyMrQAygAGVOPWgBGGDQA9M9qAJhzQA0x56cGgBoyr YIoAmUbuRQMcnWgCQUhi7aAHAUwHbflpARunegQi9aYDyO4oAetAA/AoAFGBmgBwoACOKAGkUAAG aAGsMEGgAOCKBCEUAROMZoAquO1MRCeKAG96QDMA5piGbaYgxTEMYAUANzzxTEG7BoC4ZGaQBimA 3BFADH596YhKEA4A0ASIKANGzGFFUhF0dKYC0AJQA00AIaAG0CExQAuKADFABQA00DEIoEFAGF7U gF78UAGPWmA4CgBwFADgKAHAUwFxQAYpCHCmA4UALQA1jSAqzelIZXwuTuzntikA2mACkACgAxQA UAITmgYUCF7UAJQMO9AC54xn8KQgHWmMeppDRMozSGSheKkoeo7UDRIvvUjJBxQMdQAooAlXpQA1 lwaAFVdwoAVlx1oAReDQBKOKBjsc5oAdgMORzQAoXB4oAMENxQBIp55oAkAzQMXFADscUCGleKQE YXn3pgPAz1GKAHIOKAFI4oAVfu4oABQA4jigBhGKAGj71ADiKAGlcHigBuOKAI3FAivIMdqAK8gB FAiHNAAeaYhmcUCGk81QhCQaAGFcUxCUAAFADulADTQIYelMBMetABnnFAE0YzTA0rQcU0ItimAU AIaAEoAQ0AJigAxSAXFAhMUAIaAEpgJQAmKAMMCgBQMUgHAUAOxTAUUAOFAhwAx70wHYoATFAC0A L0oAUmgBrUgKs33u1IZXbrSAbQAtAAM0DDtQITNACfzoGFAgGcUAAoAKACgBe9Ax6dRSGi1EtSyk WFTipKAx80hihWHamA9QaQx6rQA8LQA4CgCQLkUANClDQA/AYUDG+XQAAEGgBwJ9KQDs5oAeKYDw M0DHAUASAYoEKBQMdigQmKAI3GORSAcrZFMB460AOx2pgNpAJ0NAD80wI3HBpAM5IoAdnigB2OKB DAOcGgBki0DK7g96BFaUEUAVzjrTENLYoEJkEUANOKYhDimITNACcetAg6UAIWFMBuM0CFwaAGYp gKAM0ASIecUCNKA7QKoC0KYC0AJQAlABQAYoAMUgCgQhoAaaAEpgFABigDDxSAWgBRQAtMBRQIeB QMeBQAtABQISmAuaAEpABoArzjvSY0VSaVxiUAFAAKAAj86BCUhjRTELSGApgJQIWkAUwFHWkMkU ZIoGXYh0qGUi0gpFD9tAxwSgBwjoGOEdIBwjpgL5dIB6rigYuzNADSmKAFC0gFCUxjxH7UCF8qgB dlAxQMcUAOAoAcKBCgc0AOoACKAGMuQRQBCpKnBpATLyPemA5TQApFADTQA4dKAEYZFAEadxQAdK AHD7tAhB1oAHXAoGV3FAiCRM0AVnTBoEQOB0xTER9KYhpOO1MBuaCRaLgAxmgALA0wE4oEH0oADw KBiEcUCEGcEjtVCFRuRQBoQvkimBdQ5FMB1ABQAYoAKACgQuKQCGgBpoASmAmKAACgBQKAMIUhCi gBaYwoAcKAHigBwoELmgBM0wEzQAZoAM0AITSAa3IxSGVJE2tx0pARdOtAC0AJQAHn2oADweM496 AG0wFpAFACdKACgBR0oAUdaAJY8kikUi9CKgtFpaRQ8daAHrQBKooGOAoAcBSAXFAChaBjtpoAXZ kUAHl0AOCUAPVKYDwlACGPikAwpQAmKAHCgBc0AANADjQA0jFAEMic5pDFR6YiVeuaAH0ANYYoAR TxigB2OMUAREbXoAUr3FACIcEigB2MGgQHJpgQsMmkBEy5oAryJjNMRUkpiKzNg0ybjS49aLBcTc KYhu/FAhN+famAoOKBChs9KBjuce1ACFgKAG5JoAQ9KYgXORQBftxmP3pgXYGytAE1MBcUAFAgoA XFABQA00ANNACYoEFABQAtAzBpALTAKAFFADhQAoNADs0CFJoGNJoEGaAAmgBM0AGaBi0gIJxx0p DKxoEHagYYoAac0BYKAENAgoGHagAoABmgQvNACjk0DRPCM1LKRfhHy1JSLC0ih4oGSIKBEoFIY4 UAOAoAUCgY8CgBwFACgYoAcBQA4CmA4CgB2KBBigBrL6UDGlaAG7SKQBg0DDac0WAUAigBQPWgBj pjpQAwpSAcFNMB6nHrQIVhkUAMHWgB4oAHUMvvQBGjY4NAC8E8UAL1HvQApoAiYYJoAjIpgQSLxQ SUZxgUxFJzke9UQQt19KaENyRTEJk0DAHmgQ7OKAHKaQwZie9ADec0wJABikIQ4oARfrTAu274FA y7bH5M0xFkGmAtAhaACgAoAKAENADTQISgBKAFFAC0AYAFAC9KAAUDFFACigQtAC5oGGaBCUALQA uKADFACkdBmgYmKQEcsZfgUDIHh2nk0hERGKAE6UAB5HtQMQDJxx+NAgIIOOOKBiUCCgA4oGFIBR TEKvWgZbgWpZSL0YwKgtEq0DJFFAEqigCVRSGOA4oAcBTAUCkMeKAHYxTAWgBaAHLxSAfTAWgQUA LigAxQAbR6UAN2igYbaAE20gDFABjigBpWgYbOKBDgtMBQKQCNGDRYBuwjigACmmAGIHmkAgQDtT AUpmgQ0Ag4NIYjrxTERMKBkTDIoEUblSAaCWZcvFWiGQE561RImaAEzQAA4oAXNADgcjGaLgH0pA L0GTTYCqeM0hiMePemAqdcmgROj8gZoA0rdgVGOlMCypyaYElAgoAWgBKYhKAA0ANNACUgCgBRQA UAYOKAFxQAdKACgYUCFoAWgAoAKAHAUALigBQKAFxigAxikMiZyDxSGMf5hyKBFdhk9MGmMbtJPA xSEIybQOhoATOOnWgBv60ABHNABzzQAUXAB3zQACgB6g5ouMu246VDLRcWpLJFoAlWgCVKAJVoGO oAUdaQxwoAeKYDsUAGOaAFpAKDimA7NIBc0AKDTAXNADqBBQAUAFACUDDFACYoAMUgFxTAXFAgxQ AuKYhMUhhigAxQAYoATFACFKAI2WgCJhQBEwoArTplTQJmLcIQxq0ZsqsKokbk5oEFAAOKAFxQMX NACgmgA/GgCTBC4NADDyaLgKB7UATwoWYZoA0YiEXApgWo+nvTESigBaACgBKADFAhDQAlACYoAM UAGKADFAGFTAWgBKQBQMUUCFoAXFMAAoAXFIBwFACgUAPAoAMUDGvxSYEAGWNIYrDFAEZIHXFAiO TBXjrQBA3agY2gQGgAxQAvFAxKBAegxSGKBzTAliUk0hovxLgCoZoiwo4pDJFoAkWgCVKBkooAeD igBRSAcKYx6CgRIBQAoFACEUDEIpAFAwzQA4GgBynNAhwpiCgBaBhQIDQAlAwpAFAC0xC5oELTAK AE3UgG7xQMN49aADeKAHAg0CCgBrDigZA45oAiZaAIZV4IoAxb1drVSIkUT1wDVmbGMMHrQAlAgF IYtMBe9ADwmVHOT6UAPWPHJpDFZs0CGYOeeKYE8cfy5PSgCaEYPAoAsIpJyeKALKOFIGaYiwKYDq AEoAMUAJQAUAJimIMUgFxQMTFACYoAwqYgoAKACgBaAFFADgB3oAUCgBcUAKBzSAcBQA4CgApDI5 Pu0hkI4zQBHIc4wcUARlcDrmgBmcUAMfrQKw2gBDQAuMjOOBQAnagAzQMWgBV5oAswJzUtlIvIvF QaIlWgB4xQBItAEq9KAH7gBQMb5p9KQCiQ0wHLNQBIs1AEi3ApAPEwoAPOBoGHmDFABuzQAZoGGa QD1NMCQUxBSAUUwFoEFAxKAEJxSATeBQAxpaBjDNigLCG4NAhfPJ70AJ5uaAANmgB3amIUCgBVJB oAkElAC5yKAInHNAETUAROtAGTqKd6pEMy3GCRVkEZ+vNBInWgYqjPagBTQAqigCQNjtzSGIzHpT AFHHNAidEz2oAlUE/KBxSGTxqEHPFMQ9CZDhenrQBajiAFMRYAxTAKACgAoASgAoAMUALigAxQAh oAQ0AYBBHWmIKACgAoAUUAPAoAcBQA4CgBQKAFxigBcUhhQAjdKQEMmQMGkMYzACgCF3z2oAiJz3 oAaR7UAIRjjigBvegQhoAUnjGeKAEHSgAoAXGKAHIMnFAy9AvFQy0WkqSyQUAKKAJF60ASbgooAY Xz0oAcMmgB4WgBCpFACBiOtAC76Qxd5HSgA8w5oAcsh6UDJFkoGPD0gHhs0ASLQBIppgOoEKKYBQ AHigBpbFICNmzQMiZjmkAzJJpgNY0gGHNMQozQBIqse1AE6REUxEoj4oELsxQMQx96AGkUAIHI60 AK3NAEZFMCJ6QGdfrlKZLMWTgkVaM2RfSmIUAMOmDQAY54NADynygjmgQLx0FAxwUnk8fSgBSAO1 ADlwT0oAlU44HFIZYiGBk0ATJC0nLcL6U7CJhHsPy9KYE6HIoESCmAtABQAlABjigAoAKAFoASgB KAEoAwCSetMQUAFABQAooAeKAJBQA7FACigBw96QCYoGFACNSArSt2FIZDuGaAI3bJ4oAaF70ANx ii4CGgBD196BDcUAHegBRQAlAwFAiWPrQNF+EcVmzRFhaRQ/tQAooAfnAoAbyxoAkRfagCyiCgZI EBoAd5YI6UARND6UARmIjtQAmw0gFCUALsoGLgigBQcUAPDUhkqNQBOtMB4oEOApiFxQA00DI2pD IzSAZtpgG2gBNlAgCCgCRVUUCJFKigB4IpgOzQIXNAAaAGkcUDIWWgABoAQ0wImFICjejKGmJmFO vzVaMmRcYPHNMQ2gQvJ7UAOwSvtQMeqgY5oAeCOTQA5UDDpQA4LgUgHKvrQMtQMq4J5piLgbcOKA JFGBTECjBoAlHSmAtABQAlABQIKBiZoAM0AGaAEoEFMDn6ACgBaACgBRQA4UASA0ASA0ALQAtABS GJQAhHFAFZ0IYkVIyvJx04zQAeUTTAQqQPYUgGUDGN6UXEJQISgAoAQUAFACjFAySPg0DRfh6VDL RZXpUlDx0oABQAuMmgCVEoAmUAUDJVIpAPDCgBd49aADzF6ZFADGkT1FADS6mgYAqfSgBwAoACtA EbDFIBAaBksbUAWozTAmFMkWgBaBDGoKRE1IYw0AGKBATigCJ5QvSgCMyMfagCNp9vVqBDftYB6m mFx6XilgM4oETC59GzRYdyRbsdDQBOsoYcGgB+RQA080AMxQAhoAjIpgUrwfIaBMw5x8xqkZsrEe lUSJwKADvQA9WHfii4DiwxmgBA5zxQBMrACkMerAmgCzGEYUAPaLaMgUxE1q/amBbxQIcBTAdigA FABQIKACgYlACGgQlABQAlMBaAOfoABQAUALQAtACg0ASCgB4oAcKAFpAFAxaADFAEci8UgKT8PS GOFACSHtQBCRRqFyM+tADeKBBTADSAKNgCgAFIZInWmCL0HIqGaItrUlD6ACgB6DNAEgOKAHBsUh g0wQcmgCB7v0p2Fcha7b+9TsK5GbhjzmiwXHLO54p2FclWVgfmFKw7kqsCODg0rDuSLKVOGpDLCu GFACN7UDIjwaAJI2pDLcRpgWF6UyRwpiFxQAxqQ0RPSGRk0AGeKAIZX7CgCHIHuaAI5A+MjinYTZ CIHkztBOKdiGyGFPMlKHgiqSE2SzWxixQ1YExsaucgHpSsO5IsxX5WGPekMmjuCpyDxSaKLsVwHX rSGShqBC9aYCGgBjCgCpcjKGgGYVwvzGrRmyvjFUQIVGKAAJxSGAQ8UXCwu0qPamAhXFAh6jNAXJ NmBk0AAkKEc0AWkuCVw1AE9oRyaYFsMB3pATgcUxCjpQAUwA0CEoASgAoAKAEoASgAoAKYHP0ALQ AUAFAAKAHigB4oAcKAHUhi5oAM0AKKAFoAR+lIZQkUE/jSAZuK8EUANZs4oAYxwaNQGHFABj8KBB j2pDA0wDFADaAFFAEiYpDRftxwKllotrUlDqAHCgB2cUAG+kMZJKEFAFR5d/JNVYm4IhkPXimIV4 sOBTJJY403rv+7QtwIpjGtwPKPFMRrGNGtwcDOKGCEhthJGfUVJaIpEKHDCpKCN9px2oGT7sikMi agQqHFAy3C3SgZcXpTRI8UyRTQBG1IpETUDIyKQDHyBxSGQP1pgOijycmmSOuEwgpiZWLvGp2d6C SlGXS43kZq0yWi68vmKAVxSbBIW2jyxOKEMdPCCOlSy7FN4mT6UATW780mNF9GPrSGTKc0xCkUAM YUAV5hlTQBiXSYc1SIZAI89BTuTYkW2LY4xSbKUST7PtXpSuOwzZz0pXHYSaPagpomSK5WrIFVgt AEyFG70ANlRV6HNMQ6GFpOlAFuNDFxmgCzEhPJpgWlIIoEPoADTAaaAEoEFABQAUAFACGgBKAEoA wqYBSAKAEoAUCmA8UgHCgBwoGGaAFP1oAUGgBRQA4UgAjIoApzJtf2pARvigZE2KAGEZFADKBAOa ALMceY8iobNEhDGD2NCYWDyM9Kdxcox4GA6UXFykWKYiRByKBl+3HFQy0WlpFD8UgHAUwA8UhjGO BmgCrKSxpoTEjjz1qhJFqKPFIdhZo84YdqZLQm0MtAiEW43UXCxdjRtuOaB2L9tiOPmi40hk+xxU jsUiuG9qCrE8a8cUgFZeKAIxwaBFmE80DLsZ4oESg0xAaYhjUikM70DFKA0MRHIgVfU1JRWZDnIF MBV3A0AOcllwaYrEJhOKCbEX2fnmmKxIbY49KYWJIwIhilcdgJ3HgZpDInjJoAQQAcgUhliNaBlh BigQ4jigQxhTAgkHFAzIvEw5pkMhiXmgaLSlVHJpDAsCPWkBCwJPAxQMhmBHJqkQyL5SeDirMxrL QIavBoAkJ3EAUAX4BtQBR+NMCbYqjcxoAeoaQc/KtMQsJ2ylR0oAtUAIaYCUAJQAUALQIKAEoASg BKACgDBoAKACmAUgCmAuaQDgaBig0ALmgBc0AKDQA4GgBwNADhSAilXNIZUlXHtQAwrigBjLhcdq dwIWFK4hQBRcZetlzFxWcjWI9YwalFWHiPFMQhTd14pAVJoNpJB4q0yGhiLzTuIvwDAqWWiwtIZK BQA7bikAFaBjGWgCIxc0AKI/SmA9Yz60xEgB70ASKoxytAEioMfdoCxKqgdqBj8CkMYy0gE8lT1o AAgXpSARyMUAQjrTETxdaBl2M8UASA0yRaAGmgY3oaAHA0gEJHegCJtp7UDGEelAxAtAhdmcUwEM IPrQId5WQM5pgL5I9KADywO1IBPLFAxwiFIBfKoAeq4oAUigQxhTAgkFAzOvF5zQSQRR7unWgCdb Y9TQMeYcD0pAQ7MtigCvfYQAAVSJkUlIzVmYuMnAoEKIwRQMsW6KH5piNDKotADY0MjZft0FCAnY hFoAjhB3FvWmIsigAoASmAUAFAgoGFAgoASgAxQAYoAwKYBSAKAEpgFACg0gFBoGOFACjrQAtACg 0CHCgBwoAeKBjW5pAV5o8c0gITzTAa3C0AVm6UAAFIZesj8pWs5GsC2qVJZII8imIikiZaQEDJkc 00TYhCbWqrk2LUfApMpFhaQyVaQEgFAx20UAGzigBpjoAQJimA9UoAkCCgCRVFADwBigBcii4wJp AMNADeRQA0sRQBESWOBQIBQBPFxQMtp0oAlFMQtAhppDEPSmAmaBjTk0AIUyKQCCM0WC4oU0wFwR 2pAKDTAdmgQvWgAxmgA20ALigBcUAJSADTAjNAyJxQBSuVytAirDlJKYi6JfakMYd0h5PFIBnl/O AOlA0VNVXaFxTRMtjKzg1oZEkb4amBKGG4EH8KQiRT83BoGXYBuI3GmInK7TkGgBdpYc0wJEXFAD wMUCFoASgBMUAGKYC4oAMUCCgBMUAFABQBz9ACUAJmgAoAWgBRQAooGOFAC0ALQAooAcKBCigB4N AwNADHGRSAqMNrUgEfGKYFZhQAlKwyxaNtlFS0XE1AOlZmpYjFMQ51UrQIoSja1IZXcfPVEMnSkU idaBkqikBItAEiigB+KADbQAmzmgB4SgBQhoAdsoGKEzTAURmgQpSgBpWgYwigCNzxQIjxikAneg ZPFSGW0piJBQA4UxDTSGAoAQimIAKADFADgKYC4oELgUAJsoC4baQXFxQFwxTAMUAGKACkAlAxpo GNNAET0AVpxkUCKQG16ALC4PWgCaNN59qQx0kYBGKGNGbqibse1UiJGM681ZkC9aYicLnoKAJ4l5 oAtodvOKAJ1JagCZF4pgSAcUCFoASgAoAKACgBcUAFMBKADFACYoAMUCOePFACUAJQAo+lAC0AAo GOFACgUAOxQA4CgBQKAFxQAUCFBxQAuaAGtxSGQyLuGe9AEDYwaAIZFIANADMcUAPizvGKllI2Y+ VWszZFheBQAM2KQFadlYUXCxTx8/NUSywlIaJloGTLQA8GkBItAEi0DJFXNAh4SmA4JQA4KKAF20 AJigAoASgBhoAjegCFutIY00AIKQE0VAy2nSmIkFADqYhppDEoAdQIKYC0AKKYgoAWmIWgApAFAB QAUAIaAEpDEoGNNAxhoAjagCGQZoEVjHz0pDHpHzTAtRjApALIvFMDJ1NsSAU0TIyZQCeKsyEVee KYjRtYRs5XmgCb7OAd3Q0ATogxnFAEmB0FAEqjApgOoAQ0AIaBCUAFMBaADNAC5oASgQtAwoAKAO cIoEJQAAUALigAAoGOxQAuKAFAoAcBSAeBQAoFMAoAQ0AJmgQA0AK3IoAiNIYxo9woArPG3T0oAi oAkiHzCkUjZi6D6VkbIm6CkMjc0AQOM0hkboQRVEMkSgETLQMkXpQA8daQEq0ASJQMmWgRIozTAf igBcUAGKAEoAQ0ANNAER4pDI2NAEZoAaaAG96QyaI8igC5GcimIkFADhTENPWgYUgAUALTEFAC0C FpgLQAtAgoAKACgAoASgAoGNNIYhoAYaBkbUARMKBDCtIYq0DJo+tACy9qYjE1b/AFtNESMvoeat GZPBEXIpiNSIBFAoAnCcc0AR7udooAnRe9MB9IBaYCUAIaACgQlABTAWgQUDFoAKAFFABigDnM9j QA3FAC4oAXFAC4oAWgBRSAcBQAooAcKAFpgGaQCGmA2gQA0AO7UARuO9AAmCMUAJJH3FAFaSPIyO tIY2NSHAIpMpGxD2rM2Q9jipGMJoAYF3GgBZk+SmIjWgRKtAyVaAJF60ASgUhkiigCVaAJVpiH0A LQAZoAQmkMaTTAY1ICNqAIzQAw0AMNIBvegZInWmBbiNAE45piHUCEoGJSAKAFoEFMBRQAtMQtAg oAKAFoAKACmAUgEoGIaAENIYw0DI2oAYq5NMQ5kxSAjIpFEkdMQ6TtQIwNTOZiKaJkZ4Hze9aGRo 2oygA4pgXFAUeppAKzE9BQA1BhqALI6UwFpALTAKAENABQISmAtABQIKBiigAoAMUAKKAOapAKKA CgBaAFoAKAHCgBRQA7NAC0AGaAEzTAM0ANoEAoAUUAFADGBU7hQA9WDCgBjx9xSsMgJwwpMaNKE4 2n2rM3RI9SMjPWgZJGtMkWdcJQIrjigB60DJVoAlTrSAmWgY9eKAJFoAlWmA8UALQAUAN70gEJpg MY0gIzQMYaAGGgCMmgQgoGSoOaALMdAydTTEOoJEpDCgAFACigBRTELQIKYCigQtABQAUwCgAoAS kAUDEoAQ0hkZoGMagAj+9TESPjFJgiA0ih6CgTElPP0piOfvm3TPzVIiRS6tVGZftBtAzTAuBl+t AEmSR0xTAUDkUASjrigBwFAC0AFIBKYBigBKBBQAYpgLigAxQAtABQAtAHM0gFoAKADNABQAooAU UAOBoAUGgBwoAWgBDQAlAgpgGKAFAoAMc0AGKAGNH3WgBpZh1FAEDnL9KllI0YDmMVmzaJMfmGak oYRjmgZLGRxTJJJhkCgRUYYagBVoAlWgCVOtAyUGkMkU0ASLQBIppgPBoAdQAUANNADTSAYaBjT1 oAYaAInOKAIieaBCrzQBPGKCiwooETKKYDqCRDQMQmkA3NADg1ADwaYhaYhQKACmIWgAoAKAFoAS gBKACkMSgBKQxjUDI2oAE4NMQrNSGRqCaQyXGBTEQynEbGgDm7lsyN9atIykRRoWbimQXouODwaY FqMZFAEwBAoAcpOelAD0HOTTAkoAKQAaYCUAFABQAYoELigAxTAWkAUAJQAtMDmaQBQAZoAM0AFA C0AKKQCigY4GmIcDigBc0xAKACgAxQACgB1ABigAxQAuKAI5BxxQBVlB3ZNIaLlm+VxWcjaJaU9q ksVlpAMXKmgCfeGTHemIryDmgQg4oAkSgCZeKBkimkMkWgCRelMB60ASKaAHZoAWgBKAGmgBppAM Y0DInbFAFZ2yaAGZoEPTrQMtxCgCwooAkApiHYoEIaBjDSAbQMDQAgcg0ATK2RTuS0PBpiFpiCgA oAWgQlAwoASkAUDEoAQ0hkbUDGNQAIOaBEhQUDEGFFAEbNuNAFa+k2QkCgDnpDljVoxZPbrgdKok kLZcYoAtQAk9OKALIU0ASKmOtMB9ABSAKACmAUgCmAUAFADqBBQMKBCUAFABigDmKACgAzQACgBR QAvekAtAwFAhwpgOFACimIKAFoAWgAoAcBQAoHFABimAYoAQrSAqzLupDQtqdjgVDRpFmhjIyKg1 JEbjBpAG0GmICuBSAiemDGdDQIlU0ASrQMkHWkMlWmA8GgCRaAHA0AOB5oAXPNAATQAUAMZqQEEj 4oGVnfNIBg5NMQYoGKvWgC3CelAFxKYhwoEPFMQ1uKBojapGJimMQikBG/FAxEkwaQFhHzVIlokB pki5oELTAKAEoAKQBQMSgBKBiGkAxqBjCeaYiSMcUAPPSkBEwoGMOBQMytTl6LTRMjNQAtzVmLLL bVTC0AOtY95yelNCNSNFAwBTAkCgUgCmAUgCgBKACmAUgCmAUALQAtABQAUAFACUAFAjmaAEoAKA FoAUUALQAUAFACigBwpgKKAFAoEOAoAdigBcUwFxSAXFMAoAKAEPSkBEycUAR5CDipZSLkL7krJm 6JMUhjhTESYyKAIpExSAgPBqhD1NICZTQMkU0hkgNADwaYyRTQA4GgQ4GgBc0ALQAh4pAROeKBlW RqQyA9aYhy0CFoGJ0NAixE3SgZfiIK0xMkoEOFMQ1qGNETNzSKEDUCFJpDImGTQAxlINIY+N8UwL CtkUyWh4NMkXNAgoAKBiUAFACUDENIBCaBjGNAEeeaYiwnSgBT0pARsaBleZ9qmgZhXcm+QmqSMp MhUADOaognVS65xxTAsWB+cigRpJ96gCSgAoATFABQAlACUwCgBaADFABSAWgAoAXFABimAlABQI 5igAoASgBaAFFAC0AFABQAtAC0CHCmA8CmBIFoAcFoAUCkAYpgJQAlABSAMUANYCgCLaClIaCB9j be1ZyNYsuqcipNB2aQEinimIbIMikBWYc1QhVNICVTQBIpoGSikMeppgOFIY7NADgaAHimIWgBpN IZDIaQFdhmgZGwxQIaDimIa0uKQxomGeaYE8b9KAL8MnFAFhWpiHbqBWI3kpFJFWSYDp1oGMErel ICVHJpiJVXNADynFAEZTBpDHoaYiUGgQ4UyQpgFIApjEpAFADSaBjSaAIyaAEX71MROvSgBSaQEM hxQMzr+bCYHegGzFdsH1NWjFiA55pklxDtg5pgWrBCAW9aANBBigB9ABQAUAGKAENMBCKACkAUwC kACgB1ABQAtACUAJTASgDmaBBQAUALQAooAWgAAoAMUAFADgKYh4FAEiigBwFMBwpAKKAAimAlAC UgCgAoAQjigCuTgYpDIgcMT6VLKTLkEu5etQ0ap3JlOakolSmIcelICvIMGmIYODQA8HBoAlU0DJ VNIY9TQA8GmMdmkAoOKAHBqAHE5oAYTQBE1IYwigBjCgRCy0wGBfWgBfLU9qBCqCtAy1E+KALCSU ASb+KAImJbgUDEEQ60CFKjtQMfGmOaAJlGKYhwoEIy5pAMwQaQx4NMBwNMQZoELmgAoASgBCaBjS aAGE0AMJoEKn3qYEw4pDEZqAKtxLgdaBmNdS+YT+lNGcmUH61ZmKnWmIuwRSTEAg7aANeCIRoBTA mxSAWgAoAKACgAxQAmKAEpgLSASgBaAFFAC0AFACGgBKYCUAczSELTAKQC0AKBTAWkAUAFMAxQA4 CgB60xDxQA4GgBQaAHCgAoASgAoAMUAHSgBD0oGVn+ViakCtnLYz1oGTRt5fNS0VF2Lkb5qDUnVq AHA0gI5aYmRA0AOHWgCVTQMkU0gJAaBjxQAuaBiigBwoAcKAENIBhFADGoAjNADCKAGlc0wEwR2o AU0ACtg0ASrJigCZXzQA9aAJMZpgKEoAkAxQAtIQopgLQICM0h3G4xQMWgQZoAKAFzTAQ0ANNADD zQAnSgBhoEIrY5oAk80YoGQy3CqDk4oAyLu93nCnimkS5FMybqqxncjb1FMQ+LlhTEb1smIxxQBY AoAdQAtABQAhoAKACgAoAMUAJQAlACigBaACgAzQAhoASgApgc1igQuKQABQA6gBQKACgBKACmAo FADhQA4UAOBoAXNMBQaQDhQA6mAUAFAhKACgY1ulICnPL1A5pARwru5pjLDRjy6TBDkYKoOalotS JkmHrUGlyUSD1pANdwR1piGCmIcDzSGSKaAJVoGPWgZIKQDhQAo4oAcKAHZxQMbmkAhoAYaYDCKQ CbaYBt5oANlACeXQAnl0AAjNAyZFpgTxrQImC0CHYxQAYoAMUALikAUxC0gExQAmKBiUAFAC0wA0 ANNACEUAMNADGoEU7mbylyKYrme+pOOlHKLnKst08nVqdiXK5AWzVWJFWgQ40AS267pBTA37c5QU ATgUAKRQAtACUAFACUAFABQAUAFABigAoAKACgBKAEoAKAEpgc7SEKOKACgBcUALigAoASgAxQAo pgLQA6gApALmmA4GgBwNADgaAFpgFIBKAA0ARScqRQBnzfewOaQD4GAFMCy7rtpDIskpxQBEWJIw cGlYdxfPZeppco+Ycs5Y8mlyj5i3G2RSKRKKQx60ASg0APWgZIKQD6Bid6AJBQApoAaeKBjWOBQA zNABQIUCgBdtADgtADxHQA7yc0wAQ0DHiL2oAkVMUCY/FMQYpAFACGgAoGFAhaACgApAIRQMMUAG KBARTAaaBiGgQwigCFzigDI1KTBxmqRDZlMxzVkDQ3agQDrQBPGMrSGLtyeBQIltm2yYpgbttnaM igCyKACgBaAEoAMUAJQAUAFABQAUAFABQAlACUAJQAUAFACUwOepCFFAxQKAFxQAuKAExQAYoEJi gBcUALQAtABQAUAKKAHimMcKBC0wCkAUANNAEUnTNIZVZO/egCEEqelAh5m46UDEWQ4NADTk9OKA GsDn1oAUZGKBl+3bKVDLTLIqSh60ASLQBIooGSrQA88CkAKKBj+lIBKAEJpgMPIoAYeKAEBoAeDQ MdnIoAepxQBKnNMRMMUCDigYtAgzQAuaADNACbhQFhCaBjdwpAKDQA7NMBaQgpgFAAKQBTAQ0AJS AKYELGgCCQ0AYeoNulNWjNlA80yRAvNMQqrk0AWBgACkMliK76EJj4IszjHrTA3IV2gDNAE4oAWg AoATigBOKAFoATFABQAlABQAUAFACGgBtABTAKQCZoAKYHPUgFoAcKQC0AFMAoAKADHFABigBcUA FABQAYoEOFMBwoAcKAFpgFIANADW6UAR8EYoGROCowBmkBAACDxzQAgTPAWgBAm1qAHFe9ACFBjJ oAYQD0oAsWrVLKiXVNQaEgoAkXrQBKtAEi0DHHpSAegoAVhigY2gBrcUARM+KAI2kAoAZ51BVhRM aB2HCc0BYeJjQOw9bgigViZboY5pi5RwuRQHKL9pFAco03B7UD5Rv2h6B8qDz29aAshpmb1oCwee 3rSCwgnIoFYcLkDvQKw8XAJ60BYsRtkUEskFMQtAgoGIaAEoAKAGsaBkLUCKs7YBoEzAuG3SE1aM 2QAHOaokMc0hkyLgZNAD4xufFAD5FAPFCEW7CMlgaYGsq4oAlAoAXFABigBMUAGKADFABQAYoAQ0 AMJxQAA8UALmgBM0AJmgAoAKADFMAxQBzopAKKQC5oAXNAC5oAM0AFABTAWkAtABTASgBaYhRQAo oAeKAFFABQAUAFAEbJ3FIY0nsetAETDDZoAZnnIoAQj5s0AIzDGBQBCSc4NABjJ68UAPgbbJikxo 0ENQakopASLQBMtAEi0DFNICWOgBWHNAxCKAIpDgUAU5WbsKBlZ2bPNAxoegCRXoGPV8Uxjg9IY4 PTAUPQMerCgB+8UCDzKB2FEhNAWDLehoFYPmPagBpVqLDAITQImjt+eRRYlssfZ129KRNx8SFOKA ZOKZItAhtAwNACUAFADGoGQuaQGfePtjamiWYj8nNaGTEUCgBQOaQDxknFMB6jbJQBKFy3rQBpWE eFpiL4WgZIBQIXFABigBMUAJigAoAKAENACGgBppgJSASgBKACmAUgFoAKACmBzmaQC5oAKQC0wF FACigBaACgQuaBhmgAoAWgQtMA70AOFACimA6gBKAFpAFAAaBjWUHqKAIzH6E0gG+QexosAC1z1J osA77MqimBWeFmOQOKQDDFimIYikPSGX4jlRWbRoidTSKJFNAEymgCQGgYuaAJI2waAJDzSAKAGs ARQMhdBQMgkhBoArtDg0FAEApjJFQUDJBECOlMBRAMUWC4CCiw7jxb4osK44QDNFguSLAPSnYVx/ kAUWC47yhigVxrIBQBGR6Uhjki70hNlhFoJJQKBCigQooEFACUDCgAoAQ0ARucUDK8rcUhGTqMmF 21SIkZTHJqyBV570AO3BTiiwDkPOaYh7sS9ICxaxl2FMDYjXywBQBODQBKDQMKAFoEJQAlABQAlA CGgBpoAbmmAlACUAFABQAUAFABQAUCOcpDCgAzQA4GgBQRQIWgBaADNABmgYUCFFAxwpiFoAWgBR QAtMBaACgBcUgFxQAYoAMUALgUAAFAxRQAyQhevSgBuVIx2oAilChSPypAU15Y0AWIW7VDLTLKmp LJVNAEy9KAJAaQx2aAFU4NAEwbigBM0DDPFAxhoAaRQAwrmgBpizQUmIIyKZVyRODQA8H2piHgj0 oAcGoAM0wFDUCsLuNAC7iTQAmwmkFxViwaQrkoTFArjgMUCHUCCgAzSAM0wEoAWgBCcUgGk0DIna gCrM9MTMS9k3SHnpVIzZRJ9KskTOKBD8EAGgCRCQKAJIY2lf3oA2rO28sZPWgC6UBFACKG4GKAJh QAtABQMKACgBKBCGgBpoAYaAEpgJmgQUDCgAoAKBCUAFABmgDnKQC0ALj3oGFAC0ALmgQUALQAUA KKAFFMBwoAcKACgBRQA4CgBcUwDFAC4pALigBcUAGKAFoAAKAFAoGNlTchFAFAlo2w3SgRJ8rL1p DKzcGgQRNhqTRSLiHpWZqidTQBKpoAlU0DHUgAUAPzQAuaBhmgYUAFACYoAULmgB4WgLi+WD2oHc PKpjuHlmgLibDQFxQpouA4JRcLjlSgVyQJ7UCuOCigVxcUCuGKAFoAKACgBM0hhTEFAC0AITQBEx pDIXPFAFO4OFJpkswZ2JY/WtEZsg5pki96AJQcgUAS7MKPegDR0+HoSOtAGtGKAJBQAoFAC0ALQM WgBKACgBKAEoENIoAaRQA2mAmKAACgBcUCA0AJQAlACUAFAHOUgHCgBc+9AwoEFMBR1oAXOaAAUA LSAUHimAooAcKAFFADhQAoFMB4FAC4oELigYYoAXFABQAYoAUCgBcUgFxQAY4oAhmhDrigChJE0Z 9qQELBu9AxqhgetMLlyFsgVmy0yyhqSyVDQBMpoAeDQMdQAZoAQtikA5TmgY40AFAxaAHAUAPFAi RaYDgBQAuBQAbQaAAIKAuLtFAXFAoELimAuKBBQMSgApAFACGgBpNIYopiFoAM0AMJoAiZqAIXNA EEq5iY+1AjnrgYc1pEzZD3pki96YiSMZIzQBbjG9gBSGbNrFtUUAW1GBQA6gBRQA6gYUAFAgoGLQ ISkAhpgNNADDQAlMBKAFxxQIMUABFADTQAhoATNACUAc7QA4H5cUAFIBaACmAuKAFxQAAUAKKAFx QA4UAKKAHCmAooAeKAHCgQtAC4oAKBhQAtAC4pALigAAoAUCgBcUABFAEckYcYIoArPa45FAELW7 Z6UhjdpjPPSk0NMnRuKg0TJkNIZMpoAkU0AOzQMQnikA0mgB6GgZIKAFoGLikA4UwJFoEOHFAyQc CmIUUALQAtAgoAKACgAoAKACmAUgCgBDQMYaAFFAhc0ANJxQAxjQBC5pAR43NTAJgBGRQBzl0MSN n1q0ZvcgUdTVXJAD+LHFBJNDGWbABpga9lZkfMwoGaSJgUgH0AOFAC0AKKAFoGLQAlAhaAGmgBDQ A00ANNMAoAMUCFxQAYoGIaBDTQA00ANoAKAOdoAWgBRQAtAC0ALQAuKAFAoAXFAC4oABQA4CmAoF ADgKAHAUAOAoAcKAFoAKAFoAMUAKKAFpAGKAHYpgLigAxSANtACFaAGmOgCtcQbkOO1IZTjfadpp NFJlpGqCyZWpDJVNADwaAEJoAYTQMehoAmU0hjxQAooGOFAEi0AOFMBRQAu7tSAcKYhaBBQAooAK YC0gEoAKACgBM0ANY0DGigQtAC5oAYTQBE7YoAiY5oAkRcD3oAiuDhTSGc7d8ytWkTKW5XGMGn1J BSM1RJf05gs4z3oA6BAMUhjwKAFoAUCgBRQA4UAFAC0AFACUAIaAEoAaaYCUAFAC0CCgBKBiGgQ0 0ANNACUAFMDncUgFxQAuKAFxQAuKYC0gFApgOAoAXFABSAXFMBQKAHAUAOAoAcKAFFADhQAtABQA CgBaAFoAWgBQKAFxQAtAC0AFAC0AJigBrLmkBnXlsUO9aQyGKTsalopMspJUlk6tSGSA0AGaAGmg ByHmgCZTSKHigB4oGPFADgaAHZoAM80AKOtMB4oAcKBBQIWgAFMAoAKQBQAZoAaTQMYxoATNAhc0 ANLUAMLUARM2TQA5E7mgBx4pDKl02FNAGBcnLmtImUtyBe9USgHFMklhkKOCO1AjctdQRwA/ymgZ fSVWHBBoGSCkAtADhQAooAWgAoAKAEoAQ0AJTAaaAEoAKAEJoEGaADNADc0AIaAEoASgApgc/ikA tACgUALimAtAC4oAWgBRQAooAXFACgUAKKAFAoAcKAHCgBRQAtABmgBaACgBaAFoAUUAOFAC0ALQ AUAANAC0AFABQBHKm5SKQzGnjMchFIBYpscGpaKTLkclSWTK2aQx2aAA0AIDigCZGpDJQaBjgaAH qaBjqAFFADwKAHAUwHgUCFoELTAXFABQISgYUgENABmgY0nigCNjQAmaBBuoAYzUARM1ACouTzQB L0FADHOBSGZ92/BoAxZ+WrRGUiFTzVEoKZLDPHFAEiyEUAWoLt4yCpoA1bfU0YAPwaALsVwkg+Vg aBk4OaQDhQAtAC0AJQAUANNMBDQA00AJQIaaYCGkAmaADNABmgBKYCGkAUwEoAwcUgFxTAWgBaAF oAKAFoAUUAOoAWgBaAFoAUUCFoAUGgBc0DFzQACgQtAxRQIOlAxQaAHCgBwoAcKAA0AJQACgBRQA tAC0ANIzSGVbq3Ein1pAZLxlGwRSGTQuTUstFpHqSiUNmgB27NACZ5oAkRqAJkPFAx4NIY4GgZIp oAcOaAJFHFMB4FAh1AgoAWmAtMQUgENAxKAEJpDEzQBG7UARbqADdigQ0tQAwtQAKuetAEyjigYp oAglbikBmXb8GgDJmOSa0RkyNT81UQhTwaAYE5AHGfWncQ3NMB4JFICRXIxQBOk5Q/KxFAF631OR MbjuFMDSg1COTAzg0rBctq4PQ0DH5oAKAEoAaaAGmgQlMAoASkAmKAGmgBDQAlABQAlMAzQAmaAM KgBwI70AFABQAtAC0AL+FADhQAtACigQooAWgBaYC0AFIAzQMWgQtMBaAFpAGaAFBoAcDQMcDQAu aAFzQAUAFACigBRQAUDFpAMbBoAyb3Hm9OlSykQRHDUmUi2OQKgoXcVPNADw9ADt1ADlagCdGoGS g0ALmkMerUDJUNAEobimIcGoAXNAC5oAUGmIM0ALmgBCaQCE0wGE0hiFqAIXegCLdQIQyUAN3E0A ORaAJlGKBjulADGakBVmfigDNuWzQgZnSda0RiyNeGFMke3L8U0DGkEcGmITvQACgB2TmgQoOKAH rJTAlWQjpmgC1DfSxnhjigC/BquThxQO5oQ3CSjKmkBLmgYhoENxTAKAEpAFACGgBpoGNNAhM0AJ mgBM0AIaYBQBh0ALQAtAAKAFFADqAAUAOHSgQtAxaBCimAooAWgBaACgAoAUUALQAtABSAKYBmkA 4GgBQaBi5oAXNAC5oAXNAC5oAUGgBc0DFJ4pARt0oAx7o7pW+tQX0Kytgg0wL0ZyKzZoiTFADSMH igQBsGgB4amBMj0gJlegY/dQA5WpDJEagZKrUAPDUxC5oAN1AC76AANQAb6Bib6BCb6AEL8UARtJ igCFnoERl6AEXJoAlRaAJlGKBjxSAQ9KAInNAFOduKAM6ZutNCZTfrVmbIwOabJQ5h8xIHSmgYjY LZximSNxQAY9qAF9KBAOO1ADlI9KYC5xQA4PQBIrUAWLe4aJgQaAN21ulnQc8+lAyxmkMKAEoASg AoAaaAGmkA00AJTEJQAlABQAUwMSgAoAdQAYoELQAo4oAM0DHUCFoAUGmAUALQA7NABQAUALQAtA C0AFAC0AFABQAopALQMM0ALmgBQaAFzQMUGgBwNAhc0DDPFADJDhTSGYsp+Y/WsyyBhtwfWqRLLd u+UqGjSOxZHSkMQigBhFACdKBDg+KAJkloAlElAxwkxQBIsnFAyQSUAP8ygBfNoAN+KADzKBi+bS APMFACGSmIQyUAMaXFAiIyZoAbkmgByrQBKqUDJVWkBIBTAOlADWPFICvI3FAFGdutAFGU00Sys3 v+VWZsauN1OwCkfvCB3prYl7jehpiENMBMYNIBTQIXFAxPaiwgNMYooEOBoAkVqALVrcmGQEUAbs M6zIGU0hkwNAwzQAlABQA00AJQAhpAJimAmKBBigBMUAKBTAwqBC0ALQAlACg0ALmgBRQAuaAFzT AAaQC0wFzQAtAC0AFAC0AKKAFzQAtABQAUALQMKQCigAoAWgAFAC0DFBoEOBoGLmgAJoAgun2xE1 LGjKaoNCBzVIiRNav2qZIqLLymoNBxHFMQwikAmKYCYoAOlADg5FACiSgByzYoAeJ6AHiegBfPoA BPQMPPoAPOoAXzqLBcPNNAhfMJoAOTQA4LQBIqUASKtAyRVoAeBigAzSAQmmBE5pAVpWoApTGgCn JVIlkDVRmMXhqYkDfepoTDFMQlMQds0WAPwpAKDQAZ9qYAT26UAFACg0AOBoAcrYoAu2l20LDn5a ANqGZZUBBpDJQaBhSAKYCGgBKQCUAGKYC4oATFAhMUAFAGDxTELQAUABoAKACgY4UCFoAWgAoAWg YtMBaQgoAdQMKYhaAFoAWgBc0AFAwpALQAtAAKAFoGAoAKAFoAWgBaAAmkBUvm+UL6mpZUSg1Qak D9apGchYWw4pvYS3NGM5FZGxKKAGsKAG0CHAUwDbQAhSgBpUigBMUgFoAUUALTAUUAKBQA4D2oAc FPpQA4IaAHrHQBKqUASBKAHhaAHgUAOAoAWgYlADGOKQELmgCtIaAKcpoAqyU0Syu3WrRAi43CmC 3Eb7xxVIhgaBBn1oASmIO9IBRigYYBoAQ0wFoAOhoFqO/wA4pAKO1MB4OKALlpdtC/JJBpDNqKQS KCpyKBkuaQCUAFABQAlABQAtMAxQA2gQlMDAzQAtAhaAEoGFAC0ALQAtAhaACgYooAWmAtACigQt ACigBaACgBaACgYCkAtACigBaAFoAKBi0AFABQAtABmgAJpAZ9026XHpUSZpFFdqg0IZOatGUkRq cNVEo0IHyorJmyLIpDCgBpoAVaYh4FADgKADZmgA8ugBPKoAPKoAUQ0AKIaAHiKgB6xUAPEdADhH QA8JQA5UoAeFxQAoFAC4oAU0AJQMQmkBExoAiY0AVZDQBUkNAFaSqRLIG61SIEXg8UxDc81RLDNA g7UAGaAE60CAEjvQMXJoAdnPp+VOwNhQIDQMXGaBCikA7NADg3PtTAv2F35Z2MeDSGa6OCMikMfQ AUAFABQAUwCkAUAJTEJQBz9MBaAFzQAlAC0AFAC0ALQAUALQAtABTELQAtADhQAtAC0AAoGLQAUA LSAKAFoAKAFoGFAC5oAXtQAUAFABQAx2CqSaQzNL72Zves5GkBrdKkshc1cTOREetUZlu1fjFRJG sGXlPFQWLQAhFACCgCRaYiRRQA8CgB4WgBQlADglABsoAcEoAcEoAcEoAXbigBwWgBcUALigBcUA LQAlABQAhOKAGMaQyJjQBC5oArSGgCq9AED0yWQNVokb0yfamiWNqiAoASgBce4oAUYzzmgBCBnr TASkAvagA6UwHBj+FAhysO9IA3c0AGcdKYBu/KkMcr9xQBo2N/twjnj1oA00nRujA0DJQ2aQDgaA DNABQAUAFMBKQBTEc9TAWgAoEFAxRQAtABQIKAFFAxaBC0xhmgBaBBQAooGOFACigBaAFFAC0gFo AKACgAoAKACgBRQAtAxaACgAoAr3fELUmMoKMJmspGsdhGpWKIGNWtDJkeaogngO18UpLQuLNGI5 FZGpJQAhoGN6UCHqaYiVTQBKtAEi0APAoAcFoAftoAAtADgtAC4oAQrmgB4GKYBigAxQAUAFIBM0 AGaAGE0DGGkBG5oAgegCs9AFd6AIWpolkLCqJZG3AqkSxg61RAtADTQAo5pgBoAVcg5wDjmkJgck 56fSmMDQAZwaBCUAL34pDFDcUxByaQCk5HWgYgPFMQoYjmkBIs7KeCaALUOoSL/Fn60DL0GohsB+ KALySqwyDmgB+aQxc0AGaYBQAUAc6KZIooAKYC0gFoABQAtAC0wCgBaACgBaACgBaAFoAcDxQAoo ABQMWgBaAFoAWkMKBCUwCgAoAWkA6gYUALQAhNIClezYG0UMZXH3RWLNlsRucChAyBq0RkxlMkeh KsD0oYI0YWyBWTOhFgc0gFNAxhoEKpoAkU0xEqmgCZTQBIDQMetAh4oAdQAUALQAopgLjFABSAQm gBpNACZoGJmgAzQAlAhjGgZCxpAQuaYED0gK70ARMKaEyJhTRLIXznFaIzkMpki8YGOc9aAG4piF FIYHg8HP0piAUALnigAoACpU4PFACd6AE+lACikAA9aYBSASmACkAucUwF3evFIByyFT1NMZaiun TG1iKQi9DqfaQfjQMvRXMcn3WFAEwbNAC5oAM0Ac7VCFFACigBaACgBQKAFoAWgBRQAUAFABQAtA C0AKKAFFACigBaAFoGKKACgBaACgAoAKACgAoAXNIBc0DDNADWbAoAyZ5N85OeKXQZIe1Y3NyGQ0 0TIiY1aMmyPPNVckUE5ouBdtn+Uc1lI3iy6h4qSx9ADTQA3PNAh6mmBKrUCJlNAEqmgZKpoEPBoG LQAooAWgQoNAC0wEJpAIaAGk0DGZoACaACgBCaQDGNAELGmBE9AED0gIXoAiNMTIyKdxFZiSxrVG L3G0xAaADBoEN5BoAd+NAB0NABmgBTQAhJJyaACi4CY5ouAUAFAByaACgYZxQIKVwEzQAvzY6cUw HKxHegB4cigCRJipyCaAL9vqLLw/IoAvw3aSjg80DJw+aBHPigBwpgKKAHYoAWgAoAWgAoAKAFoA KAFFAC0AAoAWgAoAUUAOFAC0DAUAKKACgAoAWgQUDDNACUAGaAE3YpARyTqg5NAFGe8ZuB0pAVgf mpMaLJPHNYnQQSNk1aRmyInnirM2xtAhRQNFiBsGokjSLL8bcVBqTigAPSgCM9aAFBoAlU0xEimg RKpxQMlVqAJA1ADg1ACg0AOzQIXNABmmAhNIBM0ANNAxuaADpQAhNADSaQDDQBG1AEbGgCFqAIWo AiagCKQ4U1S3Jbsiqa1MWJ34oEHFABmgBDxQAoPHFMQUhh70CEPagYZoEFABmmMM0gA0AJ0oAXt0 pAHYdaYCdKAAUCDNAxRwBQIcppgLnJ4oAUMRQBIspHQ0AXIb50xzkUARYpgOAoAcKAFoABQAUALQ AUAFAC0AFAC0AFAC0AFACimAtIBRQAuaBi0AGaAFoAM0CDNABQAmaAAmgZG7hRkmgCrLd4ztpAU3 kLHJpAMJoAVOtDGtyeRscVkkbNkDtmrSMmxi0yQAzQA4ChgPjODSZaL0TVkbIsqaQx/WmAxhSAbT AeDQIkU0wJFagCVTQBIDQA8UAOFACigBaACgAzQAmaAGk0AJnFACE0AJSAQ0ANJoAjamBE1AETUg ImoAiamgK855xVxM5EAx3OOKszGnI60CCgAoAM+1ACd+lADqYCfhSAUAkcAUAJQAlFwCgBBQAuaA CgAA9KYA2M0gEzQwFoABQAvYUAFABmmIdmgYq9ccDNAhwJ3YoAtUwFFADhQAGgAoAM0ALmgAoAUU CFoAKBhQAtABQAooAWgApgOFABSGLmgAzQAUCFzQAmaAAmgBrOAOTQBWluguQKAKcs7P1pAQ7qQC CgAoGOT7wpMa3JJW+bFTEuTIjVGbG0wHYoAKQx69aBotQtWTNUy0jUiyUGgAIpAMoAcppgSKaYh6 0ASrQBIpoAkBoAcKAHCgBRQAhNACUAJigBGOBQA0e9AwpAITQIQ0AMY0xEbGgCNqBkTUgI2oAjag ClK2XPNapaGEndkXeqJEoEL2NMBKAF4pAJ6UAL+NMA+vFIBM8UAJTAB+NAAaQAKADvQAv40agHSm AmfypALwaAAjmgAFAC9qAEoAB1pgLzQA4UCCgZdpiFFAxc0AGaACgAoAWgBRQIWgYueKBBQAUAFA xaYhaQwoAWgBQaBhQAuaACgAzQITNACFwKAIJblV6c0AVJLlmqbgQFietFwANg5wD7GkA2gA560w CkMfGMuKT0RUdxX++aS2HLcYaogXHFAwHHFABmgQ5aRRNEcYxUM0iy1G1SaInU0gH0AMNACimA9e aBEi0wJVpASLTAkFADgKAFoAdQAmKAA4FADTQA00AITQAmaQCE0ANNADGNMRGxoAYaBkZpAMagCv O2EqkrsmTsikx4rUwbG0CEoAXOKQ7hnmmAnXtQK4tACfhQAUAGfWgAFIAx6daYxO9IQUwFoC4UgC mAcY560hh1piFXIpDFPHbmmISgBSCOo49aAEFAC5xTAAaADNAF3NMBc0ALmgAFABQAtACigQtACg 0AFMBaQBQAtMApAFAwoAM0DFFAC0ALQITNACFsUDIZbgKODk0CKb3BY8nikBEWoAbnnmkAUAIcdu lAB0oGJQIKQyWH74oexUNwk++aSHLcbVEhxQAnegA4zSAfQMfGallIsoazNUWFagZIDSADQAlMB6 mgCdOaYiQLSAkUUwHigBy0AOAoAXpQAE0ANNADScUAMJoATNACZpANJoAQnigBhNMRGTQAxjQMYa QEbGgCjO+W68CtIoym9SA1ZmLxigQ3ILUDDimAGkAUAFMQZzSAKEMOlMBaQhKADvQAgoAXvQMUYx 1oEJkUDAUAA4pgOXjnPIpCEzmgAPSmAZyPagAFABQAUALigC5TAKACgBc0AANADgaAHUCCgAzQAo oAKYCigBaAFoASkMM0AAoGKKAFzQAE0CI3lC96AKk1wWOBxSArk/jQA2gAJ4pAJmgAxQMP0oEJRY AoGHekBLD/rB2pPYuG46QfMaS2KktSPoapEATQISgBR1oAeRgUihVJpMaJ1NS0WidD+FIomU1Ix1 ACGgAU0wJkagCdDTESg0APFADgcUAOBoACaAELYoAaWoAYTQA3PNACE0ANJpAJQAhNMQwmgBhNAD DQMY1ICvPJtWqSuJuyKLHJrSxg2NJxx2p2EIeaBCUDDpQAvUUAAoADQIFO2iwCUWGLQIXsKBhTAQ 8mlYA4z1xQITvQMPwoAOtACjrTAcRgA560gE6UAHb2oAKBBTAOlIYUxCUgHD04pgW6YBQAUALQAC gBwoAUGgQtABQAtACigBRQAtMApAJQMKACgAzQAjOAMmgCtJc9lpAVi5J5NAXGk0AJSAKAEoAKAD t3oADQAlK4AOe9ABQA+LhxQ9i47liReayizZohK1VzNoYeKshiUAOUUholcfKDSKGr0oBEy1LLRM pxUlEqmgZIDQAppAA60wFBIoAmjkoEWEcUwJA1ADt1ABvoATf70AIXoAaWoATOaAGk0AITQAhNAC ZoENJoAaTQAwmgYwmgCN2wM0gKE0m5q1SsYylchJzVEXE9qBCUDCgAoAM0CAcUDA0CFoGJmgAoC4 oNAhaAuIfrQMSgQHigYDnvQAoGDQK4dKAuODY6jNACE5Pp9KYCClcBc0wCgYZoFcKQAOaYCjg9M0 AW80wEoAUdKACgBaAFoAcKAFoEKKAFoAKYC0AL2oAKAEpDEoACcCgCKSYL0NAFR5ixNICPNACUAJ SAX6UAJ2oAOtAB0oAKLABoASgAoGHSgBVODSBMuL86A+1YtWZ0p3QxlFNMGiJxVoyaGgVRA5eoos NEzj92KkpkYpgSLUMpEq1JRIpoKJFagCQcigAFIApgKOKAJFfFAEySe9Ah2+mAF6QCbqYChjQApN ACE0ANJoATOaAEzQITNACGgBpNAxhoEMY0DKlxL/AAiqiupEn0KhNaGI3oTQAGgBKBCjA6jNAxPp QAvWmAlAgoGHekACgAoAUe1AB3pgFACZ56UgA0AKvWhBcXHPWmISiwC/WgA7UAJ0NAAOaAuL9KAD rQAGgAoAOooAuUAJTAUDigAoAWgBRQA4CgBwoELQAUDFFAhaYBQAUANzSAjeUKKBlZ7hm6cCkBAW J60gEoAKAEoQAaAFoASgAoAM4oAKADvQAUgEoAX8KBgDQJFi3cZ2nvUyRtB20JiOayubWIpF61cW ZyRFgnPtWhlYVRzSYIsMP3FIsgFBKJBUstEgpFIeDSGPBoGSKaAHUgFBoAcKYC4oAUZoEOGaYDxQ A4UCFzQAhNADSaADNAxCaAEzQAZoENJpDGk0wGE0gK88u0YHWqSuTJ2KLMSa0MbjCaoQmeaQCkgD rQISgYdDQIM+tAD43Cnlc85oGOuJlmk3KCox0Jzg0CIjQAuaAG0DF4oEKDQADrxQArHnpigBo60A HWkAopgGaADpTAU0AGRQAZoAQdaQC0wDpQAUAH0oAKALlACUALTAKAAUAOHWgBwoAcKAFxQAtABT AWgBM0CGlsUgIJZ8Dii4yqxJPJpBYb3pAJxQAGgYlAhQDjPagYlIA6d6YBQIKQwxTAMUCFIoATtS GIKAFxQFhKAHLwc0DRdjbeme9YyVmdMXdAy5pXBorsuDWy7mLQAc0AWWH7ikMrDrQIkUc0mUiRel IY4VJQ8GgB6mgY+kAoOKAHA0wHA0CHCmA4cUAKDQIcDQAhagBu7mgBCaADNAwpAFMBKAEyKAGMRQ BBNMFHvTSuS3You5ZjmtErGTdyP/AD0pkiYoACKAENABigAxQAd6AEoAWgAoAO9FhAKBikUAJQIW gYGgBOlACiiwhcUwDtQAnSgBTQAUAJigA7+gpALTAPWgAxmgAoAKALdMAoAKACgBaQDhTAcKAHCm AtIBaYB0oAazACgCvJcY4FK4ELSse5pXAjJoAMZOKAE6etIBvegYEUgCmIXJAxk4pDE707gH4UAF IAoAPb+lNAHekgCgBKLgFAC0AHXrTAcuO9AEkTlX4BqWrlxlZl3aCMisbWOlaohkiPWriZyIgpz0 qzNFor/o9SMpgDNMRIKTKQ9aQx4qRjqBiigCRTQMdSAAaAHA0xDg1MBwagA3UALvoEG6gYm6gQZo GJ3pALTAWgAzQIYzYpDK00wUcdapK4m7FF5N3PetNjFu5GTzTRIDFABmgAzii4DaQC9adwFAFAAR igBtAAPpRcBfxx+FABQAdqAF/MUAJRcBaAEoAcDigBOBQA6mIT8KLjA0AGKACgQAcUDADI/pSEGM UAHWmAUDDtSAUAdKYizQAtMAoAWgAFADloAeKAHUALTAQmkAySQKtAFN5S59qQEROTSATNABnFAC 9qGAlACZoAKGAd6QCU+gC0AFACUXGGKQBTEFAC0AJSAKBhmgQ4c9qYCgE9BQMACKQFiGYocHpUuN zWE7FkksvFZ3sbNXIirZ74quYz5CyiZgNPoKxQIIamSOApMaHikyh4qRjqBiimA5TzSGSA0ABoAQ GgQoNAC5oAN1AC7qADdQAZpgLmgBR1pAKKYC5oEMZsUAVJ7nHC00rickik7knmtNDJsZQSIDzTEL nii4CZ5oGH86LiFoATNAxc0xCjntzSGICelAADQAnNAC0CAcUDFycUAJzQIOcUAFMBwoAKQCg0wC gAoAaaAFFACjpSAToaAHZ4pgJ+tABj8qAFCnFIBcEkcUwJxTAXNAC0AFACigBwoAkFAC0wEJpARy yBRQBSeTceTSAZmlqAgYjOD1GKQAMetABx9KdgDqcZo1ADgHrmgYcZ9KVhCUagFFgEzx1pgLxSAT j1pgGaLAKCDxnFIYnFAgp2AM+9KwxeKNRBx60ABxQAZ96dgAHJ60AKQRg0DBW54NKwXLNvPtOD0q ZR7GsJ2LgIasWjqTTHhtoI7U07EuKZUkjOSapSM3AYBimRYeKQxwpDHCmAtIYo+tAEiUAOIoAbig BKAFzQAUxC0hhQIKAFpgOBpALmgY13CLkmmIoz3WeB0q1EiUiozd8/rVWMrjSRmmAZFAhKVh3HED jBzketMQ3NAwBpWELTAOKLAGRQAoNAxCfSiwBkUCCgBcigBKVhingUxAOfyoAKADigBc09QDIzQA 7IosAZFAC5HrSsA04o1C4UwAEUgFAB780AKDjINOwCA4NAC9frQApOKQCh+1FgJaoBc0ALmgAoAU UAPFADs0ABbFAEbzBQaAKkkhY80gI/zpDCgQhoGAoAB0oEFABQAcUDE780gFxQAlMA9KACgBKQC0 AFNCDvQMMUAGKQhKBi0PQBMUALjmgA6UwHAj0oEGT2zigaJ4Zyh56VEo3NoTsXFcMODmsWrHQmmD HAz1pJA3YqvLk9K1UTByAS+1Vyk8xIjA96hqxaaZLipuXyhimKwlAh6GgCcdKAEIpgMIpAIaAAGg BQaYBQIWkAGgYooAiluFjHHWqSuJuxSmnZzyatKxk5XIM5pkDaADFOwB+FAC96AEoAKACkAvX1pg JQIXjFCGFAC9DjrQAlIANMA70AHagBaAEoAKEIWgYuelMQpGACCOew7UgAUwF7UAJSASgYUxAOvF IB+MD+VABgHkGgAoAUcYoAUmgBtAE9MA6UAL+GKYC0AKKAHDigALUAV5ZucCkBATmgBKQxO1AC9K AA8CgQlAwoEL0pgHcc8UgEbAPByKADjGaBhjijYQlIYYoAKYBigQUMBQBQAlAB3oAKOowoAKAAYo EHegAxQMVQc0ABUg0AFILkkcpToalxuaRm0WknDcMcGs3FpmyqJkhVGXPFF2OyGeSp7U+axKgmKI FFHMPkSGvJsOByKfLcnmsAmU1LgylNMYbgZ6VXIZuaHJOD0Bp8rDnJ0uV6HijlYcyJRNGR1pWGmG QelIoTikA3imAUAKDQIXNA7CNIFFIditLddQtWomblbYqMxJ65q7GTY3Bxk0CE7UwEoAWgBKAF70 AFABQAd6ACgAoAO/tRYAPtQADr6UAKfWgBKLBcWgBO1AC4yOaADpxQAUwFNAABQIAOaAHUDD2oEJ xSGIaYgHWgCaRYww8pjyOc+tIYm4Y9aBCfKQccUANzjvTAT8aAAHpQAd6ALNMApALTAWgAzQAuaA I5JNo96QFUnmkAZoQCUALQMO1Agzgd6AEzQMSgBc0MQUAFAWCgAzigAzQMM0AJQAZyaBCk5oAOlA CUDCgAoEAxnnj6UgFIoASmMUCgQYHcn8qAFG31P5UAIcZ4JNACHrwCBQAZoGKCc0h3JPMIGM9aLI LscsrjoTQ4opTaHG5YDbS5EV7RkLSE07EXE3YpiuCsM85oEPU/IOcZPNACuQj4Q7h60DBZeRk96T Q09S2J0CjmsuVnQpRsN85W6tgU+Vk8ybGmYbsg8UKOgnJA1z6U+UTkhqzn+JqrlJUga7OflqeTuV 7TsQvKzHk1drbEOTYwGgkTP5UxAxG47QQvbPWkAnPemAUgEzTAXrQAUAFAAKACgAoAD70AFABmgA zQACgBfSgQpOaAE/GgYAZwBmgA6UAAOKYDqADGKBCjr6UDFpCENMBvahDAjHagAHFAg70hi5yMfr TABwKBBQAYpALimAEknJoAs0AFMApALQAZwKAImm5wKLgROT3zS0GMo2EFAATweKBgKACgQUDE6d 6QBTEB+tIYtAhKAF/GmMSgAxSADTAOlABSAKNgF49aYhOhoAKBgKQgoANxxjJxQMKBCfjQAv40AJ TGKBQIPxpALj3pjDpxQgEoEKCR3oGHB70WATHNABQAUgFDYXB6UxBn3IpDEHBoAUmgYZ96Yrhk0h iE0xC54pAHagBRzQAY7UwEbHTNIBO1ACUAFAB9KACmAd6QBTAWkAlABQAdqYB3pAKOKYAKAF/GgA 7YzQAlAC0CDHHpQMMd6AFHWnYQ8cEUAIRzQMO+KQhT7UDE+lMBMUAAHPPSkApGMHnHYmgBuKAFFA goGH40xB0oGFAg/OgC1TAKQBQAZoAbIflNAFbvSGNpAFABQAuaYBRcApABoASgQZouAtFwDtRqMT pTEL0FAwpagJQAZwaEAppgJikAZxQIBQMUsSAD2piEpMAoGJQAUwFpAFMBKQC9qACjUBKAFoAKAD NMApAAxQAdaYCUgFBPajUQlAwoABjFAC0AGaYBSAKACgBRQAq8HrTAUkZNIBnemA+Qxtt8tSpxzk 0gGUAJQAdKACgBfqKYCZ5pALxQAlCAUjAB7UAJQAtMAoAWgAoADQAdDQAufagAJ9aNRCCgY5TzQA 8imITvSGGKBDT1oGKrlDkdcUAG87dvFACZ4pgBJx1pAJQAUAKOKYBSEFMBcYoAKALJpgFABSAKAI 5D8uKVxkBzmgQ2kACgA5HSgApgLQAUABPtQAgpAFMYc0CCgBR9KAEzQAtACUAFIBcnAzTATmkAlA xaYg70gCgApgGcdKQCUwDrSAKACgBRTGFAhKAFFIApgHfpQAuPxoATHtSAKYwoEJQAUALSAAKYB2 oGAODmgApCCgYCmIAaQwJNAgpgFAw70gCgAPWgQlAwH0pgL160AGOaQAfYUxBikAdqewBQAbWABI wD0oGKTkD5QMD86ADnFAB+FAhaAEpgH4UgCgYAUxDs9BgUAOHIoAUjAyPyoATtzSABjPIpgNPtQA CgBPbFIAFMAHWkAUwAUAKB7UAL3oASgBc0AWaACgBSMDmgBpPFK40RsMilcqxFg/WmSNoAO1ACUg D8aACmAuaQCHrTEFIYUAFABQAUwAnmgBSc80gEpiCkMO/FMQlIYUALTAAKQB70wCgBKQBQAUAGKA CgBaACnoAcdzSABxQAv8XPFAARzwc0wE5FADgRQAhUYyDQAe1ACAZOKAEpALQAlMANAABxSACMUA FAC0wEpALQAUAHSmAUgEoAKACgAoAOlAC8UAIKAFIIAPrQAUAFABQAUMApgKOtGgC0AJQIKBhQAv FAg70wFFADutAAeRSAacUABxTQCUDDFAC8UCExSGGOaBC4oGFAgpgFIApgWaAF6UAFADG56VDZaF I+WlcogYEZq0QxpFAhAKACkAKpY4FAARgkZ5pgApAw9qAEHNAB3pgLSASgBaAEIoAUA0xCdqBge1 IApgGKQB2oAXrTASgApAHSgBKAF7UAJQAUwCkAvagA70wClYApgLyc+1IBOQKBAeaYw6HigAoAOp oAMkUgDrTAKQCUAFAC0AJk0AFAC0wE70rALQAUABoAD2oAMcZ7UAJQAuTjHagAAzTAAKAD6UgEFM BxJPXpQAnekAc4pgFABikAtMAFACmgA5oACKAEoELQMKYBmgBwPFAgz2oAQ/SgBBSGL0NMQo9KQw NMQYpDAc9aBBnApgAP4UgDPamAnSgYtAFmgQUAIaTGgxUXNELipuOxHInFWmS0Qkc1RAn1zQAdTz QID7UABAAGM+9AxKQAaGACi4g796YB0BHrSAKaASgYuKQgoASgBTnNFxhTAOvU8UhCUXGKKACgAo EJQADjtQMKBBQMKLgB60AAoABTAO9IBaYgNACGgYCgBQMkAUIBz8DaO3WhiGY+tIYUXASmIXFIYl ABQAtMAFK4AQQaACmAUgCgAoAKAFHPrQA5uRxwB0pgMwRSuAc0AFABTAKVwDFMApABzmgBevQUxC YoGL+dAg/OgYuKBCn2oASgYc0XAKBByKYBQAdqQAPpTAcaQCfhmgAx6UXAQUALQMMmgQZoGGaAD8 6AFFAgpgFACc0AWRQAUAIOTUMtD8VNy0KBxSGNZcii4mVnXBrQzaEx/nNMQYoASgQY4oATGKBgaB AKQCkc07jG0gCmADrQAUAFIApgLSAKYhM4oGFIBaBBk9aBiUxDmIwuOMDmkMbTEFIAoGFACGmAtI QDmgYEEHFMA70gCgAI496AAcUAAJByODQAd6AFzTASi4B3xSAAO1FwDFMAoATtSAKAHH7tO4DaQB 0oAKAFxQAYxQBIqjGe9ADG64HSmA2gBaQAOOlAABTAKQBTuAYoAKQBimAtABQAUAAoAXtQISgYCg BQKYgxRcAoAKBhnNIQUALTAO9ACUhi4piDp2oATv0xSGLg59KYhybc/Nnb7UANxQAGgAFABigCx+ NACM2BzSGKvSoZaHipZaHUhiGgRFIMiqRLIe+K0MxDxQIM8UgDPrTAOCKAEIoASkAUABFACUAFMB RjNIAIxwKYCUDA0hBTAPpSAXmgBKACmMKBBQAUrAB+tABQAd6YwNIApgOKFVVjjB6c0gG0AGKYgp DDNAgpjCkIB+FAw4piD8aQwoAASOQaAE6GgBaYgNIYUwDFIApgFAgpDDvQA4FqYhCx247UhiUAJQ AUAFMBaQB1pgFABSAKYBQIBgUDFzQIXNACUAKaAEzQAdKBimmIO1AxaBCUDCgBBxSAWmIKQAPfpT AUkdqAEpAKOBQAhoAUHimACgAoAM0gQc0wJqAGMeaQ0SJUM0RKBUMpDu1IoaRTQhrCmSQuoBq0Qx mOaZIhFMQdKAD8KADHNAAQKAGYxQhi8d6QgxTATila4ARR0GGPagA+lAhepoASgAxTAKQw4oEB60 AFAwoEJQMXFABgUxBjmkMO2KACmAcUgDvQAUwClcANABQAd6AChgFACGgApiF/WkMQYoAUCmApUq cEUAJjFIAxQAfyosAUAJQAooAXJ6UAJzigA7UAA4oAOtACd6AAD6UwFxSABxTAWkAU7AHbtQAUAF ABigA7+tAgNABQACgYtAgoGFMQHpSAMUAJQAuBQMfvzGF2jjv3oEMxxxigYpGKBCYoAXPHagYEAH jpQIAKAHbc9Dk45oAbQAUwFxzQgJGOBQBHnnFIZJGRUMtE4qGzRDhSGNNCExCaoRC54q0yJEeaoz FzxzQAhHpQAZoAQgHPrQAnIoAO9ACHvQAE9zQAZyKNhgelIQg96LgAxTAM4NAxRQISgBaQCUDDvQ AGgAoAO9Ag6UDD3oAKAEoAWgAoEFMBePegYlIANABigAoEHWmMKQgoGApiCkAUxh3oAUnPJoEGaL jE4pALQAnbrTAOPWkAvHrTEAxnvQMTp60AGRRcApAJQAo7UwCgQUDCkAdqYhaBgMUbAFABQIM0DC gQZoGGfagQDg0DFJz1oC4pO45OPw4piEoAM0gDtTATvSGKDxQIOtMYoIoEHXnrSAKAEoGFAhaYBQ AUgCgAzxTGOYmgQ0cUhj4yM1LGiyvIrNmyFqRhTENIpiIZBxVoiRF2qzMXtzQFxMkUAO6j3oAaRQ AdCecj1oAaaAEpALTsO4lAC46UguIBQIXFMBDz3pDDpQIXtTATvSGL0piEpDFpiEoAKACkMO9MQY pDACmIUBSOuDQMCMHrn6UCE5oGLikITFMBSMDg5FAABnpQAmOaQB2oAMUAFACdqYC0AHbrQMKQg7 UwD1oGFACnHY0CExQAUhgOtMQUDF7UgEoAKACmIBx6fjQMKBBQAUDAUtgCmAvYUCAA0DDvQIKYw7 UrCuHagYUCCgApgLQAUgA0AA6EUwEPPNIANCGKOntTEHOaQAaYBSAKAFPagBBQAo9qYClSoBIxnp QAD0NACUAK/WkA2gYqnBpajRaQ8VmzVDxUFCGmAhNOxJFL0q0RIizxVkDcenNGoB+FACj2oEGSKA DNACY5OaQCEUwAUDDvSAMZ4HNAEqxALljihARnG7jp2piG0hi4p6gNpAGaAF7UAHegQUwA0gCgYY oAKBBQMSi4C96YBSAKYBQAdqNQHBiF47jmgQgNACEk0AFAwpAJQIKYxaQCUwFoAKACgQUDCgBKAF IIOD1FFhAKBgTzSAPwo1AM9sUAJTAKAF7UAJQA7HHSgQnegYdqADFAhQCcCgYdMgjmgA60CCgYlA hccUAIKBi0AGKYC0gEoAO1MQUAFIYEUCFGcYoATtQAtAwoAKNRAKBigelMQp44xigBKQwpiCgBDS 1AKNQCkMsRHjFRI0iyYdKhmghoQhp60xEcg4qo3IkQGrIE6U7iFz0zQwAHB4pABIPamFhO1IA70A FMAFFwDvQgDpRcAyT1NIYg4oELRcYDryKBA2dxyMe1ACdaAAUAB609QFpAJQAUAFABj2ouAUDDpQ ACgQDjtQMKGIKAFA70AKQPWmAlACEYPWlqAECgYUxB1pAGKACmAdKACkAopgJSAMUAGKYBSAKACm AUDCkAY4o1AOKACgAxQIOppgL2oAOlFxhilcQmKYCigYHqaBBigBe1ACUXADQAUAAHtQMUimIOlA BSAKYCe1IBQpOfagBzoI22k5I64oAaBQMMUCD2pgFIAoCwtABQAUwCkAY4pgL1FADKQxRQAYOKWg DoztOaGrjTLSnisXY2QpoAYaYhknSrW5LICParMxKAE6UALQIKBji4MQTaMg53d6BDKADrSAWmAZ oGFAABQISgYtIApiEJJ70aAFIYYpgL1FACUAFABQAUCCgYUAJQIWgYUAFABQIUdTQMTFACqQCeM8 UAJ344oEFABRoMSgBelGggoAKADBH40DACmAvrSAQ9KACgQCmMKTsAUAGKADFABQAYo0ABQAUAFA C0AFACUAGDQAtAhMUDF5o0AOaAEHWgBT7UAJQIUUDF6UxBzmgYCgQYOM0XATtSGHrTEA96QC0xiU gF5piFo0ASjQApDFpiEoAXFAwoEFACd6QAfagAye9LUYuaYE8T5GKzkjSLJM81JYhxTJGHr600Jk L8GtDIZRqAlAC0agBoGJQAd6LCCgBaACgAJoGHegQdKADPPtQAdaAEpDCgQooAB1pgB4oATNABQM M0CAUAFAB0oAKVgCmAUAHtQACgBaNQE9qAAUagFACUhiimIKACgAoAM5oAX9KNQENAAaADt1oAPx oQBQACgAo1AKACgYUK4C96AEoEHegYo7UCDqaAFZSp5oAQ0AHSnqAUABpAFABQAUDCgQUDFFMQUA FAAcigApAJ3oAXI96YAOlABQAUALQAUgEoAM0wFoAKADtQACkA2gApAFMYpNADkbDUmhp2LKkEZr I0EPWgYm4CqTIaK7nLZqyBp4PWgBO1MApCFpgJSAKAF78cUwEpDDj1pgKcZoEFIAz3pgBxQAlAwp CDigAFAAOtACk0wE60gEpgKaQB0pjA0hBQMKADtTEFABQAUAFAB1ouAlAC55oGJQIBQAtAC4IIyO tACcUAAxQMBQAtAhKB6hQIUdaAENAwoAKAA0AAoAKQB3pgA5oAKNBC9+aADGQSO1AxO9AheM0AIK ACgBaACgYCgAoAKBBQAtAB0FMAzSAKYCUgCgAoAUe+cUXAOKACgA9KYC0gE9qACgAFMBaADpQAe9 ILDT1pDCmAUCFNAwyKQEkUnGDSkWmSnBrMsaaaYmQtwSKtbGbGGmSFMYCi4gNAC54oASgANIYvHb pTASgAoABSAcqb8AD60xCshXuOPQ0DGUAAoAOlK4AKBB3pjD8KQCUXABTAXtQAlIQpIwKYCUhgKY BQAtAg7UDCgAoEFACUDClcApgL3oAO1AhdxIAPagBKLgFIAFMYUXAD0oAKADFABQAUMAoACMUAJQ AoxnnpQAEjPA4pAA6U7gFFwCgAoAKACgBe3WgQlAwxQIKBhQAtACdKLgAoAdQAcbfemAd6AEPWkA A8UXEJ3oHYU0XAKBC8YoGFAgpgHWkAEY5IpgFK4BTAWgAoAOKAG1IBQMSgBaAEoAUGkPYnQ5qGjR MceKSGV34NaIze400yRKYCjpSADQAdqAE70AONAhKACgYUAHagAUleRQAuTmgA70CE6dKBgTQADo aACgQvWgYlAhOaB6C5oEJQxi0AJQAUAFMAoELQMSgBe1IApgJSAKYBSQAOtAC0wCgQUDDtQIBQMK AEpAKKYBmkAUwCgApAFACUAFABQAZoAKAF5NMA6GgQUDDFIApgFIBe1MBOc0gCgBSCMd+KAE5oAA DTAdg5oAMH0oASgAoABQITtikMKYCjpQIOaBhQAtAg70AJQAooAKAAUBoFABTAQipGJ2oQBigBe1 AB+VFwE57UBcepIIqWiosmByKjY0uQyfeq0ZyGUyQpgFAg70DuHegAHWgBcEjOKAEoAKNgA0AFAB igBcYoAAKAEPWgAA/wDrUgAD2pgKKADvQAGgQ2gYdKADBoAUcUABoAUM2zZk7c5x70AJQAYoYBQI APagYHigAoAMc0AHtQAmKACgApgLSAQUwFoAMUgACgAxQAUAJTQCikAuOM02AlIBKAF/CgAOM8Cg AxigBKACgBaACmACgBce1AAVwKQB+FMAxQAhFIBe1ABnjG0fWgA4oAKYBigBcjb3oAM80BcKAExi gAxzSAKYC4oEJQMKAFoAKBB2oAMUALTAME4pDDFAgxxQA3rSGGOaAD86ADFMAxQAlIAoAlRs1LNE xJaEyZEdUSAFAAM4ouApoATmgAHWhADe3SgAA4zQAYoAMUAFACqpNCACOMCgAxjimAY7UgE6UAL2 pgFIAxQAhpgGKQARQACmAmOaQBimAuOaQBTAMUagLg470XEJQMSgBccUAJQAYoYC4oASgAxQAp4o AQUALigAxQAUAGAfWkAdqYBj0oAP0pAGDTAO9AARikACmAYoASkAuKYCYoAXFFwDFGoC4oAMc0AB 4o1AADmmAppAJigBAOaAFxQAmKQABQAvPamAUAGKADuKAD8aAAj60gDFAABTAOlABTAXGOKQB0oA DQAYoAWmAEUgDFMAoENIpAFIYc4p3AKAF4xigBPalcBKAHKcGloNDnPA4ppjZHQSApgKKAEpXAXp TAD70AB69KLgJ0oAKACkAYoAXGBTAUMVORSuAFy3UUwG0gA0AKOlMANFxBQMSgQYxQMDRcAFAgxQ MKACgAFABQIWgAoGBoATvQIOlAwNFwCi4BSAKdwCi4hKLjF+tDABRcAHSgAoAKADpRcApAApgFIA p3AKACgApAFMAoAKAFxRcBcUAL1oAMUAJ0GaADjFABxQAYHp+VACfjQAooAQd+M0IBaADFMAo2EJ QMKQCUAL7UALggdKADNO4C44zjigBPrQAe9IAzQIUUDEpgLQAUCD0oCw08UrDCgQUhgaYBQAmKAD 8KQAOKAFJ4oAQ/SgBe1MQmaLjFpCDtQMKBCGgApjFJ4+lIQlMYdqQWD6UxC0hhTATpQA7K8YX86Q DwUA+7zTEMO3PAPtQMSkAlABQAp9eKBCU0ACkAUDCgQU0MKGIBQMKBAaAFx+FACHjigANACUDCgB aBBSGJmmAtABQAdKACgAouAUIA6UgDtTAKAAikAUAJ3oAWgAoAKYCigBaACgQvWgBMYH0oAPTFAC EE8CgA70DE6mgBe1AAKAHbyKAE754oAPwoEHHpQMKBCUAFGwB1OaBjmbceOB0oENoGLnj2oEFAwB 4NAgoAUDigYlMQvSkACmAZoAbSAMUAGKADFABQAfhSASmMKQBQIKYwFAC0CCiwxKAFHHSgQlABQM KAA0CCgApDF70wCkAnagQUDFFMQcUAJQAUXGFAB0oAMUCCgAoAOtAAKACgBcUAJQAGgY4CmIQ8Hp ikAnSgYd6BCUDFoEHQ0AJQAuKAFxxQAmKEAYoGGOKBBigYUAKBRcAoASgAoASgBaACgAA5oEOxgZ 7UAKOF5pgJ147UgFx2pgJxQAgNIBc89aAD6imAfLz2pDDFAhBxQMTAoAXFAC0wEoEFABSASgBaAA UAL2pgIaAFxQAgpAHSmA4flQAcY560AJSAUUwDigBtTcYA0AHai4Bk07gHFIQlFxhQAdqADFCAKL gLTEHPNIYGncA6UhBQMOlABTASgANIAoAMUwAikAUAKBQAYoAADTEBFAxSOMGgBMUgEHNABQAvJp iEoGBpAAp3AKACgQtABQMXFFxBmmMSkIToaBhSATHrTuAUALQAUAFAC4yPwoAQUALii4B0ouAUAG KAE70AL3oAQ0AFK4BTAKQBTAcBzQhCkZPHSgYhOTQAuOOaAEPFO4CUgEouAUCFzzRcYZouAZ9qLg FACUXAWi4BzQAGi4B3oAUjpQAlACDigBRQAtMApAGaAEFFxC0DAZoEFAC0wEoAXFADKkYtACCgBa dwAUAFACUgF4wOaAE7UAFMBQBRcAz2oAO1ABikFxKeohfagANIYlMApAApgGOaQXCgBe1O4B0NAg PFIYopgFIBKAF56UwEoQCEYpAIOKAFzzTAPxFAAKACgBaBBQAUDHZAB9e1Ahp60AJSGHemAUAHJ6 0gFIwaACmAAd6LgAoAKAAUAB4FACdKAChAL+FFwAc0AHNFwF+tACYwKLgJigAxzSAUCmFxeegoQB kYA7UACjHJoEBb06UXASgYUAJQAUrgFMBM0gFoAB0pgLigBfagAoEJ3oAKAD6UDEoAXFABQIWncA pDEGRQAp6/4UAH1pAAyKYh3t1pgJxSAKYBQAlKwagaBiUCCiwxaBBjBoGJzQAYoABSAMUwFoDUB0 oEFAxKBBmgAoYBQMKBC4oGJjmgAoEHegYvagQlAC0AA/CgBaAA9KAE4xQAh68UDCgBMUAOCgoWyO O1ACUAApiCkAUALjHf8AKgAzwKYCGkACmAoGTgUgEPH1o0AO1ACUDFJyc0xAKQw7UwCkIWmMAKBC cUhgOlABQAUALTEJQMUCkAmfrQAe3WgQuaAEHSmAtABmkAE0xgOaQgFMBMUgDHNAw6UAGKAEFAC9 KACgQuaBi09BBQMTgGkAfhQISmAd6Vxi0CAUAGaYBQAooASkMXigAzTEKOaADvQAdqACgBlSMOtA BxQAUwDigQfSgYUgD1oAKADvTAUYoEFAC9aAEzxSAOKYAfrQAlAwP1oEFABSAKAFpgJ0oAD1oAWk MBjvTEFIAoAONvSgBO9CGFAB1piDvSAKADpQAUwDFABQAflQAvSmAn1pAFAAcdqBiUCFxQAdaAAU hhTAWi4goABjFAARQMSgAouAUAHFAC9KYgpbjENAB3pABNMA4oADTEFIAoAWgAFABn0oGJmkACgA yOppgJ3pAKaACmAUAOyNvv60CE6DrQgDrQAUAFACfjSGFMBR9aEIKYCmkMSgQGkAUwAUXAWjYAzQ AoOO+KAEzzTAaakYCgAwaEIOlAB24oGGaAA0AGKAFxQgFYYoAAaAEoAcBxmgQ3FCGHemIKQABQAE 5OaYB1FAxKQAKBAaBgKAA9aEAuDjNFxAOKLgFAxDQAZ4oEJ1oGL0oYkHegBKBi0AFFwChAByBTEF AxcUbAIaBAKAFzzQAmaQCUAA4oGKKdxCCkAvSgYHii4BTuFhRSuAUALnA6CmA2lcQdKYwHWjrYA7 0AHpSAXpQAnc0AFACdqAsKKEAHg0wsFAgoGHeiwC9qAExSAD7UAB4FHUBKAFPGKBB0pgFIYv60xX CgYCgApAHSncBDxSAO1AWFxTAMjigLC9aAEpXEJnnFAB6UxiikAo6U7CDHegBe/4UwAetID/2Y== ------=_NextPart_01C8E823.DA10E9A0 Content-Location: file:///C:/8E69C634/Classof2004_files/slide0112_image015.jpg Content-Transfer-Encoding: base64 Content-Type: image/jpeg /9j/4AAQSkZJRgABAQEANQA1AAD/2wBDAAoHBwgHBgoICAgLCgoLDhgQDg0NDh0VFhEYIx8lJCIf IiEmKzcvJik0KSEiMEExNDk7Pj4+JS5ESUM8SDc9Pjv/2wBDAQoLCw4NDhwQEBw7KCIoOzs7Ozs7 Ozs7Ozs7Ozs7Ozs7Ozs7Ozs7Ozs7Ozs7Ozs7Ozs7Ozs7Ozs7Ozs7Ozs7Ozv/wAARCADxAKsDASIA AhEBAxEB/8QAHwAAAQUBAQEBAQEAAAAAAAAAAAECAwQFBgcICQoL/8QAtRAAAgEDAwIEAwUFBAQA AAF9AQIDAAQRBRIhMUEGE1FhByJxFDKBkaEII0KxwRVS0fAkM2JyggkKFhcYGRolJicoKSo0NTY3 ODk6Q0RFRkdISUpTVFVWV1hZWmNkZWZnaGlqc3R1dnd4eXqDhIWGh4iJipKTlJWWl5iZmqKjpKWm p6ipqrKztLW2t7i5usLDxMXGx8jJytLT1NXW19jZ2uHi4+Tl5ufo6erx8vP09fb3+Pn6/8QAHwEA AwEBAQEBAQEBAQAAAAAAAAECAwQFBgcICQoL/8QAtREAAgECBAQDBAcFBAQAAQJ3AAECAxEEBSEx BhJBUQdhcRMiMoEIFEKRobHBCSMzUvAVYnLRChYkNOEl8RcYGRomJygpKjU2Nzg5OkNERUZHSElK U1RVVldYWVpjZGVmZ2hpanN0dXZ3eHl6goOEhYaHiImKkpOUlZaXmJmaoqOkpaanqKmqsrO0tba3 uLm6wsPExcbHyMnK0tPU1dbX2Nna4uPk5ebn6Onq8vP09fb3+Pn6/9oADAMBAAIRAxEAPwDl9Ot7 M2FuzWsDExLkmMZJwKfc29mFyLSAf9sxVaxkb7DB/wBc1/lS3E2RgVtZAQPb2xOfs8Q/4AKFtbb/ AJ4RH/gAqIyZ70+NzkCqViWSi0tx/wAu8X/fAqSK0ticG2h/74FSxr8mTT41+fgVRAqWVp3tYf8A v2KnFjZkcWcH/fsU7YT2p7uIYjIwOFoukFm9hBp1kBzZwf8AfsU06baM3FpB/wB+xTY9UhZhvjdf rV+2vonXIhIH1rN1Io0VOTIo9Is262UH/fsf4Vdj0ewH/LjbH/tkv+FQyX5X5UUZ9B1qGPV3jDK/ DdlxUOomWqbRqpo+nHj+z7X/AL8r/hU6aLpgH/IPtT/2xX/CsZdWkkAbJjAPc1px6vF9mDZy+OQK Smh8jLB0jSx/zDrT/vyv+FRtpWl/9A60/wC/C/4Uy21iK5ypBVh2qyzhlBByDVppktWKEum6arca fa/9+V/wqu+m6cR/x42w/wC2S/4VoyYIPrVYoWPtVaE6lT+z9PPSwtv+/S/4VG+mWWOLG3/79L/h WmIQnNQSnnimrE6meul2WebODH/XIf4VnX9hZpeSKttCAMcCMegrcLYrFv5P9Nk/D+QokgVzKtJS LKIDsi/ypsjH1qC3bFtF/uD+VNZ9zc0iiZeealXjGKijBx0qzEAWANCEWrZXfrV8II1ye3NVvMS2 gL+nes+91JpU/d7go4J9amU7FRjcsT30hkI3AJ0A9aaJJpY2RJCD3Vhyay3uinzRxM3qetC6xOhJ UqMetYu7NVZFxhIkwM3bkDsBT21cxY4wM/KBVK41JbhV3H58YJHQ1lSs28+naly33HzW2Osi1GIR Bi2GbJzVaTU4p0kG4BnOVwelc99pxwcn8acLhcqFAT6darkFzm9bH590kue/JrR+xNJH50VyGJ52 jtXMQunDFsk9s1tWb4KnJXHdDn9KiSsXF3JRJNEHUsQ2QMetauj3xjlaGWQ4PABPQ1hajnzg0cis rfxJwD+HY02KVvPAAy38LeuKIu2oSV9DvARjjmlKjqRWZo1/9rh2N/rE4PvWmxODXQncwtYimkAG BVU8nipJiAKiDcVokQxGUEYNYOoKPtsnPp/IVsyP8pIrBvmzeSc+n8hTewGNCy/ZowT/AAD+VKv3 gcVBDnyk4/hH8qsqvbFZlFhCGHAqaLGcnjFRou0UkjhEOR14pNhYXULgtbBUbvyPaq0EnnQtE3BP eqs77mYr64pFmZgMDDVm9TRWRpwsYAUKDp2HWsm6uPNnPlwjHcY61aiupEcFl/HsafLeeaCBGu/O AcVK0Y3qjNcFFIbCknOPSotzEcnNWJ4nZxxz0/GlSzLHaO3WruRZldEZj0pGjcHlcVa8mSNiyjj1 qWNtzjzFz60XDlKIZlOQO/5Vq6ZeOrgvyBVa5jDOrBcA8H3qNY2gn2ZAI5Bz1pPVFK8WdbdW8M9q bg4VsdR/FWKrN5wK9F9D0p6SymIKH4PUdRSrGw5AY9/asrWNW7l21vpLa4MsYAz3zxXT2Ooi7iw2 A/p61xyONpHcelamkTlJlUjhhwa0g7OxElc25id3FRjnipfvdqbsZeSOK6+hz8uoxkGOawL8D7ZJ x6fyFbspYjCmsC+4vJOfT+QqXsVYxoF/cR/7g/lVlFwOlVIHPkxjphRVtGZhjFQgH7+cVn3tyd6x j6mtWOAsue9YmpYW7ZfbkUSVkCIyxGD1qVAAN/SqqsQMNyKkklUoAOKyLTJmJkYKM5J4Fa1jYL5b MevQcVlW2Gkjcduv1rqrFQY8gfWspytob0431KcemeY7nHIHXFXY9GQW4bv3rQRRCTxwwq3CABz9 xulYuRuoIw7nRyVxGvGOtMt/D++QALycCuut7YlBkZHTFWbe0EF3yvykZHtS5mXyI5K48N9AF4FZ 2paGWiDKPmVQa9Ke0DyggDpVSTTFJPHqKfOxOnFnlcKTWzYYHb2NaC4lUbpM/jXRatpCQn7g2ntW BLbrE3yxnI75rTmuYOHKKsEaAiNSzHqaktZBA+TjKjpUBuSFwoxx1FU/OZWIyST61STIbSO4spkn hWReQaml5GKh0CLzNJRiOeatyR7TXZF6GLM6VCfuisC/gP2yTOe38hXVmPAziuf1H/j/AJPw/kKG yDmraIGGMnn5RWnbRKRk1Rtl/wBGjPX5R/KrUZfHFCQrlxSqDANc5qyEXhYjhuQfWt+KBn61S1S1 RxtbhkHBJqZAjnmOBxTMnIp86eW5UnPuKiwazKNzw/bC5uCrdK7Oy0hsfK+R9K57wrblYjKR948V 32nqojycD61y1NWd1JWiQxaSxAzyR+tW7bR5+ijj0IrXtI1cfKV/Or0bCLggVnY6EZUFmYWwwwas TxKEEijdt7VrKsUq5Kg0htox0Uc0WC5nRhWjDoBxTJVxITjKkVppbW6cEqM9iaa0Fr90yjjpz0os FzmdYsTNB8o5wa4HUCbaQxyYBHvivX7qzRoCyMGFeUePrNra4jlXgPkH61cFdmNR2jcxTNEWyCN1 RybQ2See9ZKSMGyKuIshUgfebsOprp5bHFzXPRfDc4l0qNVGMCtTytx5rm/CYlhj8uX+I8YrqyuB W62IbKMqc4Fc9qcQGoS/h/IV1LRMxzXOaqpGoy/h/IUMk5S3P+jxf7g/lWjZhScNVC3AFrF2+Qfy q3byBeMVSegjVVFAGKwNVWY3DRDjv17VsRTEkZqrrNp5iLOvXGD7VEikclOuGx3qIDLCr8NqJNSS CToxxWne+GWgt1mQNn6cGsZSUXZmkabkro3NFQCwjK9MCujs0D4M8oSMds4rG0SA/Y4k7gVdvNMu rjau4iPPIHeuVvU7orQ05LvS0fbDqIV/7o5q1bytsLxXJkx1BNZ1n4fPmpIG8nYwbAx1Fa09nGkk bqRHsXDbR9760SSsVFyvqjY0ef7TGRnkVevN0cfBIzWJ4fcJduFztPTNb9wFkI3jI71K2Kb1OcvZ IYuZpXJ6kA02y8Q6VEdrRTDnG5we1aE2nK0zmNWIcYOR0FV7fw6kbs6sSSScNkjJ604pdRSv0NBL i2uohJaSgqeoFcL8R7UtpiOByr12dhoS2MrPG2AxyV7Vm+MLBbnTJFxnBzVRdmTJXjY8SiRg2GUg fStSwETOrFvL5wSw4FddNoaJY70VPlQsSi+3euVshHPKFD7UY4ZcZreM+Y450+Q7zRIomiWSIAN0 ODnOK2SvrWVpduLcp5CbV7gDtitV8k9K6ImDI2YjjFcxqv8AyEpfw/kK6llOOmK5jVk/4mUv4fyF NknI26breLHTYv8AKrUUXNVbZiLaLH9wfyqzGzDnNK+hVjQjRVXJ60kj+ZG0ZweOlMjfcoHWp44C T0poTOeuLCRLuKdDld4ye45rtLoNParap/EKx76zLW7FPvdfrW3p7+dFDMuA+B7j3Fc2IWx2YZ6N DNJXYoTuOK7DToUkAEgBrlIR5V6ykbec4rqNOlAA5rmOpGz9niReFA/CsrUTkFRitQSq6Vg6tdoj eUn3j39KTKSJNEcLeEEde9dI3UVzXh0LJOysfmHIro7gBFX5sZoS0GyVBz0qcAelZsV75UwjkGVP RvStFXBGRVx1MppoRxxWRqNv9oHk9d3GK1nYYqi4Et0qg470McdjBvLZLPQL0YwUjbH5VwvhfS4J Y5bmZQxLcAdiK7TxtdLZ6JLbqQGnOwevuaxfCunbom2uAicAY5J9a1pI58Q9UjdsoVjgG1QCR0Ha pCpzU6xeWuB2o25rpRykQUmub1hP+JpN/wAB/wDQRXW7OOBXK6yP+JrN/wAB/wDQRTbJscPaxlra I/7A/lVoR4AzTbEqLSHOP9Wv8quYVqi47C2iqpy1acbK64FZ6qAMCrVvxxVqQrEkiqqMW6YrP0rU TE7s7DyGc4b3q/OhkiKjvXPy6dMjlEMm0n7qjiomuZWZdOTg7o6iW7gnnWSCRWOOdpzW5p8xKivO tJJtNTCsrqHyp3etd9pbA4PpXJOPK7HdTnzam9DK2w88Vl31v5rHHLHvWiikwBk75zWDd6lcW91t NqwGfvHoayOhO5LZ29zZTCWFWJ7810MUc2pIGmVlA7E1kWWuTxdbTcD7GtRNau3/ANVaY/4CapIv kkacVqiReWV4qVd0a46isePUtRluBGIEz3zxW1B5jRZmADdwKLGck1uMldtvHesHUvEFnoTefeuQ G4XAySa6CXhST2ryX4h3QudSitQwwgJP1NVFXdjKcuWNyl4h8RN4jvg8askSNhAa9D0TTkstPjVM sWAZmPUnFeZ6JYC4uIrdcEuwz9O9ew20Gy3VRjAGBXVFWVkcMpOTuyEr2pnlnPAq2Y8daru+1vaq IGs2BiuS1k/8TWb/AID/AOgiupLZPpXLazj+1Zuf7v8A6CKAOJszm1i7YRf5VdRm96r2MQNpCf8A YX+VX4o1yO9Uokiw5zmtCCPcetQxxDOavQhVqkgHLABUyW/tSowPNXIQp5osBymrabfpIrxJ5yoc qw6gehrY0a8yoDcMOo9DWyAp4IrA122k06Yajar+7JHnKP51jVp3VzalPlZ0qXflqBu4JqfykmI3 DINc1BqCTxKc4OMgGt+wu1eNTmuJo9CMjXt9Mi2/IxT2FW4tPCn5pCaitWMmDuGBWimPWqVy5Sa6 jEt4ovuKBSs+H20PIE6msubUUVmOaCPUm1C62x7Vzk8cV4p4r84+JblZDuKsAK9baQ7GuZeMD5Qe 1eN+Ibo3Gu3Mozy2a0pfEYV/gPQ/A2h/ZLb7bPCVkkGE3DkCu1iUKoCjivLPD/xGmtY0ttQhEsaA KHXhgP616BpPibSNVQfZ7tA5/wCWbna1dVjiTNOQDbVBoyzcZq9MwAqpIzKMihIGyCVdgrktYY/2 pN/wH/0EV1UkpPWuU1dx/ak3/Af/AEEU2ScvYgfYoP8Armv8hV2JhkVQsm/0OH/rmv8AKrae1WhF +OQZqwkmcVnocVZiaqEX1YYqaOQgcGqiEGpQ22kxpF+OcgjNZniq5H9kmPu7Af1qyj5Fc74kut03 lBsiNMkehNZVHaJtTjeSG6RJ9p08c/OnFalpfXNt0G9a5nw1dAXMsBOA/IFdPAVSfDdDXFNWlY7Y e9FM17TxSYhtaNhV1PFbN92NzUVpY21wASgOfatOHSrdOiDP0qTS7Kv9rXd4u2NCue5qxaWLBvMm bcavC3ihGcAfhTZJVCnbTAyPEN55Nm6r1xXkd4266kY9fWvRPEUxdGUGvO79Nkx/2jV0fiMa/wAJ Vxg/WpoppInBViMVXyOc0/cV6ciu5HnHpfg/xgZkTTr+Q7hxFIx6+xrsZG3DFeDpdsmGX5SORiuu 0n4jT28ccN9AJlUY8wHDUncaZ6C0O7muW1eMDU5h/u/+gitvTfEemaqALe5XeR9xuGrI1gj+1Jv+ A/8AoIpDOP04A2UBJ/5Zqf0q6rDpWXZSEWUA/wCma/yq7FIT9a1WxmXV7VMhqqjN3qRn20wTL6SY pZLqOFC0jhVHcmufvdfitgY4sSSfXgVzt3f3F4+6WQt6DsKlsdzotS8WCPKWQ3HpvPQVgSXs00Ur yMXkkbljVFiatW8Rltm29UbOKxm+5rTu3oP02Q294kvIOea7hZBLCsi9RXCQIxLNjlef1rqNLuv3 QRjxXNWWt0dmGdlY63S7p1IANdHBMxA5rjbC7+zyAOMqT+VdHDqVuEBDZzWSZ0tGhNM205qlNN8p 5xUNxfhxkdKoTXeQeaGIoaqwcHFcFqsga7ZR/DxXU61qC20DNn5jwo964iR2diSepzW9GOtzkxM9 FEXvSE+maTkAEgjPQ+tCnPauo4hAc0uMnik5zgU8cLx170ASRSvEwKEqR0IOKty67fmQ5uXJ4GSc 9qo9qjcjcaHsI2rM/wChwY/55qP0q/bAmsyzOLWHn/lmv8qmn1EWkJCEGTsKtbAaF3fRWMe5zlj0 Ud6wbzVprv5f9Wnoveqc1xJcSGSVyxNQ5GcVLkFhSeeaTNIcUmBmoGKTkcCrNlP9nmDnO08MPaqh pRgHr+NJpPRjjJxd0dCtkGinmgO6No8g/j0qWyJCisSz1Gazc+WdyHqp6Grq6tAgaREk3HopIIrn lCWx3QqU972Z09vMdue461divlTGF5rkLfxGYnZjEpX+7nrVtvEVnwwDg9wB0rP2cl0NfbQl1OoN 6ZG4NVNS1SCxg3yt8x6KOprnpvEq+Xi3iJf1boKwLq6lupTJM7Ox7mrjSb3Mp11Fe6Wr/UXvpzJJ 0HRR2qoCCfaowR0o3CupJLQ4m23dkuT0JJx09qAcYxTAQeopR1AwaZJKig07bg4pFGOvakz82WUk emaoQ8IcCo5IzvNSGXnKrioZHO80nsBrWpH2SI/9M1/lWdfKxnLHvVy0lBjgj/2B/Kpr+3DxA8ZX ms5TtJI1jTvFsxACO1JzU5T2qJhjj9aozE7U05OKX2o5oAQ5pOacSaQ0gDGTTsD3pPpmgEg8cUwG kCjNLnnpSgHrSGAYjgHFI2TjP0zQBzTmOQAOAKAGDgUuMGgU4CmAoGR0py5DZ7ikzxSr0qkImZwV zTMFh1poPOM4paBDgMVE5O89KlH3e1RP989KGBJbylGjf+6BWzcMHgJHIZawEbCr9BWhaXRaMwnq Ome9c9RXtI6KUrXj3KfmYb+lNYgkevtTXP7w/Wkra5hYd8oB+XJ7H0ppGMYpQeRngetI3X+VGgAa SlbOKTPXFAC5yaVvbFN+ooJNMA/GlxxSKRilzxQAnfNBzRRnmkAoGaUU0NTsmmAppw6fWmZPPFPU nHSmmFhMZ6npTqZk56U8GgQ4fzqN/vmnCmOfmND2ARfuj6ClDFHDDjFIv3F57UpAqOhSEJDOWHc0 HGKcq0bcU7CGcA044LDtSbfelAFAXEbGcDmmkCpWAxTNvXmgBB9KCvGe1OAApW5z7UwIvWlHSnAC nBaAGDr0pDxT8etBUUDGouT0qTAAFIpAGKG55zQIQj2pQFxxmm4OetPCjbQA3jdyadwKQjnmnEUw FHTNMf75qRcYqNx8xoewiJfuj6Cl70UVmUP9KG+8frRRQJjW6/jSCiihgDdaO9FFAAPvCg9D9aKK fQGNH9aeOtFFIYHrSdqKKGAg6fjThRRT6AN704UUUIQHqKVvu0UUhipSN96iiq6CP//Z ------=_NextPart_01C8E823.DA10E9A0 Content-Location: file:///C:/8E69C634/Classof2004_files/slide0113.htm Content-Transfer-Encoding: quoted-printable Content-Type: text/html; charset="windows-1252" CHSAA Hall of Fame
Scott Stocker
(Rocky Mountain News)
nPerhaps the most recognized prep sports journalist in the state, Stocker has covered high = school sports for more than 30 years. Stocker started Colorado Sidelines newspaper in 1971 <= /span>and published it until 1985. Colorado Sidelines was a unique publication in the country as it was focused strictly on prep athletics. It became = a staple in high schools across the state and the = Stockers risked much of their personal financial <= /span>health keeping the paper afloat.  In 1985, Stocker accepted a fulltime position with the Rocky Mountain News and his personal publication venture came to an end. But, throughout that time, Stocker had cultivated a generation of students and coaches for his News prep reporting career. Stocker founded the Fred Steinmark Award that has become one of the state’s most prestigious awards for high school participation and academic success. =
------=_NextPart_01C8E823.DA10E9A0 Content-Location: file:///C:/8E69C634/Classof2004_files/slide0113_image016.jpg Content-Transfer-Encoding: base64 Content-Type: image/jpeg /9j/4AAQSkZJRgABAAEAyADIAAD//gAfTEVBRCBUZWNobm9sb2dpZXMgSW5jLiBWMS4wMQD/2wCE ABkREhYSDxkWFBYcGhkeJT8pJSIiJU03Oi0/W1BgXlpQWFZlcZF7ZWuJbVZYfqx/iZaaoqSiYXmy v7CevZGfopwBGhwcJSElSikpSpxoWGicnJycnJycnJycnJycnJycnJycnJycnJycnJycnJycnJyc nJycnJycnJycnJycnJycnP/EAaIAAAEFAQEBAQEBAAAAAAAAAAABAgMEBQYHCAkKCwEAAwEBAQEB AQEBAQAAAAAAAAECAwQFBgcICQoLEAACAQMDAgQDBQUEBAAAAX0BAgMABBEFEiExQQYTUWEHInEU MoGRoQgjQrHBFVLR8CQzYnKCCQoWFxgZGiUmJygpKjQ1Njc4OTpDREVGR0hJSlNUVVZXWFlaY2Rl ZmdoaWpzdHV2d3h5eoOEhYaHiImKkpOUlZaXmJmaoqOkpaanqKmqsrO0tba3uLm6wsPExcbHyMnK 0tPU1dbX2Nna4eLj5OXm5+jp6vHy8/T19vf4+foRAAIBAgQEAwQHBQQEAAECdwABAgMRBAUhMQYS QVEHYXETIjKBCBRCkaGxwQkjM1LwFWJy0QoWJDThJfEXGBkaJicoKSo1Njc4OTpDREVGR0hJSlNU VVZXWFlaY2RlZmdoaWpzdHV2d3h5eoKDhIWGh4iJipKTlJWWl5iZmqKjpKWmp6ipqrKztLW2t7i5 usLDxMXGx8jJytLT1NXW19jZ2uLj5OXm5+jp6vLz9PX29/j5+v/AABEIAwgCaQMBEQACEQEDEQH/ 2gAMAwEAAhEDEQA/AMpRkkY5qiBoJBosAjDBzigZIiljgdT2pARkbWwRyDTAcuM/MO1ACDpQMaD8 vpQIVWCbgRnPc9qAYM24/d6D0pDJsjewx3oYMlVAqEgcmpRI3BX2NFxjfKJfeetF9LATHK4BH1pb gNJJGQMj6UDILlP3XJGf5VSEysASMbefpT0AcRtxn+VK+gbCOTt9j7UCGKw3cimxB1Pp+FIYKDuI x+NAEpGzBHUjmkHQiJL8kUxihdnXkUaCJBCWBf8Ah9qNABW/hC0guIcmQcUATJntigY4ErknrSsM eYUeHcuNw9aCTOcENyKoBKBD0+lGgD1GXFIq4r8dvrRcQnYcfSmgfkPQHqehpMaEI2ngfpSFYcwY 42gfhT0GOVCD0+tAMDCSTt6d6OgXHxLtI5GKAJ3dSvyLtHr60CSEkXcisaSAiKgfNkYNMYmdzDHU UwIiMk565oAVhgcAUAKGYDaBgUAKvJyetADnPFIERSHA4BxVIRGCe/SmGwoPAxmgNywi4IA5NSMj nDFvWhCYioGUZpD3FZCo9adxMjIzwePegSE+5xxTDYDz9fpSH0FCnb0P1oENUHinoIkRctSKBzt+ UfjSHsRNxjAp3JHKCR83Qe1AxQA7YxjmkNbg7hy3GcdDTAjPTgdKBAFOM0B8g5/KkHQMYI7imO44 ZXn1pBYD27D+VAeou0f5FLQdiYnk44rQQ08jpQAE5IBPSgY9DtYEZ4pANdjJJuOM0wDgYoAXbhAe Pm96QCMNvbOf0oC408MMYzQGpLZmMXK+dGXQ8FV60rgSMoExOc4wPqaGMdLJnGO1ImwhdWAz1FId iWNcH94flIpN9hDZcLJjPA6GmhkKs3IFMB7RblG7pRcRXlURyYX88UXAayM5FCdgsHldsigCOSMK eCAPSncGMAweeBRcQ4sUzjGD2oGKCWGCentRcTERcnAAouGopjwcEg80XAnD+WoVQCTxSGNaLau4 9frRcRG248YwKBj1O0jjmgCV3VvlAwaVwExtAFNANdFfngmlcCCSEoOMEU7hsCAZ4psQvQ9cUrh1 F5YHpigYm07famIkRSc8DgUikLyT0yKVwFRSD0oAkJJAAoJZMoCxkkYzwaVxXEDKgwMU9QvcY5y4 OaZQ9QTtU9DmkgKrKVYqAODVAKGPYc0AOI3D5sA+tJABUgYxRcYh+8PSmBJlR6ZoEMfHTNIExpK7 dvemBGy80wJYbfzDkdBSuMfLGwwQ2OKEwZCz7TgmgGKZVAIXn3xQCsNWQue5FJgJtPfH0ouK4u0Z 6DNO4gcY4HWkADIYDHUY6ZoTHYcI2VSxHSi4JCBtpOBz79qBjX5zzRcnYQcqKYa3HE5HagLifdDM Op4oewIjXPTHNIY47fTpQAgx3GKBMVgDjFAxgxuwaAWhIEzGG4x9aLgBAwOlK4B8nrTuwuibGasB 0TAEk49gRQIZn5huHbsKB6ihtv17UDG5JJ65oEL1PWgExSPl46igBjEkCgGxQpJyOwzzRqMFJBwp I7cUgJQWyAvXpSAd5bDGT9aQhp49qYx4kyNpNK1gA5PU59KAFHFIBS424JxRYCOQRg5BzT1AaG7d AKAGsTjoaNQI3U4BwaauDIeSD7VRAmaWoxck9O9MCZImI+9jPapuO4kkHlkEHPtQmLYcXUEbQc0h huJ+8DRYLiP8pBx70K7DYaHJfP5cVQrjnypDYIOKQJiG4ZgPai1guIAd/XqKYEv/ACyJzzUajvoR Rgjpg1TTEmIxxxjpT1ECA4pO5SY8LxjvRdhYCdgwc809xXZLbsC+0j6VLQXCVyG+XPWiw7kkLswL EDigkTzCc+npRYTYvmKVw1K1iXuMZ+RkYAqrFIlMnKlRxSsUhoT/AEgN/CeaOgBMAkh2gcimBGzg L0FGoEfmOMdfxp2HcDISp56elFhCIxOe1AXFD8gdaGmCYHG/oQfagEKELSbR1oHctxfKgFSxhKVZ vbvQh3KckWG5qkxMCoA4Xr7Uak36DQSp6H2osK4qNnPIzSsxoRiVOO9FgHbCcetAD41G4bgT+OKB jipUEEHGKQDHjw5x6U7gxnXAPFAhpxuwCfbinqIcoJosFxCRikMaBzxn60DSDGSBmgVxwXPtQAh4 zmiwhnfGDnNAxwclMcnHFLcdxoBkOFU0wDP1qiCznAPvQUJtx9KBoVyp4/WgBFUk4yAfegYDoenJ pCA5UlTjimGohOQf8KQ9QPQUCsGOlAwVTuIo0AkCnd94CloArMSSc0hCbSRmjQAUE9aAFOQeTQMc VyMk8UIBpT5c5/CgQ0rzmgYm4AZIoAGlG3GcZoARz8gHanbURWOM4FArCEbsUaICWFBnOcY9qGCu SB/3h2jtSGNbJYEnOaWgC7Mcjj8KAEADZG79KegMRix7cfSloJ3JI0CrnHNNjEkBbg9+lGgEIiJ4 6UbC1HeWdmc0xDMHaQT9KQAvp3puwgb71Gg9WO3YHBpaDWiFSTBHNFguxXbn/wCtTQmLFJtbnBAp AkSkbxkDJouJhh0HsaNATuMUEkljxT0DYeq/j9KQEgRSOoz700CY3BC5X9KB3JN/yoSelIYj8/Mc YoC4xIxIpZuBngUXsJiTqhOAKEwIig29OaY7DVQrTFqG3H1zQMUAZ55PagESgoxLjII60gsPV8gg GixQBt3FFhEUv3utCAjZyV7GqsidSPv1pW1Cw6NDyxP/ANehjSGliTk+tICSMljwefpQKzH4IOTS GkTJKwUjA4707jGu6NjZwfpQFyLYR1H4igmwGNdvJ5ouNIap+bAOKLjsD49xSAYAwx05ougFAKue 1AWY9OVK59xSC2gu3P3scUAMYZJxTFqRgH8KYDkC5IYkewFILC8/3aLjsyfGasQowQBQMay7W4oA UgFcj71AWEA5xjFAAVJbHQigYBTjpQAm3ii4C4HfqKAFUYJNIAdsgDFAABnIxxSuIdnA4oGIrg8G gCQ4CE9aAFXHl59aQxTwAMYoEQuu5TzTAbGoHbj1oEDooO4EY9KLhYhZs/w4HpTQn5EfckCi4DlH HSkA9CFzg80MAHBzj9aQwYsCM4FMBCwI65oEClV6dfagYocrQxEm7A3Y7cUrDbsIjF2GRxQwGEFX IYd6YDlP3z2xQSQHpRdjBcDFMQrHJ6e1CAOOmOaGNC+nAoAMZPFFxDlUGpuMeZPKHA609xDhKZPe jRCsN5ouPYcjHpjHvRcViXAPegdxyRsIMkYBNHUByxAuF56UrjGMxV8HkDtQAwuAMDIFAhmQe9Aw RfMY8dKq4hsgOcUXHYQjaB3ovcSGg/MCaEMnjQg9Mg80hscRjBFMQZ+agBj/ADHpmgBhiB6cUXCw hhAIJPFFwSGPk/w4HaheQDCpXqCKLgOjUluAaTAsrjbikNbCFegXpTAjzhulAIfFI0Z+6CD2PQ0A K53IoUYIPNADfJAbjNAA6gDG3mkCE+ViAARQGhIkQYYPXt70AMKGOXAGT60AEnzHpz7UgGhQV6c9 6dwGldx5FMQFcdqEDG49v1p6iLOSOlMoUKd2aAQ18k+lFwDkKaQxy/KBwMmmApGG3DkUgEBINACb iOmKYCHJzmi6AchxgGkCH7eOmKAAjHTrSQhqBjklSR2NAA6A9sUwG4dB7GjQB8bgrjNIdx0jgjCj OO9JCIGVxnpTATBYcnNAEnlFU5xii4EDAjnAxTJsR8nrigYAsCMHFAthRkn60XGXY9NkkiyHHTpi p5kA02JQHdyaOYYhtljGSuQR+VFxDcKE+UjPpTAhcEccGm2Awk/hQAqMVxikBdaJZAM9+RSuBAXI LJ0pgQsuM/1ouIbTuAuKLgKBgHNACnhBgigAHXmk7AO5HQ5o0C4pQuOMZzQmF7DGV046U7gIrcEn rQDJEkYDHakGg8jgdqEGpd3KbFcdQaT3GhnnAPuHBAxSBlR2JYk4qhDNx7UwDOR25oAVSVbrigAI YnNGwAdwI3DFAIOS3AoGrkgc+vFAxQ2aBDWYjr0oGOBXbwvzetACMdoGeTSAM5xkdaBEi4brg4HG anYkadrEK3IFFhhEPLmwo+UjnmlLVAwPyyEAfLRG9tRoTG3kngmqKGuQchcUwE3ZGCMfSjQTHrk4 xzmgB5O0jB69qSAaeuMUANDBTnaKYDvMzgZwRSuMdvUPmXBJ4yKBCSxqXBQ4B9aA2IjuXnGKYmNU 9c0AhooExcn2p3CxMQQetMoUA5zSGSSLlFxj3NFgQnl7oWIIBHb1oC4wMTgUABBz1OKAFGcHigBO fSjQBSRjGKAFC4JNGgDjyOvNIQh/SkMeF2pQITtimAkinYKBkDI2T2J9qNBWE3PGORkUrIBWmDHp imkO4Ky5BpWAn4bJBwKAK7gheTRoBBjJyaYgosgLNtGSm8DODikwRoRznywASCOwqLBYY027JJOa dgGTyKYx859MU0gKTdOD+dUIibINGgCEngZxRZAICeuaWgy5HJkDrSsgCQYJOc01YBkmxtq9DSAh IK8ccU9BaCA800kJgfTmjQYDIxz+YosA4qSflNAhVJBxjOKVkMkB454o0Ak+z72yzdaVybkb2pA3 L0FVpYdxnlMqg5p6AmLglfWgTJFciLrxmpKuMZyW46UWAjJJbAp2QAc8g0WQBjGKGAuecYpgOQ4f noKTWgFiV43T3ArOKaYlchABGeat7lIAx5p20AnRV8ncwwSeDSERsu7IoGMPy96dguIUY8jkUWQE ixttySBj9aLIVhAuActRZDSEyg5osMTzB2o2DQC+Rt4pBcVVXIXJ9cmkK4OR5vUUAPCHaeBhevvQ rBcaGAAwelCGObJGc9sU0JiJNGFwxz6UCQ6RhvXacofagaRFJgbtuTn9KLDGMxI5HPrRYQscxxtf p29qAJmVOMc0A7kWMNxxSARl4BoQgwfSqH8iZlP/ANamIWPPOAD+NMYoD9hx9aABjlTmkMRB8vI/ GgNROAcHFAC+tACZGOpoAXGRzQA5TnrQAv3cA0AKfuikhAFYjsKNgFxg8H8aYDHOPekMUDIGQBQA OFzxQBFsUnkUhWE8juM0BYYY3zhaegWEO4ffHajQNWRZ5PFGgtQxx3oS1B3NTTUzGcDipk0BaNsp GdwX6VNwuylIiq33s/SqTGitKvzgAHFNAKyELgDmmgIjgjnFADGXmhWFYacY6UC1FRyvSjQPQvJi ZAejdxU9RkMiFTwuRTEyIEeZkjimA7YoO7OKLCux2UkbHQ0D1sIImc8DketGgriAAEA9e9Aa3HhR syT3pD1HKiEDsc0aC16E+VxikIRnyMHpQkNEYwTzz7UwI2V+SSFHYVQETFuQaRQm4ggelMCRcYJ7 0hjeTnAyaLCF2nHTgUAAAOaAuxCD9fSmIkKkJuzn2qdB6iA8Yxg9qNARIqNj5VyTxTuNkirmMpn5 l5pdRXGDqQKBkcpxzjgUAM844Ap2C4jSt2p2QXAOSTkn3pCGE98ZFUIA/NKyAeH3Z6DFTYYjTEqF x0osIj3HJI5p2HqSCT5cUrAORgcA/pS2C45nVUzuwc9KaGytu5JHFVZCHmUheOhpDJYpfX7vfjpQ xIfKI8hkbjFAETDJwQQaTGORuOc0CFB5/nRoA7dxgDIzSuMOPSgCSNsN7Hg1oIbgE84ouMXYfb86 AEAz8vfNIY4hk4HSgBh5IouANkDB65oAcoAIJw3tQA/gA46e9MBFAIpAIzcZ7igBytleaQg3Hv8A pQA/AwOcUARTlRjGMj2p3AFJVc96QxSVI75pgMA7GkBYiyELjoBipbBhAnJLYyaGK426iBQsCOOl NMLme3HFVoSAB6cUJobuatncRx24Cr81ZtXY7Cy3BYYHAp27hsVS44BoAkjH8W38TQAhyWwB19KN hMjmhAHcdsUxlZkI607isRk56/SnoAgxkdqBEisU+6aWjAm88CI+ppAV9xwSTznpVAOjG7qcClcC UIN+AcmncQuMEEvx3oAbIq79yMMehpXHqOBBjAIA56ii6DUVRiPIJxSC4vndF7etCATzCGJwCPem AsQVgDnmgGEqZPDc0wuxhDBct2oAbI4ZRhFB9qdwGpxRcZMpBzjG48UgZFJ8pGDRcBB0oEPG4DIO KNADJ29QTSADj1o0GPWRl5HGOKNBio0nzMOnemGhGsjZpATDjIZd2aAK0igE8dqdwYjrtIzgcDoe tFxBkg/MSKLoQAqcZ6UXAl8hWUsmeOanmtuLUhGM5zj3qroY3GTQAMNpoHqNAycUXAVsgDtRcBCe c0XASi4EiAOuCcYoukOwFQpPei5JLEAygc0XKWxIluSxIOfSgXUfIuxSARnpQIiIwADipuUIeRjN CANg/vVVwsyZcAe+aYhp470hgT8oIOTTAEyc45pDHFiSBmgBo560AL1FACdRkcEUASojNwMnA5oA cPl4xnPegBoUktx+VADenNAhxySAtKwEbk4B7UwuNZhuGTQAvmEn1pWGLzgHNAXDvzQA7zSF8sHg 9qVuoAsm3HUmnYQSS/u2zmhLUZTyDnOadibgDQFy3A4CgdxSY7g0mScYoFciB5+Y4osK5KJSq4z1 6VCTGLvwoYHOKYXGPI7kZNFtBpkUpPrVCuRAZ9qNhAU24wc0wuwwQc0agBY4waNQEFLULi52ninZ hceDjnvS1Bi+YcY5p6gPhcD74BFLVhqIzDB2igB67hj6UagKsbbssMUWGmPMW9CRwB1piuM24HHW gYpTPXJ+lAaiR5VsHJHuOlACMoznpRcWogAJ4FAx6oMfWlqDYzYATlqBXGhQPxo1C47jGM0rMq4m QF9aeorjCcnrT1C4qk4x2pajRditsWxkk6EetPoK+pWAAPAzUq5RMjAJkHkdsUxNEFwd/KjHrQrg VzxinqK+g5iSOAaEF2AwOvP4UC6i7yq0WuMT7y++PWgWonQYx+PpTBXBtp55PFIdxinGeOaNQJ1j DglzjC5GO9LVBdkQjywycc4+lMVwZdjEdaBpsWOJ87vuj1NILj2QBsKST3ppMLkkasBxQNEythD6 j1oAgLDBxmgBc7iM0ihrEAHg0WFcM+5/KgCXGBTEEgHBHpTBAvI5pDF7+lADR97nFADkX5u1ADgv oKAFC5XIHSgBVGwhs5PYUAO5JLYxQA7cFA6Z659KAGphmI60AJJxwtAiEjHUUrjGFcuBincQYK54 4oEPUjHPSkO4pAphcZ91s4pCFU0DQkinbxRcZDsyucUyRAMdcUDH5A/woYhAe560ASHn0pBYYxBP NACh9qjaBSsAGTcxJAX6CmAzgmgBrAfwg/jTQDhkDGOfpzQAj9ecHPNAhBjqwoAOdpx07+9DGJxn rigAz7cUCHR9e1APYUff5xQBMoXAyM8+tK47DiAH+U596BDjKAfU4xz2oHYikbHTge1MAEnSkGxI GXIyDQMkGDwrZ9qAHHkYIz+FMQwIu48AUMY4xjHoO3NIRGYAfmOQKYCeUvr+YoCw1oufvqaAsIYW x1U/Q0BYY0TD+GgCMBgeVI+tAak253UKWOOwoKFC7cUgF+7yOKADHJDDrQMgZGRt2Pp3pkiA9cAc UAB+YcAfjQKw1uDihMQoGQMYH9KYyyEBUKSAcdQKnYRBImx8DkCmncCInJ5FAybcGjAxjHepe4hV BUj5Qaqw0hrTsSemaVhiqztwx4pgkSEDqT+FMBVO3nOfQUh2E37hhsEk9qVwsIyEPtdSpHZqYDSQ CMdqQxrOOM0CGb6NALrDjpVaCEcEKpxxQAnQijQAAGeaQwOMUwFQ4PNICTzMAcZGKNAGM2QccUAK i5OelADll8tvubvZqAsMZw+TtGfSgBolK8hevFGghQ5IFLQGISQeOaNBDGf5gO9MB4ClDu9KABRx SBjXJBxijQBAQRg0aCQ77oB7UMdxrPkdxmiyERk/KetPQYwEgZPQ0aABPOAOlLQAU09LCFJ9P1o0 QDsexBoAT2PShWENzge1FkMTJosgsLnngEUaASbi0ZZu1GgyInJxzT0EJ3xSAcTz04o0ATknFGgA Qe1GgMOUOKNAHb+OlGgCq59D+FGgxwbjODxRZBYkBMzE5UHHINAbEZzjBFGgakgT5Aec0tBXFwef aldBcbnrTAXcRjGQRT0AcJm3ZJNLQNQaYluV7ZFPQBVmTHIIPsaWgwFyAcDOPcU9AuIZlxzimO44 PGynIAPbFIBy7WwPMx+FACbGP8fHbFAx6EDkoOuKAFkjTGcEA+lCERlVC8P+lAxqrznANIBsil+c UAQMpUcjPNVoS0A+lIBrKS/PH1p6ACkg9OtGgiw+QVIUjipsguROzH7oPHWmkgIc9+M56U9AsSDc SAanRjSJTgcZwMUyiHHzHAzRoBKqnb1o0AA2HAIyPSjQBMYJPX3oGND4PA/+tRoIcXJOWOaNBjSQ RwKBbEbjnihWF1G/hTEaLYz8h496QxpBULnp2oAUqOADz3pgBUg9BxxSGnYaxFAChc428n0xQAuW QFTjB7YoATJ6E5oARXIGOp9KAEzk0AIfun1oGKBxntSEBO0daAEY4IycU9RXGnbketGorocGUdKN QAZHII/OiwXDzDzk9euaAuMB54oBMd1GTQA3gHrxQK4hC4PNGoXG4AXmjUBCAelPUBoOKXQBQRkd /b1oAXdinqCYgIJPNFgAY6UagO2gNgkfWlqO43gHNAkOZgwAXijUdxjAE9aeorgoB6mkNCdRTFce F65OCOg9aWo0AJANArgMcfz9KNR3EGN3UfWjUVx3ekMccbcihgtBuee9MGx6DcMUhXsSgbQCTwO1 LUGxGkH6UWAiznPbNNJlBuOB7UWZIo5PBFAxzZ3bqAGFfSjUSG8BqLMLi9c0ajBgRg596YXEXIPB z9KATFVmLdaVwLTSxrHF5cjF8fOD0B9qYot31HmclecYNIsikKk5Ax+NMQIUHOaBjwCenekASIHT kcjuKEBW2H0x71Qhcdj2oAI0CnKkHJpMRLLucADk0krANXIVwOCOoNHUW5VfGeRgmqAcAMnnGB09 aWo0O25PUDNBQpwGz0FAAZNqkdTSC43eSeadgVxwIx6GkO41nosxEZbJ9qBXEzxTQDgwK8mgLibv b9adgui4DigLDs/LtoARlOAfWgBNuTzQMfFbmaVVyVUnlj2pMluxcSIWspKHzFPf2oJ+LcpyfM/A wR2ploZjHuKQxvKsCeaYCtkPmkAufQCgATqQTQFwYDtQAknzc9KBMYB60xbDtpA4pAxAufxpgIUK jPb1oCwLkHNArAcHjOKAt5jcc4/WgPmIy55FAfMApPHOcUD+Ywg59KBAFzmgYYxxQFhMdcmmL5i4 x64pAKemRQAqnBOc5xQCAEtweBnNLUYrADGD+dMLDcZPPT1oEOQEAhTj3pDGAeucZ5p6iFbhjtyV zxmkMSmIcMbcEck9aAGgc0AP246mkAqgYwaAADmkNIcX2AbR25z60xNCF92OeKLBYcnHJzigEREZ OaAFBxjFIBQc0ABLDoaYBuyvvQAqKpJ3Ng0agx7BAPlBpahYYxz0phYaDg54GKHqFhpJJ470D+Y3 cc80AWEOSBmkUKykHPUGmIZ0pDJVYgdfwoAljc9OooYDWz5hAQEY7n/GmBGskfm4YEKT35xTEOaS MD1Hb5aQA8yHByc+woAR3Vs4+dj7UC0sQumcdR9adxDoIwrHcDikUhfLAc9x2NA7ETAqOc/SgCPn BoEO3H6kjpQMTLdD+lACbzgetDEMJJNAg7UwFAJoAftPvRqBa5xikMBzQBISU44zTAUvs/hGT0oA USEpy+ADnFILEYkdUZAcg0BYjVWLdDmgBdzLQMRnz0H1oAf1HSgBVKhefvCgBMb5OwpAAGCaAAqS BTAaU55oJJQFAHBJoAkhVN/zHK9cUgRWlTY2NwYdiPSmA0DnHSgBWHHHNADNuSeKBITG3OaBhnAG KfUTAjOM0CGEc0hjT7UwFHWkA7qDjFAWE544oBB1PamNBz39MUvmIUg7QcUJDbAdcCgQoyAcYosA AHjPQ80MLgxP3cUuoCbSPTkUwFxwKBsAeTkcUCHDgZ4zQABSOmDSGAGWx6UAOVMklR0oFcaIjnnt TAXGKLAIoLEnjApAKfXAwKNhbjUOG6cUMdhrdfUU0GwmPwoH0JsKFwRyaRKWowHaSOooKuB60yRO v1oGN5Gfaiwxp9/0pAPibDUWGmWNp6jrQMQp69e9ADSuTgUxEkZwPSpGSlBInH3h0NAGe+VfB4Iq iQLHbx360CFXPHHtQDJEGxgxOPagBDKd5OQRS5QRJE2/qcUbFIsiJZVZFIyBlT60wehWcMynHUda BlZjxjHNGwhQcmgBD0xjGKSBje3SgQu3d90/getOwBtIByOnvSANwAHGKYC4b0NFguy1nNACjjrQ Mt21r9pjfYfnUbue9NEt2K4jLKzdk60FDCCe1Idgzx0oECykfMDg+tADZG3YHpTuKw3GOaBjxkIa QxRjb0oAXOGyO1FxC85z2NJAHPUUwFIzQAwnDGgQ7ICHOc0gIttMQhFA7jiQDQLoNz82aBDWPWn0 AaR6UtR7isScU7gAIxigAZeOlIBnf0pgOAyKQhO/T607gkPCZbHA+tK5Vhuee1MQoyRSYIUKMimO yBwcjI59KBDOQec5pXEOHPU0X1KHDGMDrQIQg8Z6CmIBgkAUgFB69M0DHK2MYpDHoAAfei4Ap4OB ikMCDjincQwEBsEfjRcT0G9+OaAFKkimA3AouIbmi4xPp1oBEgOeBzQA08DBFFwsHU0AHygjvRdh YazBu9FwsNOOMUDE6Gi4FmGXPDGkUSvgj0Pb3oAZtGeKLiHZBwFUgjuTSGSrx9aBkd1blv3ij60J kspgAZ9aq5LDORTAXdk4IHHFFw9QxxmlcQqMFIpjRcUYcA9SKkshlPlA7TyeCD2pgQLtGCeaLsQ0 nDelAgYg5ouxsaenHWi4hBQBIvzZHtxQIY1ABmlqBbqigzQCJYJHjlBRiDjtQDsKxDHKnGeTmgCN vl6Z/wAaBjcZoACPmxSATgEUAOIyCR260AOQhlI9qAGg4GKA0DI6UAPOCBwKQCZApgPBDUxCMoJ4 NIBjHFAhvJHX6UAMPWn0BWFxxnNK4xNpBzTELjg9qQrojOAf/rU9R3QpIx1o1AQEd6N0BIBlcn8K A3GfLmjUNAyOmQKAEHagQZAPIyKB3VgABbgUBuKowKGCHZHWgBpbPBwRSAPT27U3cBwXPbH4UtgD G0n+dACE5x8xoABw2c49qADGc0BYUZUAn+XWkMep5ph5DkIww6c1LAUmgBoxnmmIQlc+mKAdhHdS ODTEMOB70AJkdxx7UD0AEY4oBEkTAAgdTRqITAYnJzjmhMZH+HFAWAjgHNADMYP/ANai4CqoIPtQ AcE+tLUdyZdgAoFsPZumKCxygEZPH0oAcsm1wOoqQLC4J4pXAf0JpgZ93EEbcOhqkxNEKkBaZA04 7UajE5IpiAjnpQO6L6yMSrd1FIroQyZmmLL0JoAYwC5BXmmFxpUMp45FIPQiIoEKFBIzwaBpBsw2 KBWE5GCMigQhJJ5NACY+lGoXLppgNPSgaHITnrzQApBBNACHJFAwBx160gEGc5J60xCNmkA4E7e9 AxR93FACD0NACheSeuKBWJI4zIVVASxPFAxjAqSDxQIVM/w9aBjuhwevcUCFbG0qRwelAEJBU+1A CYJHNAhMfLmgOgmSGwDTAVjzgGkDGsOM5piGjOaAG+vNFhjs+pJoD1E3YPtQK4HnHagCYwILNJvP XezEeX3A9am93YdkRbTt3bsdsVQMljUYzk9OaQ0MckcA4xTQhoznAzQKwZGOtACEk0wFBIqRgz56 cUbCAdOtMAGc4zigYvfgk+lJiHdeOc0BsITgd80AAOAaQCq+3vTsAgY7ueaABjuHU0wEC8ZJNILA 3YDNAIac45oC4nIGaOo9h6r0bPOKLiFz8vuKQ72EXk8/lTYtbA4OBjNAEQ479aAF6HrmgoQD5uTQ IlUEnmkFiZEZyADyaLXKuSyxMPkHHAzQIiDqFAx8wPJ9aQydGxnn3qGhj1IY5yaoCK5KvGB6GmhM osp6A/SqIEIwcCgBypkYB4zRcCREKNljxjFAbigk88lelBSA56KfyoGIQQ3zHrTACpjG7saQEcih jkd6LAxm7n3FAhWbPPT2pgNB6ikIaQQBnODQAZ96dgL22gBMcigEJ0PHSgY7P5UXGK6FAM9D0oFc Y3agBU4bkZGKAEagBUHXnigYrfzHpSATbwKAFQ4PNAiTcQ3BwKQx8eJJQHPU8mmItzWggYPHhgRT 8xXuVm2s5J4pDJJZVkQBlAccZA60CSsViBnnpQMbtz+FAg2Ar1A4zzQBCwweOtMVxvTigGDEHpRc BpHPtQFxMZ7ZoBu4dh/KgAIGeB+lFwAAk9KLiH+WwAJGKGykJ68UxE0TFgASMAdxUjuRtySOCfam IZ0JzR1EJ2PpQhgOaAHHqcUXACKVwAL+dMAGAf8AEUBsKvHWgB/apuAEEdf5Ux7DegPWgVxpHOaA FPODjFHUNxeMUAhAeetAXAnNArjTyOOMUDuOK8UJgLnA7UgGnHPWgBOmMUwHgk8dKQERAGRz+VO4 xO4FADlHGaVwHg8elDYFm1+c57jtQmNlu1KrITK7KOvPOafUTvbQqXaKX8xWHz9hSuNBE+F2nqKl ooG3B8r0oWwCSN8vOMU0DK2cr6kGm2ZiKmW5P5UwuSiHaMggClcQOuUyc+9NBcjB2OMD86Y0yYgH noKRYx1P3gelFwH/AHoyvXHegCDaV/DtTJEYrt9CKQN3GkZbp1FAaibehHWgAzlQDzjpQFxfKpaB qW84qrABNIYm3nNMBU54oGK2SMGgBuM0AKvakFhXBwD2NMBq88GkAHgkUAHO2gAXGeKAHA5GORSA ehKqc/lTAk81lIAOQPWgQGQFt/APUUAIZM5Y43GgBo5wSeDQAEYYgHI9aAsNKnGe1FgsRHryaAsJ tPNMQ0qcCgLCMMEA9aADbjp1pWHZgFA55NArCdTTsMdEATmgSJX5OSfaiwyFGxJ0FFhCnIPWlYZI dsgG0Yb0z1osFiMr2pisNxxjtQFgUHjPFIBQB60CA9OtA7MUEcAcUAhSM+2KAaG+vFFgsKOlAWHs 4bHHakkFhnOMdKdgDOBzzQKyBufQD0oCwzpRYdhQCRxxQxWDG3/61AxwUbee5oF1Gt04osNCZ68Y oEwINKw7MAc/SnYLCbvmosFhM5zRYAX160rASdRwcY6UJBsN5x15oHYnt3KkGjYZaQ+axHAGOtAb DZoR5YZSM9xQBFIQrjA2kD86GgQ7f3HWpsURTH5Qcd6dhMjwVHpmmyLDt4GNq4ot3FYYz+uc00gs NLHHX8KNAsNDnPtVWCxMkm48444xSZSFYbTkDj3pWGOABIdc4oAW4iKhXA+UjrQIrOvy7hxTsFhv XHPIpWAVec5HJNKwCSDAXkcdqYhnNFkPUulaYrABgdOaLhYCOaBjkYq2aQCHk4pjJIygRt6kk9Dn pSFqRj7tBQNnbTEICQuP1pXACMii4CDgetFwFHXpQAHjtmgB+OgzigB+FKgBcEd/WgQ3AzigYde3 NMQow3Tg0gHA44P50ABQkcc0DGOoNMmw1otq4HWgLDVAXlqAsA27sr1FFwtYBIpYArgd6AGFdpwp yKLhbsOZCo9R1oHYixgdKLkkqMpBDd+1K4xdgU5AzRcBjKQCetO4CRgdTn8KLgkTArIfmIz69KLj 3IpEVPu80XAjBzRckUKcgUrgGM8Yp3CwuMACi47Cgnn6UrgAwMbRz7igBDxk9Pai4ADz0ouA4hdo ouFhuBQFhp/KmKwpHOO1CCw5u1IVrDQMtg/nRcdhwXAJPSi4hu3jOOaLjWooGTgcUAIOvHbtRcfo GPwoEhHQKR3JouFhgHPPAouUkGPTii4mtR2TjAGMUrhYADgnmi4WHxMFYKfrQxouRDcwxxQMm2bD huVYc0xbjWtUkjIUkupz9RQF7MgWMlyq84GeaTHcRtrDB6UhkLMYsqSCO1Ve5FmiIkE8cUJhYQ9e aEIOPrTuMFHOTyBQFtB+F+8BigROF81QM+1K5Y2PKN5bDqadwQOWCsg5/pSAg244Ip3FYV4/lDqO 1AWGKpPIHI7UrgEgJO7HWgGHlfT86L+QWLbcUCFBAFAxM0wEbIpAPzmMHpimMQ9c84oAaOKQCk5w O1ADW4yMnFAByBzmgABwKAEGRxRoIU5x+NICQcgA96BjtrYHf0pgIcnGBigAJ+foRQIeB0xxTAVS RkH8qQCkKFG0nJ60ANAz74ouAkvIGARj1oBBjAB28gc+9AEe0FhxwaAEEY83HagBpUoeKAsODHbs PTtQBGUxyxouK3cQLkj0ouA9XYe9FxgW7j/CkFgVkxxkGmCEkIznPzY5oAZu46ZNArDQTmgVhSc4 oGkJmi4MUjpQKwqEb+RkYxQMcQBx0oGNZCehBp3Cwm1h1FIVhST0zxQOw1myAaAsNxxxQIBnHNFw HhsLjNIBVPNMPMVx6GgmyGc8ZPelcrSwvI49e1O4hA2M460ILDjJ8mCv0NDBDGLHHJpDGkmiwDow McjigBSCTgUJg9hc7UKilcVhpPzdKZRbgkzz6CkUaCyb9vGdvr6VRFrCJP5M2/b04+tIGropXsm6 dmC7d3OBTbGlZFYMVNIYSAMgbHTrSBog5BqiQAPNNMQucDGKAAgk96AFU4BHWgCSFtp9qRRNMmNr bsmhAMYswLLkcZNNANEW6PduAOelANCcoxVuhpAhqgrLgelACqu5dvqf1pN9QE+zy0XQWLBORmmA HpTAKQw6igQuflK8UwFzxjpmgY1hxSAackUxCE96Bi9VyaQCNxQGw7qKLiBc9PakA8HK544oGODE DFAAnYA9DTAcxB3Ejk0AMzgEHNAhwJYZ70DHFsLtK5bOc0CEVQSR0xQAhJHbigCXcGQEjn+dAEbj gbenf2pgR4JOQelIBSNy9OfWgBnJyDwRQA7aWzgEigBhIGMUANIOQaGAh9qQxCpApiEK5570XEG0 gduaBiY5ouLqJgg9qAWg7aeeKAsB447UAGBkYoAlduAQB0oGNEg7qDR5ggWRPpQF0LuQ8UBdDCiH oeBQCQvlByArc0AIUVeMg0AIFG3OcUdQDjOAKQOwuOcnpQSG0bevNMVxvfrSGDAA8c0w8hrEACgY 0nJ4oAVVyCePpmgVx5bCUgQ3djAoGIffNFwAkECkO5JExHOaY0+hdE3y4A/GgB7yl4wCwwKLjsiO 4AKgfKSO4NAivjI24GaAFjGQV9eKT0KRD5exjmquZsY2Bn1oTAaKAJGAzx0p3ENBxnHNADCc0DJo 5C2FJ6Uh3Jg+3C4BFAyMnD+lAA5yvvmi4hjFhgnsO1O4tgQ4YE8Ang0hk3n/AFqCh4A6CrJDGTig QHFADBzxTGOUcgZ/GkBKVUwnn5gaYEHBGOaAFHAoAbgUhhgY70BYAKAsKB0oEGOc0gHLjB+tMY8b RwaBCjbngfhQAu0N0GCKAEOCAB6dKAFUlT0oGSOqhVYZHagQ5grbc/LgfnRsIhxt75z29KChwB6U CF4wBt59fWgBVVXPoTwaAF8sDipuSJtXPQUrhcUIuOlF2AGCM4JIGadxjSgVzgZFAEZA9KAFJBAy KVgGlRu6YNMAKg/w44oATAHQUAKEVicgcDvQA0qvpTATYMdKLgG0A0DDaCelADfLUUANaMZ5zn0o AQoBRfQQmzjNMAHyOrLncPWgBrYJzyMmgYEDAzQIFB3+1AiR1UrlePY0hWIySRTCwmOaEMCMDNAD cZIoAeBjkCkAgOWPqaLXAH5HTigAVQBQgHMF5HPShCIlyDQUSZycj8aQE6lgoI6d6CkS57460xjX wSBjHrSAQEDtkd6oVhjDy3waXkCfUdKhlj3rksOuPSkgauVSvBP86ogTp2oAXAz68dqAE4HtTAeo Vu30oAQMoYcflSBDjhhwTnrQUBzj6cUANOQ3I60CFzlCMcYoAQDCj0P6UDJMSf7NKwyYAgUxC7Se aLggKk9qAsHlZpXGL5OKLgPZFEZPIfPA7Yp3FqRIoL4J2j1pj1GgY9xQGonTtQAEcE0gBRntzQAo XnFIBcdqAEUcGmA4kHigB6sRjGOKQDiAeVP1pgNxkjHB9KAFAOfmPPagB6t0BFAEiBGYkn65oEDi Pyyed2cDjtQGpAQc0ASK+OvagBcdxwDQAhz15pMBpXLE55pCF2uF4oC4mHFPQLgVf2pXC4eW3tRc LgUJFFwuN8tgc44ouFxdnBxwTRcLjhESPXNO4rjXiAOfX0pXGNEZPUGi4XF2HGMUriuJs9qLjuG0 joKdwuJjPOKQCY55FMA2gA0XAYUFFwVxrJx3p3EJtOfu9PWgeojjjii7ATgDrnjpjpTGNORkE5oJ sKNjYL8Y9BQVYU7OcZPHFIVmRgHPNCYWFIx2xTCwu3OMdaVw1G9D70agPC8AnqaQBkg+1MVhCByQ DzSuUkIwzyBxRcLAuAelGoWJYpWVWAHDdqBk8Y3YzQMnVFZSSOe3tTJZE5GzaDx7UDK8i7jk0wFi Ow8nHrSY0NuIiPnUcGkmJogPPSqTJDueKLisAGc9ad2McCcjt+FAiMjBoGSwMACCPpSY0SH25FFx sQjcmcUARqvXOQMc0X0F1JLfyyxSQkKen1oFqO8n/bagZL3x3zQBPGA45qXoIdsHTApXFcTbigaA 0wAqQAzj5SaaC5XxktjtVDG4xg0Ag6mkMTGDQFhQQPrQAvRqADvQAhGAtFhARg5oGKpBPpSAfyjH GD9KYgJDMWPNIY5jHuGCduO9MQoxjNAClR94Uhjg2/IyaBCq20kY46GmBGqknIHBoAkQkkDjjvQB I0YJPOF9c0AR7QB94fSk0AvGMiosQJkEgDrVKPcpIlIjRQWxmqskBFIVI+Q4/CkxpDeQBSaCw9cM Kh3RD0HbKQgwMe4ouAoTcPoO1MYwrjjFIQ3aaYXExigaADigY0j2pgJincAIxQgG7eeaAEIwRkfn TQCE560DGEUANIB4wKeoMYUAHt6UADIAOtG4WG9OcU7BoAHNKwx+OnA/CgBuCD2xigBuMjr0pgh2 AB1zU6i0G/xZ4xTGObsccdqLCGn7ueB+NAxCRmgCTIVRmkhj45DtwMH0pjRYViFyenSgQ7GVycUA II1cMrtjA+WmgZVcYbHXHFIB8b9Vc5BpWH5EE0XltgYI7U0S1YjxzTEOBx1oQMUkYBzinsKwxhhq BgvBzQBZV+OMUrFIULggngGgdiN0wxxTJsNZQBx1xmkFhvmP6mgLFwDJoAdFnPU0MCwoJGBUCEZG PSgA2EDrQArLuQAcetNBaxVIweO9UMafSmAhGKBigE0gEYUAKegpAxRjrmgAJyMGmA5EDPgk4xSb FsMZSpI6UIB6ffU4+XjOKYE908MkgMK7VAANAIiGORikMAWXA6UAPRjgjH/1qYEpLRxeW8YB6gkc 4oF5jVLAZHbrSAsl1tY/9WWZxxnoKCdyqORgimUIHZVIGOf0oAEBI5Gc9KQCujLhckmnYCSIGONm I5piIdxOSRQOwzkZpDG/MR1pAJvdD96i1xMsxyF046is2rENDwPUUhCjgYpBcOvegLgBxQAm0Zp3 BBspAJtp3AQrQA2mAhWgBpTNO47iGMj0oC4nl8UXAaU68U0O43Z7UABT1FA7kZj9/wBKYeQgjIOM 0AIykduKYCNGdu7IxnHWgYzBoDQBjFAxxA2e/rSQr6iKCTjOc0xbjSe3pQPYbjmgBxGe9IY6NtjD rQw0RdX516/hQMfGPMIXNMQkiELg9RQBCyqy980ICIkljxx7UAPUiWPaw59aW2o9yu8bI+DmqJtY VlwO5pIBuCFA70xARg0xiEYHWgTHw9cE+9JjRO2SdvUGkMRBtO4gnHBpgISC4OBj6UAT+WP7gpi0 EyMYIpCGhscCgZYikyKhgyTd6HFIm4uQeKAuPjYCGQY5xxTW4dSgykEg8HrVlCMS2M9vagBG54oG CjIPX8BQAhGBQAvUd6BC8AgjOKADAINIY9Oq0MTJZIvM5HWpTsSnYhYbVIIOaoobuIXaDxTAVBnv g9qQx+ScZ60AOR9rZIyM9KAJZJRLIS2cdqBD4kEi/Lk8YwO1IT0LFxCV2hjkDAz7UxJkM9q0PRw4 6/KaB3K2MgEqRj0pjJkXY65ORjI9qEIRpCWwB1ouNItz2rJEpbuOaVyrE1rpRmTOML296m99h2S3 GXmliDock9BVJhYpxWjK3I46UmxqI67tQihwKUZBKOhBAOSM9elOSujJosBOcHisiBCpoCwbeKAD HAGKAsLszRYLDCDmgLCbTQGopRvSncBvlnFFwDZ2PGKVwF29cdKYWG7aLgIV9M07gIyDA70rjuIE 9adw2Bk4wKEwTGsnancBPKz0ouFw8rjmi4CGIUXC4nkqe1Fx3GC2HTtRzBcQ2wGRk07iuNNsO2aL juMNud3ei47i/Z8Z5/SncLieRgYHNFwGtEUG45x7UXGTW0hHAyCKClqTg46HGKEA5jlPemhEKq2M j8aYDCAj7kyR70gsNPyHccqfShgOZhL8p7dKSGQ5Knac8GmiXuIw53A/pTuFuoh3E5I/GgQmPlou FgBxjFAEwk6CgpDmfuowccigCI5x35oESb3/AL360WHoTvGVzzyKCbjMDFAxyHaaTAsDBA96jYkM YHWgCzZIHnCEgZFC3E9ipeLi424xtGK1KjsVugoGIeTmgBBgilqAA45oGOHTjigQoGV5pDE6g4pg OB6UgLSdKzM2LIodcYpp2C9io8RQ8irTuUncPTtQUO+8OO1MROqLMMkqgAxgUBsRqQcK2Bg9TSAu bIY4R5LM0+c8dBQLXqTCWd1USICqn5sd6BWQ66aERpJG209MelAyoqM0RKjqc4NADHDKAduAOCaY yS3RcjJ5zxSY0dCLRZox5nQqMVKTLvYtIoRQqjAFNKxLY2SFJfvrmhoadiE2MQ6Dp0qWilIoalFs jIA4xUrRlPVGFnDccGtTFl3cDgHrWTIsO42HPJBoAZjIzSFYADu5oGKAwJDcH3FABs3EZAouAbcZ 9KQgxtPfNACY96Q7Bii4mNwN1FwFCqaLhYNoouAmwH2p3ACg9OlFxWG7VOMHrRdhYXyl45o5mMNo B4NFxgI0x1ouxCBF55ouwsHlr6/hRdjsI0QI4p3FYaYs0XDYaU4ouAmwAc5FO4CiIsMDrRcBDEMd KLjD7Nntx70cwXGvDtBOORVKRSZGHHFWULuAoEJvIyQeRzQA0DDEkAgjv2pgR3B3MAegGBSER4IO RQBJtBGSMY70aooQQt2xRclimKTcVKkMOoIxRcBHjc9QM0XAaYG2AbRmi4C+SVXJovcFoOC7l+Xl qZRHtHU9aBDuP71AEzMSDzTJDGAKQ0J39KAJo2G3ripEx3UZpDJ7Fyt2h6mgmWwl+irKXBJO4hq0 YRZSfg+xpFDcZPFMYg9M0hCkAEqSDg9QeKBiH5TjqKBD4wTwOtIBVHymmMFHyikBZQjaPpWdjN7j yR0HSgGBxtwRQKxXljK8r0q0y0xinaMjOfSqGPjLY2gZ3GkMkdHV9jptyaBFu3TyVKS7Vz8wb2pM VyePUIQ7/KcZ4AFAWGzWaTo0kLEt121QXsQJbytH1A2feBNIL2CNJLuby128j+VF7DSLOl2YkvD5 nRO1J6l7HQcAelF0hET3UStjeCfak5WKUGx7yBIi5BwBmjm0uJK7sVPtyucgqqj+9UNtmnKkVLq4 +0DYMH6Uh2MZoiJyvTBrS+hlbUsEggY61kZjgducd6BCZzSHsKWGKNxBkE0MBcgd6ECAEEYphYcw G3r2oAhYcZ5oAQcd6AHZ56UgEJxQMQnJ44p7AIXz/SgBwYEcikwsIRn/AOtTAMEg0bAJtyMDilcG xQpBxQK4mxs9ad0O4oU/XFK4cwuMUBcbhvTNMA285xSWgWE285ouIcMjjmgBQR0NIYH60yRrHORj igpFKdPLbP8ACa1i7lJjQemKsBWwRQAPITEFxyOhoERNlgM54oAaR9RQMQMQSDkijoBLC+Dg+tIC 5tEvzKx+p61DbW5OonlfMKVxDmix05zRcY1oBxxQmMpzJ5Uh9D0rRO6BMi5NMY3d7mq1Jui2+DyO KAG89qQxcc0DBWxSAmzkVIh8X+sXHXNAiWaNgkm49fm5rQSKJGY89xQUN5HtxQMQD1pAJjBoAcRm gGKOnpQADjOKABeDQBaj+6KzZD3HMcCkCFDDuKADINAiCSPbyvSrTKTGxSGORXBwRVFGsb9bmELP CAW6OOlSTbsQXLRROm8mYbeBnpTQyvbFHl2SNsX6UwLqk2V0ADvVgDn0pMW6G38kTt+5LZP3j60A rlrShGblZUUrj5SfXNDGnbQ04oRHeysBgMAaRfQsMiv94ZocUwTa2GNBGxB2j8BSauNSaHSpviZP UYptaCi7O5n29urqY2UZHqKzV9jWXcWSzit8vjk96UlYE7mQ2fOeRu3Apt6WJel2RFiD0osYChvW lYLDgQelJgGcUAGaYmhN27jpSsAY5yGyfSgYByODRYQpG4jnFAwPFNoQmT3pAKMHnqKBjguDnFK4 hNmT2ouIUrgc0DF2AYouIXAzxSHYUbQelAWEJG4YNFgsBYH3FA+UaGBJp2HygQGPymgLMUpgikIQ Ic9eKLjAx5OAaLgN8ognBNPmAUR/LSuIYVP0zTuMcq4Bzzii4iOeHzEI9aalYaM/DIMN2OOa3GG4 7sigYvUDIzTEBbjnrQA0kHnkGgBrDI3DgUg3BCXfB70bgWlcp0OPUGpaAnWaNvaocQsSF1wMGpsF hOe/4VWwWIbiNZUIHUcinF2BGbIDnGMYrbQQUrjNIRq6swYAAdDTIK2cHiixQqnFSMQkg07ASKx2 1NgLFruM6gYBJ70mSy1qkZVVcZ6Dd+NaJaExZUuXjawhC43qxzR0KSdysDh1ZxkelAwuHEkpZUCA 9AKQJWIySaBijOaLCHdqQwB6DigABORTAsIMoKzZD3HFSOKQrgMg0wFOT1pWAAMDnmgZDJCc5X8q pMaY3z3EHk5+UHNVYY1WI5607DJIy3nKwXJBzSYjUlme4lV1G1lTGCKBJWK08zzoF8sZB5Yd6BpW L0NpNaW4m3ZUjJX0osTe7Ni3nSeMMpGccj0pGhLTARcnk/gKS11G+w2YOYiEYA+ppO9hxtfUzYS8 Ug3vkjpWVzd7El7MTGp7NTbuTFJGNNKA4X160JaGdR9BO45oMRpIJ6gU0gSFGMdcYpWAUuKLAIDl uKLBYaemRQgsKDnvQIUDdnjpTBICdo6GmhkgxgMehpMLC/IDUtBYTcoH3eKLDsJvA4pWDlGq5B5P FOw7Dic98ihIBC3GQcCgBd64zRYYjFR359qLMLCecAOBzT5R2GtKSOO/6UJBYZuwDTsAm4k8HFFh knm7cZBFKwhPNP5Ucox3nMORilygKJjt5o5RCrKcegpOIWAsMiiwWFYjH+FCRNhFJVPWhoLDLuNZ Izx8wGacdAtYzu9bgOyMYzzTQDG+uaVgEVsMQRkUwFQBpNudqn1pCGOm0nkHB7UAKHOMHmlYYuTj 5SQfWhIY9JnTG6iwE6XA9O1S4jJFkQ5wwGKTTQircoW/eAD3q12EVto/umrsLQuyDaAc0CQwoSme uO1AXJA0bW2CMODx70ha3IeSaCxycdaTAs22DOnOOetSyWT6jI8jBSAAeR71a2FFFMiMxc5DD9aC tbkZIK5xjFMAckhc9h0pAMI9KBjguKAFPApAJ0YUwFGQaQFmFSYwah7kvcfjvU3JsOUke9ABjnmi 4AFzxmi4CEYPWi4yKaHIyo5q4yGmV+V7VYx6yEdO1AFgymZSQwUKOmaQE1g6w3KOVJQfezQJ7Gvf zRKir5hZX7A1TJSK+mukF4VV8h+tRJGkWbfUUxjdhD7tx/3e1SlYd9LCSjKEbcjHrTdxx0Zjsmbo EjAHbNZs216jtRlTeqL0Uc/WkSjKuomhk+fnIBrZLQwbuxgYHijkJuOwvFLlYXArhDtxilZ9QuNG B049c1I7gAVYkcUDHqxVSp5HWkAgz2FMLDl45ORUhYcjZBwTmhoAb0xzVJkjCctxkUDsxOSMGkFm BPHP50AkxCBgENx6UFDgcDqKQtxxAEeM5oGNDEHGOnTFAxzYBHqRQAwJntx60XAd5RA3DrRcBDCz joPzovYBjxFTTTEncYc/gKYwIwcgEUAKeRSHcXZxmlcVwBxxzTGOAzSbAcCA3WkIkA+TOAaQXE27 +ccU72Az54zHKf7tbRdyRhbAI70wGHj6UCuNAIbIHSmguOyxBJGKAGE5PFAXE70CTHZ9OKQ7iOxI FAXEViD9aYXHB+fQ0WEmSJIM/PyO9FirifL6UwsWpgu84wQPSghCR7gCqHjHNAyELkkDkikMGXB9 KBh0GaAJYW5xmpYmWrzeViZx04H0qlsTEqzgA5UfWgpEe0lScHA60xjf50gF2jjnmgB+45Ck0gGP 1696BAOe9AxRyetAFuEfu+tQyWPx2HSpABwcZyaYCkY68H0pCsIdo70ANJUng07DEDA55osBFKit yuQe4q0xoiAI5qhjlIPtQIv2coiKrcHbGeQaBPyFdQSJQSFJ45p2C/QdZgPdKCerDJNOwrnQgtE2 DyvY1i7rY2WqJgQRkVSZIjDcpFMadihNGiZYnkdKxasze9zGkkLzMc8ZqkrENk+rRf6PBJ3Iwa36 HOnqzIB7AGgB4JyAAaAJRDMQMKcdadhExtZVTlOaLCTIgBn5s4rGUbGiY/5Qflbj3qChGYY4zQkA ZPrQAhYDp170WAUMBjJNAhWfjiiwgAz8uc+9AAUA4Jz9KVx3HLENu7aKLiuMxjjFMYpDg5A+UUtA Qb9h6GiwCE5bIFADtxHbA9KQ0LlSc0WsFxhkHYc07CI5Hk7fLxTVh2IDPMMKo/SqshD1edlyR+lK yGSgMyDMeM0tAJEBA5WpaQCldwPAXHrS2AXy+cAg/Si4h+xOB0NA9R2wL0OakQBAB7UXJbIJoA8b Y/OrjKzFczHQxnDcNW6aZQh+59KAEGQOtAgwMEZoAFCj7w/KmFhrbd/FFxCk5YZ6UhjG5OaYhPxo AB75oAVsY9KYC7/9kfrRdBqXI/mBUAknpQANuhfjgjjmgFZksUEjIZkwAozS3E2tiB8sM9aRSGk/ hTGORtrA0mgNe+IeO3xghgDjvQtjNaXMp8FnHvVFjNxUYHfqKAEzg5FIYhyBnimA4kkEnrSENHWg BRwc0DF5zx3oAsRHMYFQxEmRSFYcjLkENhhzyOKLD2Gs+4ktkknk0WYDMjPvQIVcc0MBOAaBjsr1 7Uai1GSnIO3v196pAtCFRkgYz7VVii0iBYx5nPoPSqUe5F+wpfdwvOKYh9vKFkJHUUDZ1EEizwK4 7is5IuLGOXgyVGV9KjYvcp3OpvGMKmD9aLspRRlXF5LO3pRYd+w+2tTN8q/iaaV2KTUULrE4aRIF PEYwfrWrOddyojWydTnB7Ci4DhcwoRsj3HjGadwsPW4u5OEjwO2FosxaEoF8MEnJ7jIp6hdEU8bM N6DGeopbjWhC5VVAweawaaNE7gGOOMUhife7UCEBC8HrTsAEE8DvSAGU469O1ACFmGABiiwDt57U WCwplboM0WBIUy8DJ6UrDBpsgf0osFhjGmAD6/jQA4Z9RSANxB5oHYcpXJyKQCsOSD+lAhUbYMgc UrMAM6HCkEUKLAkV0kGMAEUmmgFIG3grmkvMm7ISzbsNz2NVZDJFgK/ODRe4XFEoXhlOSOuKnlAY 053EqM/WqUR2G/aMvzijkFZBlASfXtmizAguVVkGB8w71cW0FiicjrWghueeKYhQeKAEbOKAYu7H WiwXGk85IosK40/SgBKdguLzjsKAD34oC4uR6U7AaML+XIjAdDUsTWgt66Syb0z75oCKaIPMZVKq xAPUZoKsJnAxSGN70ASQRGaZYxgEnuaG7IG7GlcxEGKND8yHb1oTIXcpRJ/pBDqWwTwO9Mb2IZlx KVxtx2NMa2GsuBxSGNI44oAX+HigAxikIDnFMY7tSAkU4QUgJMMR1paAJg9M8UwEZj0FIBNzDFAx QaYhU5PtSYPQDnPFCAVcnimJk0ceANi5Y+1axViGyxHZSyL83APP4UxXQ/7BHCTulUHnvRZDuLHF aBm/ege+aNA1JrC9Fq/lsd8Z7jtSauCdjX81JIt0bB1PoaylE1UkZt4iFuQR9az2NVqUltd7Z+7H 3Y1UU2TKSiWbu9isIfJtuXPVvStUrGGsndmQEV8vJIATz6k0DHD7OvGx2980xajxKEbEMKr6FuaB Ej+fvVZJCA3oelVYLoJYvLkAWTdn3osguJDK1vesk5yrdeanZj3Q24iHmOoI9RUyKiyD7o4xWZQ9 ZcKQuAfWlYYzcDnOCf50wDcBxSEIc9gaYxwYEc54pADLjGM4ouAmDmmAmwE9RQAuz3BoAUoO2KLB caVPYinYBcf7VJgIM5OD+dAAN2aQDvLdSCaLhclQZ5H41LC9hpVXY5HNIYzymGcAZ6VVxDhGU+/j 86AEddj8daSAXzps44x7UWQEokPQsORyDSsAqMpyu0AUCsV5FMbHGDVLUY3kkZFMBwUk9gMUAV54 t+T3pqQmiq0bBuRV3RLuAFFwEOfwFULURuvApDEOe9FxCdulIYAUxDkRnbaBz9aAALxn8qLgGKVx 3NFseQGz82cCgXUibAxj8aY0LLCUUEnqM/ShMSdyIGgoUjpQBYsI/MvEGR1zUydkJ7GpeKVnjYAh WOR+FNLQzWxQilkjvHliXHPcdKoqytYqylnmLueSc0FCMu0kZB9xQBH0oGAHNAhzY4pAGMDrQMXt j0oAehGMGkA8/d4PHpSAbupgORwAcik0A5SpFIka2AaYxcbaAeoo+Y/L1oAvWdoZFy/yoOpNaxRn Jkpu4YAUtkDMvOT607it3Iib2dRjKg/gKNWPRDWtFU5luEBx0HNId2ReVaqf9cx9cLQO7Jv9DVBt 81iKLk6gJTHkwl1HbNMYkl9PJHtc7sd8c1NrlJ22IpbuefanQDgCgWm5C0Z35c5PenYdx7JHkeXn 3zQIfK6sqgIFx1oEPaTeFGAMelNCHFXZd/JA4zTEV2OG25pFDLglsO3JHFSxosxSJJAxkALhePak MqkDvWbLAjrjP40gBQo+8KNQBsYG1cUAOEnyYKjIpWGNwTzjjNMAGR3oAcCcjpmgGLsUnnI5pXsJ sYMZPp71VwHADof1pXGKE4OCKVxXGCNi2OtO47kscJDfMOB70mxXJCAgwpA70hjXOQOevWgBq7VB FGoACADt5PbNGoiNpXJPT6U7DAEn75B9qBC+aOAaLANLEE44p2GHmgEcg0WHcf5+FNTy3ENM4Iwe tPkAj3nduBNPlAVJsggUcoJgZF7iizAY8qEYIyKaTEVWHXB4qidBgqhB3BzS1DQMcdaYCEcDpQAo FAhMd80DA9OtABzTCzLoYgEVIxvvQBLuMuM+lLYRG4AY46UDQMBtGKBlzSYRJc5bOBUyZMmbz2wu Y4xuyY3zVx2M72KKoz6hc4jBRgRk9qq2o3ZJGRKhilAcZAOMUi07iXDIQAoIbP4UAiDH50FADjvS EBo1C6HYyoNAxD14oAcOOTSELkj6UDDPNAC7cg0gAHA44pgLk45NAAOeKANWxs1CGSU7VHrWkVYy lK+wru98/lwHZEp70w0Qhkit+LdQ793amHqQ3BnMatIxIPvSsNMaYoxCG35Y9RSC7EJh8nG07x3p hrcdHKhg2Ffm7GhC6jxMRCY8CgCIMVBIoAhcnPWkNE8Fs8ynBAOMjPegLjIxgHNMTJIrcySrlW2E 4zQFxzRKZmji+8rY2nqaL9AJvOWJGgkjLHIACnqaL2CxSkQNdFVwp9M96nqV0G3UbRFY+7DLD0oY 0S28LRv+9QhQNzA989KLCuQ3QIfEXCn9KlqzKixkZIXDDNQyhTjJApDAk0CD270hgATxmmIeAowO 9LUBu4BuDRqAeZxTsAhcEcGlYY8sT0GaBAsmGyRQMDJls9PTFAhN31zQMC340ABORyce1ADS3bP5 0wAbuCDS2AQk45NMBNwo1ANw9OPWgQ1m74oswGZAPFMBC4NGoXE3elMBC/bNAribgFPHJoQXEZye rZzQAjNzxTC4m7K+najUVxmBjpnNMWwu35cg59qLB6CDjv8ApQPRC9skUagKvU8fpQAm00DF289c CgB2wep/KmSWmhMZI6ioUkwTERMjnpQ3YABCg9jRcYmOKLgIoBU+tO4F7SXVbg7mwT0+tTIUjZSf 7NJFEBu3kkkVaM/Mo3N1K0/kwKPmJOO9U2NRW5nzxOl3i5wCV3Dmkyk9NBLu6W4ZFVAqqOfc0XWw 1GxA6IsYYPuY9RjpQNPUiH3qQCuMAe9ADl+6c0ANHQ5pXGOUcUAOxRcAxRcYdsUCDFAB360wNDSr WKWRmnbCqPXvQiZFm43Xc4toMrGh71pcjbUbLKAnkQDEa/eP96mIJUg+zrsPz96NAKc0jsMM2fSk UiMK2M9qQx4QuQFHJpkj2iEcQdTnnB9jQMVVLkADLHoKYi0+bfTD8qiTd0I5IqdgSuyrCsVzIArM rYztIouN6DWuX80TKNsacKDSY7dB7szwLDsRXfnjqo96dxeYxpHjjWGZjtH3HU0D80LaW7SXKA53 bgQ2etILly7SO0uW+cCQg7SRwM02xasx5FZGJJzznINSXcnWUid3I3NxgntTRLNRUnubNcsvTp3x VEXVynNCjRny3BdcnH0qHZmidigXPrUFhkj1pALuIJxmgAySeKBjgHxkEUtABsnH9KEIaAVbBFMA wT0XgUgAYx2zQAqs3sKNAH4yMZBoC4xiBwKYxNxDZpABbimIaT70AHNFwDc3rRoAHPGaeghOmCTR YAZuemaQxpdsdKNAG4JYHNMQjA8dDRcY0jn0ouhC455oGJsPTPShNCDZ2NO4BsycDk+lCsMBHii4 rChMDFFwsJ5Y707gLtTkmlcNBCQRQAqL6UAO8tejNigBrMq8KufrTQCeY3939aLoRZ8wkHmp5RWE LsB0osMbyTkmmApBxzRoAq4xjGaQGppioLZzsDOe/pU7siW5IJHQ+bt6fLknpV7OwnqQ294YLqW4 dATjAAquo7aWKV7cm7uGlbgnovpQUlYgAyO2aQxHUqQD1pgKu0Zyee1IBG+7mgQD7vtmgYY6elAD kOAQaTGOJpAIWp2AA4A6UWAQYJ9KAJI498nXjuaaVxN2NGUxpFGsS7AVbIz1NaWsZq4yO6kIMIx8 4GTjk0kDXUkWX7NvQqNx75qthb6jMZQn9aYmVnUmQIOp6ZqS0StPthjRCGdchlHQipbCxIsg+xM8 UeJd236Zp3C2pXUywkRIwJPzN3ApD3HebJNN5qPt8vgMe9AbaA2JJCDuSVepByKYXLen+QJw8sgY r/EFxSE0R3oj89hBGG2dien4UwRGqGQmWAkvj5kYUBtuPih+0xNcME3D5UQnAFFgbtoQCOWKYYO6 ZjwQegosO5cvVlYsw2yxNgkDkrTdyUVbqKOO7SOMYQgdT1zUvyKV7DooYEO+eQgZ+UAdcU1YHfoO lhnaBrzd5a5wBntQJPoQqsHzfvSDsyD70rId2VXwOnIPNQ0Whm40DHAnrSsAoYFuaAAn0xSAFJBo AdyTzQAp4FILiFeM9TQK4nOBxigYZx6UAJ1pgPCDHHalcBPlBFAyT92yY2kN60CInGzqOOxoAQAF c0XAMdqdwDbmi4BsOP8A69FwE2H1oATZ6mi6AUrQAGPAoFcQL7UxiqucigBrgqO1AAgJP4UAGDnp QAu0Z64oAjZD0HNMVgEZA9qNAsPwu35Rn3pANVWbv9BRcBDGRyRg0XQDWU5AINMB2w0XFYlxk4HF IB5UqAfXtQIbt3L0ovYdxwjKvzyKV9AuKSiqBg9aNQ3NLSsyK8Y4X1FK2pEtNRtyf3hVcnkHHqat AhZLKVraUfKrRnJX0zVJCvqZbR4mKKQff1oNL6DWUocMDjtQAcytyegwKQbCSqFbA5osAhY59BQB IqGUhUGT6UBsNfAKjBBHWiwxAcE0mAuRikADGeaYBjNABigDT063jktZWJzIBkLWkTOe5OsscVuG aPMnQZHGKZJSkkjjnV0YqCORjpSK3HGUTsX6nvgU9xbFqOcxxKnlBt4yM+tN3FYp3Za5uHdmAEYx kCpepa0K3AJVu3O5aQ7mxptzCIGRkLMwJXd1OKaIaKEkjSEiHaV/ugYNDK9QEDxoZo1ZQvJVx/Kl YV+g63QyRNmRUaQ/MT1xTAk+y7Lho3yIohkkdzRboFxzJDdzs4Pktjg56mnYSbRYuJHiWNFYH5Pm x600IrPG6gErgHpQBNNHOIEbywvy43DrihBcRbWaKASKcNjkZ5FAX1KF5mNgxfMn8Q9KhmiGGXzm +UYAGBntTQhGknmUx5ZlXtS3DRD4bMvDkkZzgDPJppA3YWWHZjcMY4xUTVhxZCVXPy85qChGX5RQ AxlPUCgYu7K4280AIrspHAP4U7ASebkdKmwgL8c807DF3YPA+tKwA0jEbfTpQIay4XO8H2p2GNGa Bj1JA5PFTbUB42YJYYo1Ab8p6A0aoRIgBXDrkelIA2IO1MYm1c8UtQG/wn5qdgIySenNUhACT7Ug DkZoGFACHp3FAhMHPpQA4Y9aAE2jFADs7RxQAnXJNACYBHXFPUBUTJoYx20Z5xU6hYTZg0wGg7T6 07BYUvkcjpSsFhMEnJoEO3L/AJFFmFgIJ9KehKJt4CqMZNLqAFRj5TkUr9wGAckmmJjzEGx79KSd gNKK3a2tdyE7mIprXUi93qNuHURgohzu7etXcaRHDdDz7guxCyrVXdwa0Rnxom1mY85wBn9aCmTX cqTrFGqgyp8p29DRcSVtSeKxeG1eTdGFI5Dj09KEhcybMwk+YSABmkUSMySryMP7dDQAwM0EgIyG FIYjEM+7PU0wE680DJAsfkHqJAePQikBH7UAKKAHAdBQBpx5sPLeMCTzErRKxnuSrM+oQtG+BIjc duKExNJbFOeFraVfMUHuO4NMa1As0amSJQFfjOOlK4FqDdNbSSynJhHBWhMTXRFb7MJDm1lLN1II xRa+w723KyIGLeY20k88Uh+hahH2eUzMMheEFNITFJhkkDMvltnOV6UwHXMnm3BZSSh6UC6WA2sp jEiodvrQF0i1OtxcWyZ2gEcgcE0BoCWMPyx+cFmxkqaQEolsll+zOcFB/rPU07is9yM6qgkZXi3Q A/IR2pD5SsNQu2dpwC0WcbccYoHZbFd5riaR7lCVA7UbhotCrIC4EjHc7t0qSifaIkJdcdsetVsI kiik2qbcNljk0JCbXUtSJDKyI7lGU8t2J70xK5WunV3/AHecLxz3qJlxRXDKp+ZayKGmQY4FFgHi QYxjikAw4BGKYwdV/hOaLsBuwYzkUXAUoMdQQKLgIyr1Uk0CF4P+FAwwKQAACaGBIEQDnkelFwDY gHOaLsYbkUYANJ6gOEmBn1osAhy4xg+1C0EJk4xTvcdgAGCO9AyPy+frTuIVowBwc+1CYhoVvTmi 6AMHpigYoVtvrRoITDDtzTATBHakAZ4oAAwzz09qADINMBOO9Ax4x0FIAIxwRQAEkLwOlCAQFM4I x9KaEPAjYcHP409A1Axt95fyNFgGbH/uigY5Qw6jrQQOYhW2+9IQuRsIBNABgGPBPIoGSwRyTYHO 1fagluxpyQktFB8wjI+8DTSsRfqNuj9iTCMCc459MVaVgXvbmbeSgum0bTgA+9O90XFDZLWXy/Mj HydfpQgv0KyE+ZnqfakUSM00kRYljGh6dhRYRGEaQEgcDrQPYRSUYMOoNIVh27euCADnk0wsRgEc UMewuBjApAOA7d6QABg9aBjg2BQBNbxmQM3GFHSrirsmTJraY206SuN6jtVE2voMYG6umMJ2bjnB NG4bIekkZi8m5cgoeOM1Ow/NCusZiTazGM8j2NMWpab/AFYijmABToBwfrTEMkmzapGpVXBwwXv7 0wt1Kf2d5ASikhetJjRMlu0wVTLl/wC6aSDYtFLMP5Bcq64G7sad7E2e4yW+jSYxLErwLx05+tFx qI172eWcta5EaDhccYpbhZLcjU3F9dF0OxkHAHGKLD0SFgi+0PM08wWVeQaEJ6bBH9l+wSGRiZc8 U7hrcQ3kI0/yBF8+epouO2tyJb6aK2aDACt3xSCyepV3SIjIG4brSGNVTvUA4560DLxaGRwsgYgf xVROopumSTdGSuOAB6UCsDDZFudxub+EdqewblcE7+e1ZvUsXCkfMfwrG5YgRNp5FF2INgU5DdKL jE2Ln5jRdjHeUh/jFF2IBDzgMPajmAYYucFsU+YB/kDbnd39KOYQrWzAA4pcwuYAq9RjGaNRjwgX 5sUrgRtlgTjaM0wEK4HIxnpQMTBHGRzQAFf8mi4AGPXpQMOlACHhsUwEB70gFBHcD60wEP3utAD8 qehORS1CwhPOcn6mmIXep+8enpQKw0yYzkAg9KYw3ptPygfSlqBERk8MKYDkTJPBNIBxQbuKAF2M FGMdaBiFSM5ORQIQgY5NAxjRjP3vyppiE2bc0wRIrNkBT+tFwJMyeoouIdEFDsZGIGKGQ7ldn/eZ PPNOxQBvm9M0ASxBS3JqRFuzch3xnbjtRa7Jdi0wlmTzfO2DqM1ehOzsNuLq3mtthVvMVc596a2G k0zLlcOFOMEfrQWh8FyYopYyu4OPXpT2Bq5CvyEFeo60hkgERhYu5VscKB1oFr0IFdgSBwDQOwYK sQR+NIBwC4bnHpTFqNKnb04oGCn0H1pAKgG7nihgPIHTFSMQLubAGKaFc0LaJY1cod7BeV7VqlYz buOKmWBTIFiw3QjtTF1KtzGYpPkYE9QRUspEUZUS5n5U96BvyHw3LQ5CKrrnPzClcLXLLS4kJQYV 1xx2qrk2Kgfy2LHGQeKlsqxZnuWuAkVspVQMnHc09xJW3II0lmmZi211FA9ie1W3kilNxJ+86igT v0CzuoYY5Ekj3bhwTTQNXZHbXclszNGo2t7UgauRB5QxdWwxoGCRs2WGc9zQFywLQmNX6jpxTJuP ktCCMYYj07GgEyKSJN2xG+Ydc0DIj5bNsA5Hcd6Q9SBid3PGDgUhmhBptzLEJNoVe2e9UiGyOSJr diHHzCjYNyszlzn0qWWtCxGy+WVI5Y8GgBrbCQMc5rEYkiZbAXA9M0XGJsK0XAcMZ5qRisAvYGmA m7LDEfSiwrD4mAzldxPrUsAJCfwHrTAeJxkFiQfalYLEQ2sfTFO7QClyFxjHPWgLChi4+Y/L6UbA NUksB1C+tAxT3yueetAhr7QuQpGfWhDBBkkDp9KGIY6nI4xTQxVjB6nigVwZcL8o4PrQO4m35M4x TAaGwOlDCw4SjsMZHNKzCwHDD0xTCwhjUfeBpXAcoGBgDHqadmAADPYijYBNoU9AaQxdxAAxgUWE IWGDzimMaRuGc9aAEyQvU/SmAmCRn86QC4xQIaQc5pjHqPwIpCDHuKdwF8wkHoaZFiMgMckY+lMp BjIyaAAfKOD1oBk8LEnaCQDxTSJZanimSJY5ZPlX7tPVEJp7FV8RsQGyKC0Rfe6cUwEVgqEFcn19 KSAXcvJZScjigBsYQuA5IXNA7uwpUBThu+BQK4F8ZDHORikBIqZtSewPJFAX1K+SDg5xQAH5WyOl Axf4aAuOz70hlm3C7N3GScc1cVYzl2JDL5THYxXPFW7CSHb0mg2SydG4OaVwI5pURVKDfjjJpMdi OSMyYZV4PpQO9iEloSRjqMGkPcswTP8AZimQQ35/ShEvcrTbXYbcgk80MosLJJaMSnTGOlMncrne SWycnrSKJEjJTIB44JFMVywloZIgePQDuaZN7MURRxp+9ypb7vtSGJIyQR4wGLd/amC1FZngjUxq djHPNAblhfNMkRXAQdVHahEiJGY5nmMh8sjPHf2oH5FQrGkhlBLAdj60rlEDyAsSq7WPp2pXAI0a eQDIGOpNCBuyNNDeWvKOSgH1FXYi6Yz7bHdLtuFCMeh7VJVrbDJdPO3dEQy0WDmKjBo2CnqKBiFg rH1rF3LFDgt159amwDxISMcD2xSsBIxPtSuA3Cjqc0XAdkx/dI5FFhiJcmPIIB/pTsDQnmgke/rR YViM8nBFNDBVGDyPrTB6D9mBwd3bmpJuKpITG7qaOoySYbIkJUDPpQhLUYr4QkckdqVgsMMh5B6Z qrDSHxP8h4/CpaAaxJycgfWmBHuyeTTHYXGehIoAQoTgbhRcBQqg4bBHtRcA8peu7ii4ClMYO44+ lFwGmNmJIPFNOwDSjrwT+FFwELcYzQMXkYI/nQIXf6jFAxSqkZBzSAQBfWjUBeMYzSAYVKnFUA7Y SoB7UriFKDHBouAixM569PWmAeS3tVAJjrxQSIM+ooAacdKYwyMYoAkgJDnBwRTEyWVjJISrZzTJ 2EOPLVUUE9yaQDVgZoGkyMKcEd6YX1sQgbWIOcUFDjKxjEX8Oc0BZXuMIx+FAWFGeQetIBpGecUW AdHI6AoGIU9R60AIwIXtyc0ATeUrqrKy7sdKEIgGM/NxTGBb5uOBRYCaInaeKaExw3kcA/lVbiGl DGfmDClYAUuF4HBNICRgXhGW2kfhTAjcqUGcnHGRSAg5VsqTxQMVmLMDkn60hl8OjwLuHUgZ9Kvo Z21GyMIT5e3cD1460h2uK5khKeWp20BoTTxvJImxlGABtHamIW4SKdwC7Bl4yehoYK6IWlU/K6Ao DxjqBS1HYFkdnLZ49D0pifYPMZXLcgnqRQA4tIyZwdo/KmBUkBByaTKRHtO8A96QGpbQww253cyG rSsZt3HypJFD5iScEfdFIaKhEVw2W+Rz6dDzSK2E8y4smJDZXt3BpD0ZIjR3g7K4HSkGxSfKsw9D UNFoYTSsMUdc0WAnG1m/dtj2NTYQx9yNg4+tFkMQyNwM07ABLdfWiwwClugyfejQCTbjrgn0qRDT jqMimMeHITDEc9qRIzeM8rmnYdh/mPsI6ilYLCAlVB2nOe1IBxkBHPagViN3+bIpodhyspiIK4Pb NAWGAKrZI3evvTGOZwzNtG1c8D0pMQzOD/hTsMM+2aAEywHSnoIV2JwMnGKBi7m24pWQhQxOM849 aVgBeT1Ge1ACAjdggmmMV2AXAxjuKVhDFHvTGHIODRYB4IUYIzSEKyg4NIY3O3uc0WCwDBGCeadh WHDIPHWgVh2G9qAIjnFX1ATqPegBAF/GgAwAMmgAbBk3IMCqQh6lWj44ZTzQBMuN6BD16GmSOeCS PEq8qx/DNArrYqysC+4gZzzimVYCQzEgAA/pSAZt65oGKoIOTjj1oAkKebgxLyeMCkK9txqw7nCg 4JOKAuK0QQlDywNFwGAHfjtntQMJNu47QQO2aYhhQ4zxQMswXDRJt8tXAqkyWi1DdusmIYRyMYIz TuTZdRt0lxK+6ZgD6HtQxq3QZGpGTGm5h/ERwKSuDsgbaVZp2JPZRTtbcF5FLbmTrj0zUlDzFsUZ xz3pDAR7jgUIGWI42gKl1JHoa0M9ydZM5Mihxzj2pWAj3ujE7s9yDRYYxSwO4Hn1oAeAWTGOgoEI tu0hO3nFFguSW0SvvDsFIpgx8UsKK4kXPHBoE0ys1yY4yi9DSuVbUjecyxKrAZXjNIdrFiz0+a5l R2Kru6Z7/hQl1E2iy8Uqbsxnav8AFirI0Kcjkt979aksc7RmAKB8/c4ouCGMzphZBlT2qRjJIvJA libIz+VAyAtvclu9QUKducUgFUZBHpQMegxk0gF8wYwMc+tFgGFiWA707ALvIx3x2pWAXeGbrtpW AkBVDg4bPcUrCYAA5wcD0oGN8voQaLgAj4Pzc+houMVSyFSp59qEJhnGc96VgsMYYHFUgGYwaBi8 4oAAGNMBNrE5waLgGCCM5xQA/nNIQHO7uM9aYDWBwMdKBgG6A0rASE/LkECklqIY4OBzk1QxV3et IBpGW60dAFwFOe1AC8E8H86AH5G3HBNSAhBXnPFMBpfjFFgGhmzkHNVYCQuw7CpsAb29BT5REeet XYkGbIH5cUDG96AA8igYKcHGetAizDAPKAUEyMx6UyWwIMfyOCCPbpQwBbpli8s5K9qBWK7YOcVQ xvAOGPWkxksUIldgHwqjJJpXFewSKnnBQx8skfNQFySOT7HOyodydM+oo22Fa61EhVGDSO6pg8Du aBvsSusMs8RVSFJ2nnrQLUuHSlWQlG6Gm0iOZkUnkh33xAOOhHQUbblGWW3O2epoKJLadoJOO/rQ nYTVy9EZGY/vMADmtLEOxGxVSS5LHtmjYNyL7QSdiA5P60rlcoNDMc78KMdzSHoRpBujZ2ZRjpk8 0WBu2gwuCqptAx3pN6D6h8y4P60hmja6grLtuI8r0BAq7mbj2LJjs5lJikAz0U8U7onUrRRQsGEj 4IoHcZE8SM+8ZB6UDY63uRCWO0EGi4mhiyspJQ43dhSHuQbsMSTigYkh6YFDBALeST7ikjHNIdyW O0RWCyOMk4osJyLvktBeIbJvOZV55pk301JLe7luWnhuWAIXgdOaLWG/IpvZCK3eUSK208gc0DuU d+7npSGTIfOlUSNwBQAjbfMZVPyE4FJoaZH918EAgVDRQu1d2eB9am7C4jEFz8uM9s00AgwRx+NA CqgzyeO9FxNiY2uCp5zSGISA5xwcetMYm35uCaVwHgOowR+dILhknPUEUALyMZo0AVj8rfTvSHca BgZINFwFZwF607CGhz6UWGKSDigB3JwQMCkA8qByCAaQrjSSM8/jTAa0hzkHIp2AQOe5IosAmW3E 0xiHkYzQIQtnjFAArYYdwKAHs2TwMUDFVwMjOaQgABPekAMpzjIxQhjQOaoQ5Iwc80rgAyDgk4oA NhJIznjii4xqoadwF3FTgc0gH+Y3+RQBDitCBcUhhSATGaAArg5FMC9CzYGwYI5BoJYkIku5xGWA Ld6oT0GXVnJbTFey9xTYJ3IJVUHIOc96RSGFS0gHGTQABWKsQOB1xQABTnJ6HpSAVDuYLt5zQBsQ WCSWKzOMsoOVHFCRm20ypPMdiwrjy0OQwHQ+9HQpJbliKYwXKrIS4bpjtSSE1dFbUWMc0irnacZz 1qmEdUVxaM1uZh0Hagq+tiMbpIyAB8lICW3nI+Vu3erTJaLYsZp3RwhMbHrVMlNImAghu2SK2Z3j PUGkPpuQxzQxGU3EW6VjwD2p7A7vYpqPMYjAyTSK2J7eBdrjcpbbxzQkS2QOjqucqfoaTRSY2JpI TuKZQ+o4o2B2ZdiS2nUHeY2A6HpTJ1RItiVBxIjfjQFynMDHIUI5oGhuWB45oCw8RO+NoNAFhdPk flhjGevtQK5KYrW2yZWDH0FAaskjnLSKEhKoeSaaQnsRvbq/mSbk+XkKDRoF2VI55rWVnhGO1Jof qOgi+3PJLI4Qjk+9G42+XYS0uo4I5YpELhj0pbDauOniE1vHJbxbc54HNG4bFSQNGdrDDDqKAQ2K QGUAtsxzn3qRjWYuxJIJ9qTGh+AFHOSakYoGWHzcfypXAc8ZJGMY70XC44xZwF5GKV7BcRIlBIOO nWhsCIKCDggY9aYBGCGzjFDGSvkjmkgExwTnHpQA37o5JJoAcpBPYUMBGkH3ev0pWAQZ644FAxd/ tzRYBS5f2x6ClsICRxtJP1pgNJyfmP50XAAc8DkUAIF5IxgUxDmJOcc0Ag4JA9KBiMAR7ilcBq8c 46UxiYyeM80wHqCWAz2pCG4waYxQxB+lKwC85zmgQcbuTj8KNRjicHIxSEIST70xgHVsgjB9aLWE G/aMKc/UUWGKn4fjSAf5Y9BRcCvk1qQGaAEyc0WActKwClqLATW04VsHvwKAtcd5ZDkoche9O9xF pW3B43ZiGXqR1oTIaM5/l4A6HvTLI0yTkUhjxIURlXv1pisEYLKQTgKM0mFyW3k8qdJFXJB785o6 A1c1luGE7bgQk3OCenFJkW0KuUAZHYGMnIAPQ0NsYwRBoBMHYvu4AoT6D62I7xBJcgK4JI5pgnZD EuGQHIz2A7UmmOwiQmKQNKMBuRimF+wXVsyASr8yt3FMSd9CWLUZFtliUsjqcgqaafQOXUkWWWyl E6ssjSCqJ3Kru8sryOOW9KBlmMQxTBSrF/egWthqiGFpMFy2COlMHcIIo2DNKSoA4HrQJvsQTsXG 0H5R2oY0RRsYwQRkVN7FWLiNE0SsrYbuKd0TqTTQIqRybxID1FAJkh+ywxqWHJB6DNAbjH1VFB8q H86Vw5SCW8urnpnb3CjFGo7JEttZGROBuYjJ56VSSW5LkPSTbIwlc42kU+oW0EURQWsjxkuCcNxi kPW5WkdJrfKR4O7HvSuFtSq6PH1yOM+lIq5YSeD7GYyn70/xUXFZ3EEt1axxoxKITxSeg9GQX0oa 5ZkIJNK40iuQW5IxigZMimM9AVIoAaQV5xipGLvYdKLAPSU7cN+fpU2BjQzAcHigBcsQAOpoAPLY ZJNAxQWVhQBIxUk5yFpAMUDoTxQArdCF/KmhEQyMZoGPUZAbFK4CKDuI5x3ouA9cdAePQ0rgBYjj HGaAAKW5HSgBWB4DAEe1CARRtHII+lAmNL5XavHvTsFhANoz3oGhdwVlPXmgNxSdx6c+9IQ0YApj Ar8gbtnFMYBwDyKQhQwJz6UajFViSeBQIXcytgKKAFYhgM8UAgC5IGc0AKUGCRjii4DQORjH1p3A TBwTikAillbGB+NMZNv9qkmzK1bCA9KAEFAx3QUCEoAdu9BilYZNbyhZBv8AukcikJ7F5SLgLtHC 5zk0InYq29stwJt5IcfdFUgk7FaMCKU7wSoPODQU9dgYEP8AjxQBYuLafd5rjh/4h0oJTWw2K3ky vlsC3Uj0pDb7l9dyuWuOSRsHoPxpkegXEKS3CxIoC7d2c4oBOyuVyJrbY7rhM4wDSsVdMasaTLPM p+5g7T3p7hsNt4xNKWCgL39qkb0JDmFFEqbhng+1HoLcdO3+i4jcEY6CqTElqZmSrAjj3oLLMf72 TBPzE8c8VSZD0LLho4l2RqTnB4yaZK3FlcCVSY1LlQSTTCwRoFk3zKSOuKaQN9iKeTex2DA9KTYJ EYU9OooKJraykun2wjjuT0FZylYuMb7lt/D8irlJOalSZVkUpba4t32OMkVSkJxIdz4OVqiLCxTR r/yxy3Y0gsXgzbMHAPoO1aJGbFjleEkxNyRg0NAPKxNbNIz/AD9hmgNSiJWQMoUEHnBpFCu0jxRm FQpOchakenUWaPOwO4DBcENTAr3MQhfYCCR3HFAIZNdSXW1XONnAqWykkhioAoP3jnnFIZKNibs8 8dCKYhpYHpxQANnAI57VLKQm4IuOM1ICqd3uaAFIxj5SPrSGOA5OAMUgEVC4ODkincQ4Jt+Ytk45 xSuA5E3ttzk0thXsII+MHGc0XC4wr6c/WncYgUN29qdwHx8uwwPkGTUsBhfPGDTsAm4A7uDQMazl hxTSGSRk+mRSEx2V7ZzSAjblic80xoQqCAetO4A2dmPShAR4OBQBOoVl680tguMYYFCENXsMUwsO KelAxAKYEiYx06e9IBjMS2aBB8xoGSE7VAAFSIeOecdaAAYBxihgINrEg5HpQA1lbaSSDTAbz7Uw sR1ZIdqYADQFwzgUAOQKQxYkccYHWhCbfQaAaBi80hkscpjBPPTt2pCHI+9CS2G6rg0xFclg2CMU xjwCpDdv5UAXWuWMIjSQ7MZw3rSJS6ktjttnZblCVZckjqtAnrsXtQtv9CIi+5kHBqtLEp6mLkJI p+YnPINSaGkZ4J0CiM5HG09qEybNFdrI+aUjBBzz9MU2F9CG0TZcfOSqhsHFJjd7GjclYwYSQ249 uSBVPQhX3KAhtxOY2Zsdueaktt2K89sRJhM+Ufuk0wT7kCh1+YdjQM0rOdSsjb9jsOlWmZtDtpP7 w5bHeq0Aiubp7hh0HbilcaSRGq4BGfrQBKkTPMIVHzd/aonKyLjG7OktLZLWAIo+p9TWa8zRk9MR WurQTlXHDj9aTRUXbcpXGmrMOF8uT1HQ002htJk9jpcVtGDKqySeuOBTbItbYivrDAMkI+o9KuMu hEo9TKfIBC4yOtWZ2IZj0CnnuKTGiWSZJLdI1TDDGaLhazK8sckOA2V9OaVhpkkiJM6N5gzgcUg2 ILiaJnY85xzSuNXIIwCA2cH0pDHkgZAAHPamAZ9aYDTSBCgnAHepY0JtDZOefSkMfGgC55+opXAk Eo8o5Az70rC6jTMQM7Rj1xRYZCHOSc4p2AeJMJn14pWAUS8ccNQBLGTsbP1pMXoQyPh/l6U1sOxP vXYoAyT3qdSbEbPsJwMg0ykOOAoc9D1FIWuxEwJwAuB607lCAbexI6UAOPI+U49qAHjLDk4HSkAw KB3yCad2Go8IOecYpBcXOFIIyvrSEN2qfT8Kd2AbAhHNF7gOZcr0wfaknqMi5J9KvYaDdihAAfII ODTEJ9KEMRQc0MQ4HtSGKG4IqQJFftkikIXcr/NznvimDuHIYEc8UX0AQjKDIxTuAbU/2qLsLlet CBe1AxKYB070gFBoYDwQKkYufagAzxQAwnDZFUIdzK3P3j0NF9BbCLuMmwjJHagZdFsUSEoPmkJO D0FBN9y1JHNMCSUEm3GKd7kqyJbi+eTTyrJsYEKxBzQgSVzOVC53Egn7oHepKNK3URREyFAN4Uti qJ3eg7Lo4kkbCE4DL396Q9NjPvZHjZoSo2lt+7HNA1rqWNPt1nXezlW+vWhakydht/AtvIskZwQc DJyTRawJ3WpNGkc1uyk8kcU0TszOuLV7SQGZQV7Y707WNE77FUKwyQCPepGWzOjxKASH7j1q0ybW GhcH37UxBI/lJz1oegJXLGhzqL4K+Pm6GsJ66my0R1FUAlACbxg9eKnmHYjhuY5ywTOVOCCMYpp3 BxaJqYhO1K4GTqFiFJliHXqKqMujFKNzHf5Tk9a1MiEsVO/oc1LGSmRrqT94wGB6UBaxXMyxSZz0 6YoY7FfcWckcZNSPQcM9zQApbimAAk0AKSAQpPNDAmiweoGakY2QKBkHk0hiCTA4pWCwgUueMACj YBQGfgdO1ILDdh7mi4Dvs78enai6AcY8KORn1pXuwAFlzuIxQMaWyTkgcUxWHKQhI3DGO9IBu8Nx kE0WAaJDgL1HpRYY/exbb09KLCsIxIGARQOwB8jk4zSYwY5GFIGP1o6iBRxnPIpjHeYSORSEGdy/ ewB2poBVYBcGpYDS65FAh3mYGRRYLCI4Od/4VYx+2IgcikAx1CYA6mncBrDA9qLgCkDrTAfuAxhS fXNSA1lzkjIFCGOVV2nLYpACEJyDzQ9RMfwx4IHvSsAfNnjJxTEO3UWEVa2AM80ABwDxQA2gYuKQ DgaAFznikA4cCkA0jPNMBoBFMB5+gz1ye9MQ7zpN6sGOV6ewpCsXY9QBGZkJJ4yKBco9pwH8tFyr Dqe1C7isNSx8y4f7O3CDJJPegOay1LEM62xe3dROWPJz3p7BurkkMpBIYKYhyBu6YpksiEi3RfZ8 r5x8/ehsdrFqO0kWIeWVQHOSOKVhXKX2F7iWPzpGUNnacZoKvbYeYHtZXJl+RT0YYz9KTQtyy9xD dqYyFBZP4uxqrk8ttSkYGkjBiwfKH3aRV7Fe2CPI3nJnceDjgUFPTYcybAc4IB4xVJk2KEzs7E+l Js0SsMjdo3DAkEcgiptcZ1Ok6sl4gjlIWUfrU7bjLskwD7c1MmWojTcIgwxA9Km9huJWGoW8EjAu oZuapA7Ms215FOCVkUinfuS12Jw4K5BB+lFxWIZXCqSfxqGUkcvezRtcsFwBW0G7amc0kym8g71Z BGGJJ9KQxduBmgAGAaYgyO1IBNygcmgYGXnCjFMLDOvfmkIniZTGVOdw5BpDQq8rg0ihWGF+Xgd6 nqA0BhnGce9DAlXCDk80gHB0JYE5HY0tQsEcvO3dj0FDQ2OkkXywONwNJJ3ERHaTk9+eO1VqMbIo J+XnNCAYQPc+9MBMe340ALt4/rQAnO7bnJ9aBjlOBS1AcwGA38NIAKg8g0CDHft296AFD8/d/CgL C5GePyoANg69BmgB6QqzjDfnQ3YBWgCE/MD9KSYXG+Wp7/pTuA8LHGAdmTRdsYrDfwBSuIj8sgZJ GKdwuAQFeMA0XGK0LLGrZ59BRcQgfKc9fWgYoxwccCkAEhz2BoWgAAcnjApiuOYqpxgn0NIBM/7J oAgx1rUkCOKACmAnekAUDFFACj3pMQtACkjHSiwDKBikZXHcUIQgU4z6UwHRsQMdBQIu/bJRHt4b gDI60E2QWl0IZQzCTH8e3vQNq5pwW9qbfz413OQWAJ5qlZkNvYfbxW86rL0Yjpmkmgd0RywWf7wy FgVIO4Uxq4W7ysCY8iNiQNx5pLyExkM0OVheUqEP8fb8aHYbuRzWLJMXJkeMHK454p27DvoV7Mmc OqD5s5A9qnqD0Jzp100KFcbj155p2FzK5HHaXVjKGwCOuetJ3HdMjuLsyB/MKg4yCB1pjSsMgeGY FWbEh4GRxUg9CncLh26AjsKY0RRyGNwykgjoRTtcd7GtBrZ2Ks65I7+tZuLNIzK15qD3Er7flQ9B VKKE5dCluNURceszoQwY5+tJoabL0OsTR7dwG32qHArn7i3uteZGViB56nvQoDczGZyxzWhk3cQk k0xDldl96AAyn0oATzSDxxQAm4kc0tQ0D8c0wHADPPGKAAd6AHpjeO1IZMwww+Uj2pFDlO4EAUgG tvU8gjFIABXdgjOaQx3y5I28+1AhhBGRTGL04PUdDQAufl54pALFJ5bZ9jxQ9RNDGJyMDHHSgYoX PJ4B6UABBA54oABgZA70hiqgZeoGPWi4gZ/l29h+tAxWKkfLn6ZoF6grYIO3AFABkHDYFACnjBxg GgBd3GO1ADS5wNtAx24d85pAJuzkEUxEp+6FOPzpAIDtBAyPTFADSpPGcrRcBv3TwaYwMuT1NIB8 hDAYHT0pAhgdlJC9D1pgKXHQgGiwhR36mgBQwHNAD96+9KzFYgOAe1bCG4NMANAxCSaQAOBQAUCF oGOoADQAnQ9OKQCbsfWgAHJGOD70XEXY7bdA+/AcHoeKZFxJUNrMvluDkA5oHuh1nIRMUf8A5a8c 9KAaL7Wk1rvaIboyMFQadieZPcnEKi33grHxk4HShpWJu7ldpDs2yA7SMZHQ0loVYmN1Db28alNw xjH9aelhWbZSnaCZi8fzGQ42dx70yldGhHPcNbIirtC8FiO1Im6IWjgt7oJCShwOB1NNhq1c0YXb 5vMXbxQJWKn20ZkWbBK8qcdRRcbVynqYg8lJUVd2PzouON72KsKpODshAHr3zUop6DJLR0JJ4yOh p2FzGeckntzTRWoYyKADnNACcjvxQICCaBjSSKQhhORxTAbkihgJk0roLCgn2pgLvOKNBjec8c+1 ISHKDimCHYPSgeoHOeaBBmgB8RG5cnjNJjXkakwUw7shuMA+lSgRRU4OPzoKJUywZiOAKl6AJGm8 kgge5pMG7Aoycnt3pgOKhVLZzSuBCxHpVIYhfGAefrSCw8qcAgjPpQA1W9OT0oAa5K4wSaLghRKx JwM8dDQwDOWU8+9AATufjtSABuI5oGKvOOtAEzttG0cj3qUSRAbsVdxixnBAbtSYMHOSQvahbANw 20UXGOUAMBuJ+lMRI4C4JOcmkL0I3YluKQ0LnCgZxQMTzCBgc0AJtJ6jFMBGQdc80CE3sOOlACqS T14oGLgkZ4NAhC7BcUAKoJ7mgBcP60xCGrEA7UwAnJoGNxQAe1ADtpFAhRikAnGKAACgYpI9M/Wg BpNACcA+lIC8kxniZHfBAAWmuxm1Z3RHcQyIy+cOTxkGgcWug6Zo44Y0VMTIfvA8EUwsbdjqUU0K LK4WTHOeAaEQ42M25mZZSYWym48DnihlILlruSISGJkSPoelFgXKNieNsyS/Nk5waSBrsKhEsoMU WJP4No4/KqDYeNRmVJFZRv8AXFF2hcqFWaB0jGwmZuWOelK4WaH2eoLG7RO5Ibo3pRsDVw3jzp3i IfIxwMinfULaK5FZ2wm/4+y+0n5eeKQ2+xJbxSWsp2wkx56HrTt1E2mNu7hblfLVCo9+1K4JW1MV hgkdcGmUIOnNMA70ANHIPrQCQYwMUgGleKYrDCuPakOw3rjPShhYUrnnFADMUmA9ULAkDgdaYC7Q DTAcBkUBYCp9e+KEKwbcH1oGL5eFzjjOKQDcdNv5UAW4WGBknGMYqChCmMsOlMY6JsEoWwDUtCaH spgQHOexpbi3GNITnAFCQ0h6tGoQlTilqJ3GOQG+Xmmhq4jpwMcj2poYzO1x2HvQMFGScHFJgGPS gByjB6cg9aAAgc5B4oAQAK2T35oAeSpGFJAoAjDENQA4nOeaLAIoIztpgKMZ6j8aQCbh0/lQAq7S ACSKAHkoP9WvOKAGg4GPzpASK5PXFJoVhGGD0zmgYGPAwc89KLiFMYYAA4I607juRsjAe1ACMoKj Gc0wAAqelAD1KhsUgHOEP3cHFGpGog6cDH0oATYfU0DuN7GtAEz8uKYCE80AHtSASmAo9qQDulAB QAoGaBiEUANxkUAKwx2pAIrNG4YZGORTsKw+W4llwzEtz3oFZFmwhN1Kf4QBzQKTsPk3Wx8iVdyj kD09xT2EtdURAnBMTEHPT1FIfqaVtdSXBeCbBjx0obaJatsQJaGObynHyMMj2pDv1LBSC3hGx2+0 LkLt71WgK7CBkUmKTDFzk560JiavqhWhha8jjhI3KDyOKNBa21Mokx3IGAWDYNDRfQ3YBGACFSNs YIA/WmZsnltyYgqsdoHbqKOlg8ynbG4S4dJcvs6n2pWsxu1iWSyjZiY4iCec56VW4rs5+6tXgdty kj1osWmVeKBh344oDQaOKLCHUWGIeuKBEZGaVgGdsUWAVeoBJAosMawGSO3rQAA4xRYB4IzTEO4o AM+lAC0DE47UCEJwOlKwx6v8uD2qWikyRZAVx+tIY5fcYoAUv1FKwDvmxjGD1pCGfeKjsDinYZIk YdW3MFx096lsTdhu0pyn86Y0wdxIMkDNFhjFPOBRYBwXsASaADHzDvmgBCTng4NFhiHcMhulFhCK SO1Fhi8HqMUAGQ/3aBCgklQRj1NACyD5yMcigBAM9DiiwCZ9evtQA4OB05osAo7EUhDW3ZyOlMEh 2SRgD6UrDJesfOQRxilYnqIMAn5uMdaGAqvkYHNMZEeGOaW4xSc9B0p2CwhIBxzz60WEN5AODxTA cpJIGcUALvf+9S1CyG84rUQmcUAJQMBSEFAxRximA49PSkAYI6UAHSgAzigBCaQC4zRcQxqAFyQC o6HtQMdGxjcMpK/SmFixcBpWR0fcMcA0kyVoPsREZPLuf3YPRqYn5E8qrZ3K7Xzjow5yPehiWqLR u0kLeeMK4GD2poXL2JLXT4Uw0kik9uaW4ORXksVWZCQWycZU/lQh8zK7TSQ3SgKEkUkYIp7DauhY 9NZo1uGcYzlgBz1oE5dDQgihuMlJcBT6YyKehGqHx3EkchTKuFOc+1K4WELrNMsluCDg7sjg0N9h 2toyeG8QQ7ZPlkA6etK/cLdjPu/PuPMHlFgQMAdhVagrIoXWmFI1eJt46nHamNS6MzmBVsNSKEAw OlMBQeKYhCPSgBmKQDcUhjSODjrQA00AKOgo0AcPTvmmIVe+aAHKOKBoU+1MBMDYT3HrSCysM7gU XAXGD3IqWxirJt47GlYdycE7OfSkMFxkZ60APbJcg5z0BpAghX5xk4ApNjFuDnO3pntQiUrCLvMR HPHpRpcfUaVbCt0H0pgC4XJ546UWGTO+9VIGGxg4qdg0I1Ubgec0xisGA9+1CAcEBYc5zzmlcRHt OS3UDtTuA4OuMEfWlYAxt6DjORQAwvh8YyKaAczbhnPzelAhYziT0/ClYbGPgsRn8aYAQvGKAF3n BAGKQBwDg8+9MBQQDySBSEODsQQGoCwnGBxQA5G29se9Jg0P9ieopBciwQ3pVXRQ5grdulSmIWMK rfMRg1T2Eyby0JO0gMB370vULDPKb1X86V0MgrYkQ8UwEoGFIAOaAFoAXk0CFYY4oGGaBBmkMTNA ChsUhDT3pgIGwaBjxjGT+AoAcpwPfNIGSrKFQh0yRTJEt7oxkAAEZ780wtct3Db4R5PKZJOOKBJW CKUShS7GMHjigDUtpYoiwJzkgBuvFNEvUoaki/bt4cEn2obHHYt2Nw7KVkT5lPQVGzJaGmzdp2Yo Yw3vxVoL2GR3Dxq+9PNKnbwOD9aB2QyG6ZGzswD2Hap1HYtFi8ihAFwuckc07k2JorqKOfymJDY7 96YeaILuAmdliXBfpz0z1piujO1DSha23m78kdQadtClK7sY/wDOgoAeOaBXFIOM0DsNBIPrQxA4 ycg0mURuMHpQJkfr9aAFHagCTBXBI60IQoxmmAAc0xi4we1ACNznAA56UgQzp2GaQDlJyfekxofJ H04/GkNipnG09RSY0SBcMM4xSAexwdynJpARuSOeOaBoejk8f0oCw/fiPKnBHWkAjODHgcd8UwGD GRmgBuTkgHimMA7BeDSEOaQsgx1FAWCPkHJ5oAeVZckEdOlICHnOcU7jJElAypGaVgGrjcOgpi6A wxyBQAKrAbhmi4CAZOev0oAVuFwOtAEsBTZ83JNITI2Qhs0XGKWDZIHNGwDMnPFADwWyM0CBwRzg 4FAxAzdhkUWAViGAXGDigBw4HpQIThuMdTQMcApbH60tQHYFAEQY1sSIaADvQMSkAdqAAdKYDgaV gEyetAAfbpQAmaACgBeegPWgAPShAMOcihoRI27g+3pSGOUEjNIB5XKgDOe9Ggh2wrGDtGScUJ6i vqSxAlCNm7AIAB6UxNkcJZdruhKDqRTGXN6cjzOT1oBEFwWLgNkc880w9C7aTSb/ADI/vY5De1Ik v3F0JIQm1skZJHQUxFZFRbPfCCUIOSTzmp66C66jLSaGMx+YR0ySe9HUbTL0rLJAzQ4Y9gKdrk7P UznMsD+Y6IQQcA/40lpoVo9iCCOZrnO5kyc4B6VQ21Yt31uq2rHzXkyOQxzg01Zk3ObAypHcUFiY YdaYC/SgBpOM0CEaiwCEk4ye1KwEbZosMF7ZoAeM59qdhC7SM0DsOz6cUAJmnYQUhjGbjFLQfkOj bB5pNAtCd92A3GKRY1s/e5zRYkMsRwvHrRYYqnI65qWgBunWnYABZCO1FgTHk/JnHUUrDAcMFYYz 3pNaCuHRsbhz0oGNKnG4EdcUeQCrjGDx9aGAAbRnqDRYBVcqnT9KLBoOHB5GM0gEck44AxQgImGO TTGGCwoAkUnbyKBAj5BBOKQCIOR6U2A9gTgAfjSAayY5BFACgM3WgYmNp7UASyIOCD2oEhE5BBXk UMTHcvJycAUWEhN4Q4BoGMkUFd4YHmgfUTdkZPY0AKSGJIzzTACDxxQA7K+rflSsTqR5rQA9KBif SgAoAB05pgFIQZoGFFwF9qQAcUIBOvegB3SgQhPPtQgEwcin0AlLZPzZNSOwiylRkClYLCq7Mc47 0aCJRl8AZPPNArWBGe3fcCc54FMHqSO7M7bRgE8p2p3uJaCR7mYgg5PcdqCix5fmpsXgjpk0xF+1 nhaJ7dwquF4bPWmiLdSOyv4EQRvlnYngDpQDTLiWyNA7uPkI3ACk7BZmXFMtoxFxDuXqvtRsO19h PPzdb4gVX+6vYUmwtoMaWWREjcMUD8Me9CAtx2/m22UZgVY7c1VtCb2ZMMPANy57NUrRiZy8ymK4 ZccZxVbGiFPTmqBDCCDQITnFADTmmAnNSAuDsJzzUlDBn8qdwHg4FNWJFDHbzRoUISSMjrQFgzTE HNGgaoTBpNAIDhxnpS0AnzgDb0NToWSHKIMHcD3ouFiMdTg8U7oVhEwDQAHLDODwaVkMVSDgEn8q YrkqyY+VuRSsMRmDnHSiwDcEfSlYYo44pbAJgHtSAl2FwFUZNK9g1IznAHp0p3sA8spAwcGkKzGq h3Y9aZQ6RSOMcD0p2sK4xSFYZHFKwChsZH8J9aAFAIzk4BoEKiD1yAe9DYagWye1FgG4I6UxjhuI ODwKWgC45xQICCMEmgYvPBAyD2o0FcYzkEZyD6HtQAcMeOaA1HFSUJCgenFIL6gBxggZ7UwHgYG3 uaAuL5bRgMcMDSuhKVx2D6D86AKuK1ACKdwExzQMUilcQelMC5b21rJas8lxsmGcIRxQn3E7lPHN K5WgcUXAUdaVxAcdaLgOOBQA084x1oATBPancQ4hlAXPfIHpRcYq5xk5qWMdtBbBIpXAcCuMA8d6 LkjmJXiM59cUIY+JVI3uSeefagQ9nWTJDYb0oJtYdEgRiG+9jg+lWU/IkicttOwsc9Qcc0ARzR7b jD5RffrQHQdBDGL87G4UZU45NMlvQuvcu1kHhkbep+ZPegXWzKU12blTAqABsZJ60ikrCwTPp8mU j3qy8g09hWuOlgkuGLNIqA/OFB4AouLYnFvPbRhldXQjJ5xigV02M+1tuIZ1G4cKRijqFjL1Nc3G 58DIyQtUxx2KsbblweoouPQUjB65piaGnFA9BMUrhYacZ4pXCyHfej2gc96Vx2Ihx04ouIUZI6fj TuGgueKLhoGOKdwsA4NFwshaAExilcYmMUNhYmtwHYgnGam5RKW2NjIpgJK0TKpQEEDBzSuFiMDv nNFwsScbW6c0XAYoOMYzTAXZsc5Iz+dABnHX1pAODDuc0ASKBtJHBpDG4xSswGjNKwDmJOOBn2oS AaBubHHvVLQCURlR1oEICynpQA1iS3zY/Ck0Mc4UrkEVOqYkIJOgbkDuBQVYHI4Kg/jQIEw2cjB7 U7gK2VBPfvzSuGhESxIOcU7lD92Bgfe9aBCqd3GcD6UriHbWPU4FFxXQ0bR/tH3ouMMAc9M0XACW CAqTmgLIdv3AZwPpQTYU4AIHryaEMXO0DnIoBBv/ANpfyoHykJBA6VoISmAZoGIaBADjpQApJpDD NAg6GgAJ9KBhSAAeOKYhec0AHOKQC4JAouBJ5ny7cZpWFYYFMjYX6UDJnt2QBQQaVwFjUKm7OeOQ KLgx7MhyBjBAwR60CsIUWMfKSXPXFGoJB5MxCud2enNVcdyWImD92c5J5x0oQia5neYgOFO3gVQJ WIYEDXkSjrnHXikD2J2b+y9Qba4KMOeM02TbmRSvAZJmlVflY54oKWhZtYkNu7NIQvAwTQS9xsfl 7pEDkFVO3HOTUjJpQyxJbpN/Dk7+uaZPmU38+d1b7zL0IFMqyRVuXdpMyZB96YWINu3kflTAUHNM QmCKQDCCaAAr81Ax0Z2k84zUsa0IypznpQAD0piFoCwvQ+ooATHNMBQKAGt+OaBABubGcUmMenyZ 3cipKFIJ5H5UJhYchGdpFADyo2HBwc9KYD4oJJMhevYHvSaC9gWF/N2HAIosFxsqPk5xu9qdgGHa ycsQwHT1oAI1LD5R0pAh4DAZ60DQrNkZIpAJknkAUWATkUAJz1XrTELvbPWgY5W39TRYBQpIJ25A 64pAIOSeMUWEKCDwcVLQxXbGB2pDBAxb5TmkJpWEKheM5PemFxqvjg/rTYxJCQS2OtCAIyRz6UA0 P85tuOMfSlYnl1HKSQSMUgGgjnIxQMliRX75A60EtjdgYnaOlML2EVeMNwe1BVxHJUjH60ALuNMQ 3ccYzxVgNoGFMApAHagA70CCgYUAFAAR70gFA9aYDsjHFSITOBTGG7A4oAbnnJoAfHLsJ28fhSAV 5iwU5we9CVhIQSFT7e1Fhj4WO7G3PfFMGXEkjt8Njcx5xjpSJ3JF1LKkeVhvWnZC5Ss9x5h3dwel FirDfOJXAJFPYB8btGCxZT6UCuQOxkfJHPtQM14YYIrVXZjtfHB60Gd7sy5mRbiReSuflbNBa2BY 3DJJblnK9eOhoDyZYkjj8xTu+d/71Ak3Ys2DpZ3rQ3QXdn5WB4FMl6q5X1KFbuV2txlhktg0wWm5 jk80FCZNMA3ED+mKBCA9sc0ALnnrUlB9449KYCMOhB4PtQCGYIagVxQuaAHYwMc0AJ9KYC5496BJ jSfypDQ0nHNJhccuXNSUSxghgG6UXGKc5xg49aYiWPaXG/gUXBl64RUjSRZNuewp7kJmfIxMn3if egsVUyD8+fWkA2WNUb72VpiFQ7TkHGeKkoTd2yetAATg4BPJ7imAo69cUAOZcAbTn1NIAZdjbf4a dxDGKZ+UEj3oAZngkYxQMkjcrGcHrQIGJI4YZ9aVwIxwOaBkm48CpsMXcV6H8qQhFJJyf1oGOUBu v50CYLkuV65oDoPwycBRnNAXIpEYMdwwaYJ3HpkNjk5HGKQmIV4ORzmgdxxBUjnaP50CFYngrhcC kJIjYZGRwfXNNFIfuLIA/T2osKwbE9TQMjzWghCaYBSGLg4zQAUwDNIBBQwHdhxQADg80AFACZoA cpA68/SkAh+lACDI96AEY55oAbnANGgxybn+UDJNAh80TwShHAz1ptWBO6uCPuYnpn0pMRMjI5A/ HPpQA1pcZAPHbFAxkb4bp0piJJJQ54G00l5gRKSzYpgPdGRgR6daVwBpZlRSxO09OeKYWFaZXhCl Tkd6BWHQXkyO4iOwEYxigLLqSLKxIypYg5OBQFieKATfvGx97pQS3bQfqEMFrblo3/eN2U09BRbZ hEkmnoUGaYhG+70/GkOw0n2PFGgC7vY0gAc5wOaY7DdzHj+lGgWHxtz0oBApOSBmgBetAgXqQTji mFhvOO9AWGk9qW4WEbOeRRoA+Fwsgz0zUuwy0V8z5gQAKFqPYYrHdgUkMXPGelMAMr7cEnFPQQ6C N5pMIu4jtikD03EdGRiDwR1o0GKcblHY0CNJWtwyo8K+m/PBp+pOvQhv4I4nDxEYPYdqHboEW3uU 33Ock0ihrAgjd6UDBW+YbRSYEwk84qmNoUfnUt2QPQGjVsDPHekpNCIWUDIAxzWiYAyBQCO1MQq9 ORSGDptU4PFSmmBGrZwDTGO3Ec9fpUtDANkk4PpSAcRgY9qaELyp6ijQLDldifmApaBYQluo5/pT ARd28ADik7ASDcoY4yfSkKwx8Mo+bBphawiFT3PFAaiqcnaPwp7ASg4U+vc0rC6jfOHtTsXYjxgc 1ZI00DDGTxQAvY5oAQjpQAoxQAcUAFAg49KYwPA4pAIaAHCgQdOgpAA9KYDWxmkA3Ax2zQAgJUgi iwFj7Q0ke2UBj2buKdwSIsfNx2oGLnauKAEUjcM8UWAM7GzSEKzhgcDmmA0ccg0ATKxkAXGT0FKw bEchyemMcGmA0IM8H8KA1LEO6Ihym5R6jigXkTKzhzJhQWHTFAWK8k/OxCcEZPFMZA8u5OuSPahI lsiC1VhAxoARaQCt0x1oHcaAT26D0oAMEdMflSAUkjAzQMTOeCaZIKOcYo2GP7ccUwEPUYNAhO1A xrCgSG9T7UrDAcUmh9CRXO3HQGpsO5MA0ZB6E0DuWUc+Vt2AnHWmmS0QbRLId2FA56UwLthPGsoG zYR/EvU0ImSY3U5I5br91zxzS0HFNLUjCpldqlsfe46U2h3JLmFljVlU7TyOOKQk0NRP3bmTgjpQ O5ND9j+yMZifMHTFMXvX0KLkMcjmpRWw2PAPUDFJjH8ZGCAOtTYbHKQeMYH8qm1hCOcfXtVxCwFz sy2OeOlaE2IcnOM/jSGSMBsyWBPcCiwDMDcOh+gqQBhjOBg/SmFxVI28jFFhjywC4YcHpSaARtuA O1IYsTZcCgGLN8jnyzkUhJjEZmbjrTsBJ5nyEUrWDUZjdjIAFAxUOCQopiHA5bLAUWAC454ODSFY ML/kU7jGdKsQh6UwFBweQKQxMelMAzigQCkAdKADpQAc0AFAwHI9KBDgPyouAUgDFADT7dKAGGmA oIxSAWgY4cdKYARwKAExxQAFTgUAGwqcUCEI5weKBirIAu0d6QhNwHbNAxQeCRwfemKxNFdSrkK+ B6YzSBpMikkeQfM2fpTuFiHeVLEce1NCGKDjJHFCFa47oMiqEhhOTzSAUYAoCw0nnI/DND2GIO/N Ahw5pMaQrdB04NA+gijn0pisKOOlAiTHFAxhHOKoQhwo4pAMNJgJzmkMX8aQ0TxqjSKoO0dzSGW3 t/KJ3OMdqYkwhMgXftJVaFoNjzJFcS/MpG4YAX1p3FYimjNu4+YEGk1YE7kLAFsg/N6ZoTGyxFIY k2lsB+uO1J6CtcJ7p3KxLIxiXoDTBLqDPuPJ/GkFrIhcdNrEjvQNDZBtUfSgYxRQ0BIoB4/lUsCR OfqO9SA6QK7KG4PrRHRAiOQbQMEVaYWEit2ncKoOf5VV1YRbubGS2h3H5lHBIHepaEncpnhsqOva m9R2HxKzlsbcr60JA9BGAaLAGG70rWYELFgQpJqgJT93196BiYAFS0AMflAA/GkAgUoc8igBQMnJ NAD+FVjnJxQA2NmyCaQyRnUk7l/KhgIT6DHpQIZ5j+1OyAKskQ0DAigYdu9AAMAgnkelABQIOtAC dqBi49qBBSGJ0pgOH1pCHMflwAM0gDO3gc0wI2zmmMYQc98UhDguMc8U7gOApDF7UAAJxQA5aAEJ yRRcBNhPPQDrQA3ILYNACDigBcZXNAChckYOc8YoAkQKhKsMY6ikAxwM5UYFMCMg5we9O4mNZSp2 nOBQIQDIFUKwmKGKwmOORQ9hiFTgkY496VwsJj5jilcdh8anBI7UMEgZTjgcUXHYTHNNE2ADHanc LD+TTEkGPWgdhNuKAGlc9AaQkhuMUDG45qbjsTR/Jg980hpGgl0gRgY/mIwDTuLl1CS+JtvKCAe4 ouLl1uMkQRWykYDZ4I6mmPqVmDTHuaQ7D7e2kmfy0BZxQhPTc0Bp00WDMBtJ+Y9xQ4i5l0FbTYh8 xkG3PUGnYXMUGXa5U529BU7F7lqzSAqxkbGBwPWl6idytdbWkygwo7U0ylcY6g7SBt4xwetDdhJD RkDrzU3G0Spn0qWBJ8rEL696lANYDOStUhi21xJazbkOQwwasWj3JprmSddrOSvXFZ63C1iKOBnV mTnb1q1qJuzsW4rBJ4w656dqdiXJoNQsDbAY5Rhx7Ghq2oRdzLZSFJce1MtCbtuATnNFhAz5HNAx ASBjrTAcr579ulKwATvwM4pWAdx70DuJ3GM4pWEIc44P0oAdncOaBjefegLC1ZImcUALnHagYE0A HH40xBikAUDDj0pAKcDGPxpgNoEAxQA859KLAJigBSMUANHWiwDkVWOD0pMCxHEuwDGcnr7VNxO4 kkIDbQQKEwIXQx8EVSdxoYMigYA46igCWKEzHC5oE2Rygo5WgYKNxCj8M0AIylTtPJHoadhDT8r4 FAaik7WDA49KQxuckknmmAo6Uhibhux29adiQlYYxg0IGM3DHT6VRIAg8YoAax4o6CEPrSGJnJos A9cYIpDQ/cGQdzRYZHn5unNUiWLnP0piH8DtSHcMZPy80xMaSOeM0agAbawxmiw0JIFBAU0rAN2g qTnkGpsMlCeUVzz3IosBZl2yACNAO/WgEQSNjAKkEUDNAhWsYzIykZ+6OtBPUrQzFLjegwFPQelA 2r6FhpWe+3wkIX6Y7UCSsrMnlluoSwl/emRcY64o1EknsQ2zQx5WbkHnnsaBu/QvR28V7EzybflU gY4xjuaS1Jb5dEZqxETsIDuC0mjS+mpDKpf19/aktCiIggHvTbAUY2gY5znNIB4yi5HQ96m1xCjO BSsAm7LdTVWGBGfw9KewD4xuUqM5FKwCK7xudpIJ64oWgnqXbPUfs4K44B6GmromUbk97qcdxbBV UnHP0qm76Exg07maI/tCkBG3Z45qUXsQSW7qxDIQR7Vd7BuNaJlTcVOPpSANoAx/WmMMDJGM4FLc NgGO5wR7UxChsZx+oosA1X554pMdxSQR0xTAUZVc9aVgDzW/umiwXF7UxAaAE5pjDigBSCMYpXAd 24oAQUAHBxk0hARzzTsAhHpSGJxmmA7260CCgAAJNIB2MHAIyaVxibSTgCmNk6ZCADPNSSTOCXLN jOPyqbkXIZVzgk55poaZGyDHvmqTKTHbAq8mi4h9qCJAV554oYMfeJulLkHBGaEJFXaQ3oKdyiWG MPFI3TBGB60rhewk0XRl9MGhMLkUahsqevUUxi4H4980gG7Rjg80DGEc0wEwWU5FAhmMdcHFUSKC AaYhjdDg0MEJxgc0hgOWycUAh2OMg0rjFTgdRQA3v2poWw5eQKYIfjgUAITzTADyKBCNxtOc+1Id hr4LcYpi0GxhtwZVBxUjRICwQ7lzmlcosWrCIb2Rie3HFBLQXNx58vQc+lA0rFszlLRLZ4QCehxz QTbW5XjgeKYcBif4RQx9CaDbHIXlHA42mgH5DUmd3J81lwflz/KgLEBc/NjOD60h2J7V5YwSudp4 NGwnYsSzxLbbYVKvRcSTuJbTC2QrMmVbrkdDSG9dilMwZiwGFzSKI8gP8tAyRWwGXIxikhE6pvty wHHTPpU9Sb6leWLy+Cc89RVopO4+EqjcqDnoTUsZYtbiOC63yKSuOgql5kyTasiN3SSZtqkZ6ZpM dmkJOiGMFVOQMHNFxojjVnzt4AoAt2sptJkmkj69PensQ1fRE51CKW5DtGFXuRRd31Dk0si/KbOW zlIdcYq9DNJpnNRxGWcDoKL9DV6Fm406SEhgCRjqKV7AmmUz8uQQN2adxjcnB5oEKq5HXBFAA/B5 oGAJx2oAKAHmgQE80wDg/WgYE8Y44pAGBQAue3FAC59qAsAxQAEDqOaAE4xSAQetADgVycGgQmeM 5pAHvTGC8jpwKAHIrlSy5x0IoC5NvwvXn2qSRhnO40WHYjeUsR6U0gVhd5PbB9KAsOXPQigQRsRK dvBxihgSvIXQA9gBQBG6HCnPSgNCaAEqc8A80mS2OkAIITpSAhMeBkU7lXGyfP8AOoGBwaaGhhAI 4BzigBY0ZwQo7UDuKynygFQjJoHcrzRNGQTxmrRDGDG7rTFoNbFDAT6Y4pD0Hony5xmpb1HoL5b7 fu8UXAQ8gDoRTAaSM8etNCHLwfamIdTGJ+NAg4xQA1yKA0B8HFIAVyoyhx3OfWpdykSRsytlxwaQ FxWgS2Q7iWPagSKkiqpBPBPIpj0JJbqWVkMhyV4FFwSSNe1vozbqPLBkQ5BPemmQ46jLNHvblyVB I6+lLcb0RP8AYorTU41wCGBPzU7WJu3Ezr3ZDPNFEAV3Zz6UmXHXUijlIiwWwB29akZelns1sU8o Yk/iyKZOt9SrPcGfauO/UUrjSsMmtmhA3DKHkGiSGncrkBWGO9SUSpGjMMnqKCWywIgMRRsSD1FI m/UbcKAoC8beuaaGvMqls9BjBotYsdGoDK55GeRQguWLiVHYeXgDHOKbEl3ImfB6k5FSMfEsi5Kq SoGT6U7Cuh8tz5ltGhGdhPNMSVmRq8eyQFPmP3eelA3cYo3cFtoNACeRJGqyfwk8GmF1sT/bbgQ+ WGytK4uVblQgkk4pooaVAHoadxCBNwyp5ouAuM9eoouJicgemaYC7D6ikO44kkcnOKYhPrQAYNAx yRsxIA5pCuNK44IwaYwx6CgBw6UAJ0PagB2R9KAG5xQAhoADmkIM9eaQahkg/wA6YD1xjnikMkgn 8vPHBoauJjmBcbogMfSkvMV7bkLljJtI6cU7D6EgiUYbOaVxCkKrZxk0BuIc7+etAhgG059O9MYP IQS1CQdADsMZ9aBD/OLHngClYOURmbGV4zQOwIzFTmiwMXBzxjBHIpgKiBWx27UXAcoYNgHGaQEy 5Q7ieAOBSEVrx2kjBYY54FXELFMZz2qwtYRun9MUhjDzigRdtztXpwBmoY7FmEZBJ6EUmMrvEjyY +7TArvAwkIA3DtincNRChGe4/lVoQoGBTEB/KgBhOeM0AIc4pBqDH5VoYCZ6gdPfrUsocZCwCk5A 6UIB+7DjsKQDCQxGDzT1AuqYRZD5S0meTjpS2BXuRBtuQM4NNAS2l7Naq6xkrupA1fclM8k4zIWe boufSmK1hvlTeUWIwvUkjvQF1crBzjBxx0pFCtwuev0pAKrg4yORRqIluLppYwg4UDgU2CViBG2n oCTSKFRgGB7A1NhFlHQqzrIQVOFGOtInUhml3quOOOcnrTVykiMNwOKBkrQMEj2/MX9DTFcfDFHu CTbkOaYrvoaRgso4WGS7kcChJCvJlNzcRROikbWx8vehINL3ICf9HCkYYNmgfUacthQMYHPvSKEO 3uaEA55S0KR4wAaBJdQCHnmlYLlrTRGLhopApDDHNVDzJne10Qz26CaUJ91elME3YglgEcaMCPmH AFIaI0OcA8Ed6L2QDZF247jNFxibh6UXDUkC8VYhMUguKOPpQA5XdW+XOaAt3EYlmyTQMQdaYhe1 AAvJ9KQw79KYDSaQC9RQAHGB60AJj5RjH0pCDgYxn3pgPMhIAxgUgQkXD/dz6UAydmJUNnHbjtSF YbIVILudz9jQK1tEIsoUAnrRYob5mXDHNMOg5jnBHAPU0iUBIEZOcnsKCrED5OO1MdgD498UCHYy Aw6+lADklwDkZ9/SgQ5H3fL2NJhYYxYE9aYxFlO4etDQkyR5CZCVBwaLDsCStuwSce9KwrDJfmHX ODVIZAfvGqRNxrGhgN7fShgXImwoBHaoLRKr4U9aVhkJkw1MB5cn270gIXOH3dM+9XEh6ArA/eH4 irJQpQE/KwP14pDIyhTqCKYDeq0gGsflFDAaOtSMcPpS6gxdwDc5I+tA/IRtoHHWgRKk37srtHOK AEU+mcj1pjJyCUHH1PrUgNkLhuS2RTCxKl1MYfs+47SaBWV7jPK5YbgSOmO9A0x6RMV5BA9fWpYX GvCYyCenoadxijOSQuRjvQIYqnn1pDAqTjAwR1pBcmjiJfCr1xihiuLNbgSbM8+lGwJjFjAbBIwR 3oG2Phm8g8AkClYGrkUszSuWYnH8qqwLQ1bFDLFE28NjjHtTRnJ2ZLLHGL8LnGOfan1FrYrzWMvn qigSKTkdutOw0yG7tZRJudAmBU2aLUkXIdJjnhVgfmI55oS0Ic7MYunLHODIQFHrRYHLTQr3cUds 7sHBZT09aLWGm3oMsrN7lWnY/IvX1pDcraFi/hijiRozy2PyqtBRbuV9OeFrvbc429iaWl9RyvbQ r3Ww3bmAYQnAqWNbDGQhR3weaSYDPwq7jFycUxB2oAARnmgBxYAdelKwxnXpTAXOMZoAUEigQhI4 9aBigjp1oAAvPJx9aQCdO/FMBTjb15oENzjODSACe9AXDI20AAOOhNA2P8zPXtSsKwpQmPeD8ucU BfWw0pjmi4XAYJCjpQA9oyqjkEE0E8yuQuewzTKuIcUWAaVGM5FMCaPGBg5pAyUwoP4uM5NTclMR cA8DHpTKFdAwwKEIh2Kh9SelMY4OANvekJDOh64HpTGSLnymGM00rsTZARg1RJG3HSkxoD1/rSAm SXgD0FIpEokUqQKBgiL1P86QCP8AK2exoGMYqRkdqaEyPIrQhCk0rAxVkZVIBwD1FMBN64+YA+44 oENYKRw2PrQwI9rDnGR6jkVI1qKDjFIeohILUWC4ADmgCe2dEbMi5Whh0BsM7bfyoGWIreZYRKoy uaQr9CORWO5mzweaYyNeh9RSC5IrERnBwaLgTfayscagfcOTnuaBWHzTJcHcx+c8n0FFgWg1IuAe n9aQ7j/IPmFQMUhXImLIM4A7HFAwWVkKbeMdDQFiywMiGckF84yD2ouTfoRbh5XBOUP4UFEHPPp1 NOwxu0N14B707AaunSSIEiERw54amZvual79mG2NsLI3AIHSjlQlcjsLYlw/mlxGcAHpQDfkST2S mYyOxYscgdhTsJyexXiaaOOQh1wrcY4zS1Ww9CpeQ3M0aurHa54BakUmkU7IJJehLgbgQRye9CHL bQtqptHaFyBAx3Ht+AobsTvqZ8rBdxGcZ+UHnipuaIaI1IO1gcLn/wCtQFyLg9DigA3dj1pLcA4q gCqEB7daAD3oAMZPPFACZx0oGLyaBBu4oBBz15oAUErz3oCw55Gk+8xNFxJW2GHkYoGA60CFPHHG aBidaA3ADaeaQbAeR9KAAE9elAFmAgQsjkbX7ehpPczle42Zj8u1RgfrSRSGlQDu/JRTDUeGLEDJ A9PejYVkhhVRkYznvQUtRpXapAAouMj25PfFMByPtNG4mWN0ZQA+vWkCQ3cFb5OR70ihplPIHApo QzDAjHWmAdj60ANxg560XAlXK5x+lXEmQyReM4qmJFduvNSMaB9aLgPUE1LGhcnJxSGTKx2g0DEd 92ARjFADOMHgUJ9gsN4x0rRMz2Ag+9Fw9RyZ6jFFwQzae/FAIRxhe9DCwkLMDxxWd2Wh5Ct1GD7U 7g0RuhB45+lAMUAOpOcHPSgQgOOAelAD1OAAPvetAEiyttxuYD0zQMN5b73OaAFDEMT1JoAcSu3H Q/zpAP3p9nCBPnzktQFtSPABFAFmM/JtVsjsDSYidH8pQScs3epE9QaNZxmRgm0dqYr2KUzNuCFs heKZaJ48oCFY428nFILXIiuwfIT70XGS23lNuWUkCjUl3FvYI1kAgJZSOBVAvMuaXceXIiSsion9 7rTTRElfYuXV3bq3mk+YG4AHWmwSexUsbqSNpXyUQngEZxS2G0WL4zSbZIZeg7e9NijbqVHurnCo sWFC4Ix+tSVZFb+0pU+RgDt4APakyuVFQuwk8wdc5pDJ5bma5MfnHIA4o1FZLY0Tbw3MUQwsZXgj PNPRkXaZU1OyS3CGNwf7wBpPQqLuUVTHz5ytTcrqGAHy1MQ7EfrSDUaeOK1ARu1MLiH2oGIDzQIc wK9QOfSgYD6UAIBz06UCFIxSuMXgNlc/jTC4AZOAKQiWe2aALvK/N0wc1TVhKSZAeTgUh3F70guA xQApx0xjNAxABmgBKBXHAjHTFAEomDL0A2j86mxNrDUZQylzjJ6DtQO46ZSikodyk0J33EmriFAy 7t/QZxRcpDWI2gfjR1DqOTb/ABcHFMCJtp65+tADcgAHPFMYFznmmK4hJwD2NILlhVCx7iv40gGk g9OaAGyqE24Pzdaa1EpakkQxESR1q0JvUVz+6IxmqvoT1Kjjn+lQUNwQBQGou4jjH4UtBpjg2aRV xQTijQAGCaQC460XGRg+2K0Rm2O6jmgLiH5egpiBWx7fSgd7CO2V5FJhcfBt2k4qHYpDiPmzkflS 0GRSDB6Y96YMFOUGRn1oFoBVOxx9aYri7SO3HqKAuOXDD0PpSGmO2GgLiZAbFAXF3Zz6n2oGG7H/ AOqgQHrQMkHygUhFmMxrGec+x7UhO4nmKSwC5Xtk9KEFis21c96LlAkzLnB4PWjQCWFy6lc4OOOK Qm+o4yxoq7AS38WaYIY1xu4xigCSK3eSEyZxj1otqF0tCfT4nKlgpOOlDFJllFju73aZSq9WB45F MnZFi4svsZWRGLAnGPShgncjnm86dmBCgLihsS0Mp/Ka6O45HqPWkaa2ESAkDKnB70DuX7lITbqq YAUZBI5oJje5mXDsXGW6DGc0rJFIiJJ75o0C4gfB9B6UWAOWODzRoA/yfpRqFxxI/wAasQ1jxTAb ntQAg5NADsUgAHqKYXD1xSACcCgLiigYg/nQAZ45oFqHegQdvagdwGKAFGcHpg0ANzgnHFAaj4sb wWKnByQe9IEOuJEJ/d8d8elCQMhxnnNAID90UwsT2zKWw4+Uds0noTK9tAYKXbbwM0hpuwzI9KB3 CTC7W7nrTFe5HkEmgY7YDGTnGKAuOSESbzuwFGTRcm9iH0I6Ux3JBLwFzxRYaY8RfIWXkfypAxpX K8k0wJUIEOBVrYh7idvpTsJshZTndikx3Y0jIH1oC9hnIPBqSlcFzS6AmxWIBGaLDuOUc+1IExSA SecUXGMI5Iz0q47EMevFMWonUGmFxpFADXPWpARGxjmpKuShwetFhpiMvoeaQACQTxQA1+famDY3 O05BIoFfUkDn2P1pgKJAOoIPsaWgagdrdG6+tMNWGw54I/OiwXJBGduWUj3pWHcRgFPBzQCDeKQA GyaBkq3ARsBSR3pWJaJARJCSFwB0oFsysiMz7TgZ7mgu5MjmJCiAZ7kUMW4zymIyD17UBcAAp2uc e9AalpJikTqkm9SOlIRPY6ilrbsrREkjg5pg1cqJIpV2+YPnINA9SzHqbPGscw3hQcEHmmhOPYiu Lom3Cqm1uc89aBJalW3BJ3bgCtBXqaDyRKh2uCQOnvSsSrkLQkpuaQZ6FTQVcpshMmOv070DGldr UAKELKTtOPX0pBcjOVPXmnYBc+9FkF2PqhATQMTPzUwDPpQFgP1NAWF6c0AApAHUCgAGMmjUB21d uS4z6UwEJ4GOgpXATPOKBC4x1pagIDzgUxoVflbLDj0pBYTI54o1FYMgcigLCEjFO7uOwm4dhS1A B8wAAo1Q7DvutkLQS0S7gUIUYFTYVmRYZctnntVDFOVXDcmgSIxj0oKsSLGWbb/kCi5LHySiOMxR Z2scknvQhKLbuyvjA9qZVrCsq5+XpRqFiRHK98UMY7zB3XikFiTaCnFa9DPqRFiDgnFILDSeKB2G E7eKQWGZz1OPelcqwowPepGKSCucUwANyMdKWorCb+eBQOwoPeqVyWuwqtzzTCwoHFMQh4FAEbH0 5pBYQEdCM/Sp1KHfKDnn6UBYN25hxSGPwGU4PI9aEAhUggEbjQGwny5wVIp6hYcI8/c59gaQNDSC OCKYrAuNwFIaQ7BPOe9O7Bj/ADXIHJ4pAKJWyAefY07sLIVVZmKkKDj0FLmJ8xpOxtrIKd7ghWeP sCD65pjsKJeBjj2qQsRs+T70WGkWICGypY57CkyWrErKuWUdVPXNAr2EeKM4LNzjPFFwTZXjYIx7 jsKZVhQ4bjg5oGCvhcZwtIBnyq/ymjUBWbzGOBTCxIYiLfzTgYOMetFxdbEStjnPPWlqMtWiLcs3 mOVoQpO2wSx+Q7IvzMo4NMSd0MERZBIpy2cEYoHfoR+bKjuudu4YYUgsiEja/XIFIdiXMPo3507v sLUb271QCYOKYxcA9TigWg0fWkPQXnFMBcsQBnigAHSgAIOB2FAgUEUD0DA96ADrxSDQXHTmgQcY oDQQkD60WC4mSRjrQMQ8CgWgLzwP1oAUqQSCcGlYZGByeeKYhwJAzmhoLj1bf9786LDH26CSYKzY HNITY8oykZHAFInRoZ5ZZevJPrTC6QnlYPTIoHzJolkXaDtAGeaSFEqMjb8k1RYAZPJoE2KowBTD QeADyTjFIBRjbxmgaJA2VxWiM2tRrLk8UBdDGUgUrD0Iu/NAKw3HXmpGrDlVjn9KVhhjC8GgBAOf SgNBdm0bux70h6AcjvnNNMTVxMnqOg4qkIcCemaaFcCmV3Zp2FcibrwTUsd0KARj39Kkd0Lg44p6 AJuIOPSkO4q+uen60h6FiNsIPlzzTsJjG2GPG3D5/ShaAIFPO3vQOw8MeATkikGgqLFIcFtjfpQx XsSSQSBBsAYeq80haFchgoJGDVaFCqBkE460gLk4zKMMoXbxip6GaehA+HdcHAxTWg1oRTIqnhs0 07ldNRi898DtQMOgzySKAFDc9cUCuTAkx9QM9aA0GEn149aTGIVHXdQAiFgx/nQGgjM3SmgDadu4 E9aNBEg+5joaQxpZimCTVWAbgjGc0rAXLK5FuG3ITmglq5Hd3DTzFwNucDAoGkkTpKY7UjdyOQOw pMXUz8s5JNFih2DsG7n3oGR4/wBqjQm/mT1QrBQOwh9c0ABNOwwJxQIAM0AKASKQwINAtgwRTsAA kZ70gHbSy5BHFACYYDOPxosITp70WGGO9ACBSTgc0AkIy0BYdtBAHU0gELksc8n3pjQAHPTg0rIL Ay+nPsKAsJ0GDimKxcEIgtEmz87HpS6EKTcrELTMV27iRSsXYkR4xt557g0NC5RGUGQlB36UCaGS 5K/KScHn2ppC2YzaTtwdxIplXIyD3FAbirwvB/OgaFHpn9KAsA6Yz9KLBYcr4xTWgNEgIH/16tMh oRmB4oCxA/vUjsNGOuOKQ7dQ6DqaQx6rlflPIpWH0EIzgnigA3MQBnIHagLC5B4bgetIYBcL3wa1 S0MpbiImGzjNOwiRoyPmAxntTaBEDBd2B+tTYdhqgk4z0qWrDtcAD0BwM96nYqwEHdxyPXFGgair n6fhTAcHdMYPSiwDh85y1Idhfu9DxQFhAuTkUwsOMRyfQdTSuIWN5Iz8rEc0WQFg3HOyaNWIpW7A vInSGxuMbXaJz68ildodmPfSpAcq6yL22mi6EVWsbgsf3TE59Kdxif2dc/xpsHqaLoCswVXIPIHF MBpAA4oHYV0wAR0pARbj600iRySHgHpSsNCpgAlh34oYWEZiSRTtoFgDAdKLAgVuvpikCQ5WI5Gc 0WBC78nJ49adhjg2TgnHpSAQykcKeDTSuJiZJNFgHKx2bSfwpNDsNJXbxkHGD9aLCAZC8miw0Lg+ g/OgNBfWqID9aYWD+VAxAKAsHQdfzoCwucY6UAKPrQApGe4ouFhuaAsGPp9aAsLjAFFwDmldBYQe 1AJDi2RgkCgABG8AEDHekMRicnNMQ1umaEFmIOPQUAiRW2g7sfSkMWNSzgcGgT2Ao28jjPNCBCE7 4xuc5HGO2KOokhuMqCAKLjswIweQcD2pg7k0LE8KTntmpZDv1HFCgfnk07jvsR42qSOuPyouO1yE kkbc07jEBIA4zTAeGyQOtIYcE8DFAgxjB4oGAzninexNhrMSTkY+lFwaG4Lc4obC1xQuOppXGkDc 44HHpRcYZyBjigLCBjkZ+agSFwd3YUh2Ew2QM8U1ZiehMRwBxitNjPUUDnrQMOApz1pisV3XDDti pYxCMNnjmlIcdhcNjpUFDWyMU7oGhQeuME0AOA6E0DsBOD7UCHc4z26UDHJwQetDCw4ud2RwTSsK wokYnJAzRoHKBkBBBTLHvnpSsOwmQANpPvTAeJ5VU4Y+3NKyKL8OsPHFteMMx70rIlorXGpTT5HA B9KaSCxUKF1GOtVcBFz909M0mPUsRuIASw38YAqSZJtFQxnaHxgE1V0LqJIqqwCNn3ouCXcQA5Pr QVYGUcEd6Li3ECOxwBRcLFpYERH3Al9vH1qeYi7exXVyGBxxVGmonJbaOhoFYdFl5lDkKM43UCd7 Ek0JSVhnKr/FRcE7rUjV8LnBzSKSBiXK8AfWmJ6lhooxCpP3sZOKm5KcuYY5V8bV2jjjrTLsJmP0 NPUdgGMGmRYO4pjVhCMZGPwoCyAYoFZBx+tA7BkZ6Uhh+FAtBRQGgnBphoAH4Ugsug7Gc8cCi4WA 9qA0G9jSDQMAjpTuGguBjpQFg4xxQGgpQbcgUgBRgYx9KA2JVg8xc55zQg0HND5ceQcEUC0GlAVJ 7/youIjaHAyB25pXGMA2nINMpE2UKjbgHHT1NIW5KqKkRaM84zS1ZPUM7jlm4xQKxDJIMYUYpopK xGrpj51/EVQegOQOnSkPQYBzgUwSHrxyaQ0BIoAAozwRTBJEZGc0E2FAx1FDBCrwxKnqMGlcdg2g E8Ci47IVUz1HFAE0TRJngkmjUTQydlkcMo2nvQCI2jdGG/oehqkJ2JAQau5NkIcDnFINBwUMpznp xTuKxHKgGPQigegwYIwByKQ9BpGahlaAc7hu+lILIeqjGRmi47IdtyM55z6UBYTYO+KAsgYHGDn6 U7hZDhx1AApbhohybSORzQMXYDkg8jtSATnj+lAAD+dAByeoHFADtwIzjOPWkMcsMhiMwQ+WDyew qkmK6TGbgFwKWoaEywEjBb5ycYz1pE85CflZgwJx19qCk0K5QoRj5ewNAmrkLQ4xubH1poNACEAl cEd6GFkNWPJJIxgUXCwEDAGaA0JFJByWY+2KQWQoEeDlTkc4o1GM25HAK4p3CwBcHGM96Q0Md2C4 7HjFCJaQFNq8jH41QWQ5TtYEc49akVkDnJ9BTHYlRRs9T3xSBuwzj1p6DFzVEjk6liOgzQA0nmmM TnFIAPI9KAQUAAJAIoEHXHamCQ7HGcUDEHUUgA4x7UXFYXvQAhpDDGMYoEHf2pjHKV29Mk0haijJ zwPpQAnKsMemaBil3L+w7CgC/dEvCmFGe/sKVznirNlcLjnPWkW2JICAoI+WhDRBIpLFgmFHApl7 aANqqMcmmBNEw8l/0pEvdDG5A4plIjOQuMUDI6YhATwKAsL3yOlADgc0DsIwxjFFwsOzgdM0AJj5 eKQDdppgSeWoQMDk9xikA0Ak9zTAVR2GaTGK6PG4DDb6UCvcQkk5zz60DDcSMZzQgGg4OKq5LRL1 GatEtBj5vY0yRz4K4IFJjRBsAPBqSiM8HrkVI9xR15zSHYfnnrigBwYDk0ajFVlUcjNLUAyNvA5p gN7UxDlxsPzc+lIBNx6YxQMF3dutABk55oAdklR6CkMXORjNAFx7yc2ItRhY++BzTv0Fyq9ymmVz wGpA0OSUIhzndn9KLEtCSOdoKv8Ae+8MUILEOTnHOCKYwLZ+9kmgY4FUP4UmFiUtHtLquSOvPalf oKzI/LVxuTII7daLgvMdtJIweT2oGIA5cofzoC5Ye2Cwbg2T/KlfUV76FJ2ZX29KrcewIct83Sls McEUng5FMCWNQSTzlR0pMTihrqGBxgCgaQz5iPlJAoCweWfSiwWFIzVmYhyBz0pjCgBOaQBk0wFH UdKQC9CTxQAHpnjrQA4EkYoGIFIbmgLCH8KBC96BidTSEOJI5GM0AHGev4UACjJxQMV8cDcetAhB x/IUABDK3PJoAl3OIw27Jz+VSK3QTe4Y5IH9aY7E5fzIl9VGKki2pEwMgCZJqtirWGeUFBxxRcQ6 Ifu9oIBNDDqRsJOc9BTKBM9RjjtSHcJ1jGNnXHOaaJXmQ4wOlMdhRnNK4xQpJIzRcB20qRxTAQjn 0oEICeelIY4e9MEAPzUhjlyc8UCE3srgjtQDHM3mHqT9aAsMK7aAEGR1FAxSAR05oQhYwdhq4slo fngdKq5CEYZxigaI2FIZEQc1IxFPzdsipKHEGmJ7kqpuXJ4/rSHsJjkjtQA4NgcAUIYnGQTwDQAu VB45FADR14PSgQ7BZxsGG9qNg2QhVgcHgjrQhiDAXk0ACKN4yTjNK4Fh2AGMlh6ntSVxNsi3Ij4A z9aoNxnPY96AHrGTgtyM8ilcVx5gUsxU4UDvRcnmsVuAexplASQ+QBRoPUljCncWYKew9aW+4xVZ UXAAH40mhClSw3H5f60FCo2ADxnPekxWCQO2Md+opjItm5uo96LgNZSOmKYhVAxk8UhofnbnnGRQ MVFUjJyR6UgF2rjIfj0piDDf31p3QhnXpVEiN0oAQ8HNMBQx96QCckcetMAHFABnmkFw9KAHhivI PJoGNyeaADccelACk9OKBADQAoIHbikA3Gec0w3BjjjNAC9VBxkUgHAHPtQMCxG4ZoAbgjFAATuP PagCWPowBPI6UhMaJTHx3osMPMOQTyO9FhPUmQLJkBsDtS2AgdWUkd/eqQxoLAHigGNOT97k0BsI M7e9AC4GMnP4UwuIvXvQK5JksaQxHzxTQDcYNAEigcc/hSGP2AnAzSuAx1KNjP40xDT96mAuRuHF IAYe9AwyeMg49qBCkc0DG528npTTsS1ceACOCK0IFAw2TQFxJWODyMUMEQP0Oc5qBjcZOTS9Bko+ UEdj1pFDgSvI4/GgBMFj6UwE59aAFx60rjF28deKAG/d6UwFQ4HT8aTEWZodtskysGRjj3zQlpcS etip94Uxi9AKQyQctgk9O1IVh8Xlx7i+GPb2oJkm9hssQABBz3NFwTuJGBvDHBA7E9aBsso6CAso A56mpszNpt2ZVnC7kEeScc+5q0WrrcY8TIcONvHenca12Gg54zj3oGhueMfkc0h3HGWTcAcjApWC 5JArSuSQcDpihsTLCB0D+aMYHFTdPYTZVyFfnpVDFeJ8ZUHae9F0K/QaQcn+lK5YoXDjdxTuA8HG cd/WlcB2B5fJ/KgQzcnpT1GJlgpUEgHqKogTkYoATn3pgGO1AWDGRQAc0AIBRcLCkcelIYc0xC44 FK4CEYHGadxiikIVenpQFxBzQAY5oAXb8nalcYYI9aBAQQaY7iHJ5FIBSxK80AIp7/zoC49cscjj HpSCwrIrMPnPPtQmLUcw2kYIIPTigYKQMtj5h3X/AAoCwnmk8HDL7igBoDysFVS2egFMLoaylSRj pxzRcAXjgg4NK4CmPbyGyKdx2EGM8rQIcAMckjjjFACYyRTAdggUhiBDnjrQA5ZGUnikAmcnkUwE A9TQAp5OQKBCYyfl5P0oACvHPBoARQQ/PIoGEgGSAaAZF8wIwaaZNgadvu7cgd6fMKwjzh15XGKL iGEg4wDSbAeFOQf6Ui7Eg9OlAxwGcc80CDbzmgYnO4D1oAUkg4xjHHSgAOAemTikAgBx7GmADOcd hQGwMOMDO0dqEA1e/GBQArZNADosI4PNJgLIzbySAM0LYBytvwOvsaAsNx82DwKAHHKDjp/OgLEs LxqAzcNnOcUnciSbEu5UkkJXLe5FC0HFWRWHPIA/KqK3GsoHJxzRcBY8vIC438ZwaBeRNE6RvkEh e61O6E1oAlZlZQDg/wAqLDsNWNd/zHjp0pibZYmZI4WVCcnrSRKTvcr4TGeTSuXqJtJA+XmmUh+D 5eCOaAG5GwA9KYrD9v8AtD86BkOcjFUZ+QZoGBbtjIpgISfSjQA3fLQAvagLAOtILCgrsIYMSenN ABnj096EAA4Ge/1oATPegBQ+KAFyW9KWwCN2FACknjigBuaYCsxbrSEIMimAAjqRRYBegweDSKsI ACw9O9AWJGTOdrYHoKQlca3AA6/0oGhM5baSRQBII3AJ6j1Heh2AaYnBwenvRdC9BVleE5jJU9yD QFrjpWRiCm4565oBEQ9iaBgQwbigBN5J6c0AIW9vwqgHj5jmkApJHSgBNzetADsgj0NAxM5HPNAh Ae9ACluc8CgYivg7gcEdKBEknIDFgxNADM56giiwxG6daYiInj0pbBYAMHoTRYLDVTB5FCE0PRV7 nn0oCw/YQc54oGNbIoAUFuhFDAkRQfvHbSAUgMnHUdc96LjSYm8kfNye1MErChQV44NILDRlSeOP SgEAGc0IBCMYOKAsKFz1YCgLAq57UAKRtwcjPpQwsSENMNxABA5NLYEhhUq3y0wHDLdR9KYEZZgc UCEZvlAxg96AGjIyB0oAfGuWxyB7UmwYTLGAPKJOPvZFJMCBmwcCqAMcZJNArEgb5c45HoaLDJkn TChl565qbAN3Zye2aB2GYJbA6ntQBJMpD4yBtHSgIiYAHX9aAY4oSyiMFuKLiT7jcN/do0HoR9ut aECHnvQMMEY5pDE68A0AL2oEGfc0xgPc0CDoBzSYCgHFMA5HU/rSAQj3oGHTvQIASfwouAE9OaQC 5pgIQT60IAH6UgFByepFMBCeOM0DDccYNKwxVODSAcflPXrRYQH7w5zmgexJGuH57etJkt6Eu/EB 2ucq3SpAjMobhlOB3FNKwrW2AIp7kelO7FdoY7KV2jrmnqUhm4A8gkelBQE5J54oAaDngnFNCBDg 8gMe1AWJGcnAzwPSgBpODkGmAKCemaQBk7sE4pgKnQkk0gFCsemTQAMpB+Y4oAQ49eKAHLg0wEI5 60gG5IB70wGrjb70hgCME9qQCqwPI5pgNKnrmgQ9Wz1ODQMXbu4FADXJGMHBoAFJz1pIB2eOtAx5 2BBjr60gGjJ7mmLcMHJBFAxFU45zRcLCjgEEnNADcnHfigBwJI9KYXFPXmkA4YXAJODQBIcg88HH Ge9ILoYWk2/yqrCI9pGTgnNFwsIf7x5ApAI2GYbcigLDkEisACeaNLCY7CqpIOe2DSuBBjLZ7DvV ACgE8k0ABXkjJx2obGSLGSRlgB70gZIInPzZzzSFzIXbhTIDjHSi4m7uxG/7zq2SaCraE3kIibi+ cDNK5HO72sRLMFIxnd9aGimrk+R70WFylUdPStQsNJ6UgDHPFMdhQCMHpSEIelMdhTSCwAd+goFY G68UBYBQFg6ZoHYSgBQDn6UCsGCMjpSCwu3I5poLCY565oGGc55oEwI4pAAB9aAsA9DTCwqRlxxS bDYFyuSelAxRKM5K5NKwWHO2VBXHPoKEJIsW6qwbcufQ1MnYzldETHC7VGATkmgsRXV8gjBznNMq w87GUCM89896CXFkTxGMkd+pNMaV0NfIwT+NA15DGIVuoNACkoVLDOaLgNGCOtMLBlhx2oAXcCPe gYuc8ZzRcVhB1oCw9cdDQAKxVgRxigBZHMhHagLDQOOlA7C8D60BYTOe1AWEBx0oCwUBYbgg5zxS AX+HigLADngmgLC4weRTGKhKn3pCAjn0oAMewpgGMNyc5oAcRx2pDBRjmhiJY5FJIYE+9FrFA+By Dx0pCGYz3pgAAHU4piHFw6bQvOeopWGBiIXsKLiGAd8/hQAM7EBT2oCwue2TimA3c3JyaQw5bnBw aQAjBWBx0osJkv2hSGcLg4xRYjlew+2h8yOT5wDjvSegpys0V5oHhGSQwPSqTuNSuMQBmVWOATQU 9iWeEw4Gc5oFGXMNhXc3GenSkUyxIQWwM7VAzSJsIqeacElQRxx2pN2JbsiuAVbHHFUaLYfvBBBH B9KB2GOqkjA6UAJ8/qKd0Ap6VRA0nuM0wG7ufrQAueD60DDd04osAoIxyKQMXdxjtQAmemKAsLg8 HHXkUxDc8ZxSGBJOMUALux25oEAYjNADi5K80hiKu7PbFGgWF2YHUH8aYhpPFILAHxx+tMADbm56 n1oGPA525wfrUiYuw5wadwuAj2jpxSFcUNnPYCgCVJQAvJpNA4kUzFvlU5FNDSIiCqc8U9Bjoixz 296HYCRNwHJ496nQTYkinO4imgWhFtRmABxmi9hsc0BUHBX8DRdDsRquKegADkkdhSAU4A55pgNy ARTEOByetLqAoIBpgGeQaBjwV7/pSAQnj0FACHrQBIqDaS7AegpXJb7EWMHrTGL/AA8UABbhV2gY zz3P1pDADJIHOKYAMBTuBz2xRoAgJ47DtmgYo+lG4hyspjO773akGtxQcr0+WgBDgH5cmmAEYI4o AkbYAOCD60ANHr3BoAeG7/Kc9qQwUBmOTwO1AnfoREk9sUALzGwZTTEKz78s55NKxWw1ThepoFqK oGcnofegBSAuCPypoBeCOgpDQE5B67emaAGqkZByxz9KAsHlKB/EaLgTQOijbg7fWpaIlEdc4K5U gChExRTk3Fx0P0qlsXaxMJVdQGBDDvSsJKw5WRA3PzGixQhkAiIXkk5JoCwvnhowh6g0rEqOpFtw Ru4plikHGcflTsBJLIrJGqrgjqaSREU7tjcr6igq5GRxWhA3BxQMQDJ70AFAAOPrQAfWgAHXmgOo h7CgPICMCgAHNIaY5sLgKc/hQIPrmgBCcHrR0EKP50WHcO5HagBD/OhA7CgcDsaAAgZ96BiEjsMU CuKpxyc0rAO3Y5oAchZhwOKQnYXAVfm4HagPQTzAoIC5GO9Fhj1iUKGz1GRQCYnyt8u7igY1TgbR xQxAZfnz6UWCw5pSwxxzQOwxUIIOPxoC4rR/uSxyTmhE8zvYi2uE3MOBxmmPmV7DSPlBB/KgPQVW wCB+VA7ibR1FNggC88HikAZ25HWgBQeAMHNAX0Hj8aYgwTSGDAimA5CN3zYIpMBDjd6CgYmQOOtD C4ufm46UgHlwRnaB9KYiMYJoGDDsaAuKrFTuXIIoAVnLgZwCPbrQAoA7g/QUAJ0OQMD0oAeSq4xz QAmAfagByqqnLjII7GkLUFVSOc0PQpAYsP7UJhoOWQo+U4x6igW4x2LnkAHv70BYZwG45FMBXcMO AFpDEAynvTEKrckN0pAOZT/Dz6UwGl2VcHgZ6UguKjYGO/XNAx24bCSMH2oAaJCVCYAPrSsFw+YZ DYamIQZGSMigB+9SF+XnPpRZiaGudq4b8DigY3hkAWgY0KNw7YpMBzHJx1oAUH92AeDQMNjsOO1B I3y39BTuMX+lWQMY4zRYBAcetFgDjFKwwFMBe/SgBAe/5UBccMbRnqKQDSfQUWAO3TmgBQQOSMj0 pgGcmkGwh96VhAelOwwzSAB759qYhw568c0AxUVSeTQF2OkZcbdo9mFAyLq3GcUAPwvHWkK7JQzI i85HpSJ0uJIUYqozjjJpIEnuSSmKIgxgNx0NMmLk9yuzsz+wp2RotBrEADjmgY5CxHvihgxDGT1/ OloK6FZCpyuSB3oBMcXBG3GPegA3bDtDZx7Ug3Q1lZvvEkelMWhEW2tinYu9xyyAqQRzSC4hODx0 9aYC5BOMYNGjFqAHByMZ6U7JANBC47UASEdCMGgYqscY5FIBefxoAafTH5UAKOD0oAay9KGADjrR YA5JzjigCRBkHGKGCEwd2Mc0AI2V46GgBMjHvQA7PXmkAM2B3/GgegobceAB7UAO454oAkgSKRWE jlWHQ0PQl36DHQxsBnP40FIdyFPGc0ANeNhGpK8N0oFdDBnimMULnlqQDCNpxigBw27hzj1oAkKA BiMHFACF9qjnFFiRkm0AFWPPrQgTYkTfNyM0FXHnGWxwKAEAIOV6Y7UAJuKnDL3oAkJB7DHpQgAu ccLyD2pE8upBk7sNn8aasOxK0RUAIQwNIoYFxuDc5p2ECqA3y9RQBJ8o5IzSBl2eSwNgghDLMMZz 39at2IV7lHI9qVihF6dKokjYYoBDTQADNAAPpQAtAAORjHNINQPbigBBQAE57UDsJ2oBCjA7UEgD 2xSHYXHtimCAAfjQNiDgEDk0CHKoY4Bxx1NBI0gBsZ5oGSIA2c9e1Jj1ANt4QdRSBoRcbhu/SmCJ ZCQ4yu0DpSFa6I2ADZwCDRcaCNWZ+nahiYhfI5HPTNFirDSBgf7NAWJAy7cgc+9BNmHmA5RyRzRY mzWpIrRquSd3oKWotWN8xRuLLknnFFi7MhBA+br7Uxjmk+6fbFKwiMqfwplbAqgKTxTABhsAg8UM BXQbvlNAnsKqMtFxiMq5560xWFC8DFIY5eOelAASaADaSaAAD5qAHjBNIaGlc0AxDimxCZ6Y4oGB JXoSKAEBJ6k5oADzxnNIEKAA3PQ0wHl2dduAQoxQJIaD2xQMXjscUANDbW5FFhkgwV44oEG4qRkZ A7UIC2t/02QoAo9M07k8hVllaZyx+XJ6AYpMaVhuCB0zSGNwc80xCgA0DHoGycED60mAmwbix/Sm ARsqn5kVlJ6NQFhwIVyAcLnuKTRLQxy3m4IBHbHehIEh6nBBIGPShloeXHGeQO1IljH6jPf0oBKx blkigtVjiXLkcsaHqRG7dyiS0jDjmnsaXtuAfapJHTrQMczRiP3zwaWpOtwAXIJPy0DuNlUA4GQP 50XBMjO3bx+dMY3I/u09REwwcCqJGNwcGgBmcHrQAueOtIYoyR1oEBNMBAfekhjs4xjvQIbzwe1M bDjHvSAQn6UBfzFzRoICcCiyAOveiwB3xQAvrSAXGaAEJxxjn1p6AKp75pDDPPFFgFQgOeKTQD9+ 4MOpHNImweZvAVhz60WKHlhGePyoEiDdu4xT0GGBwpH40CuKwZXG3oKEAp2nnnJosK44bYuSM+lI HdkQUtgj170x3JSqAgE4HqKTEm9yKT5W4GRmn0KQB9pI7Y6UWEDlWxtFHqMUkKF29xyKAsGDuwCM mgB8iKrfu2ZhgfeGDmh2AQopx6kZ4o0C40Y4x1oGTeWfJ3Fcc4oJ6kZZcYHSgoXNADScdaYhA5pa DFcnjFACZo0AMZAwaYCBueaAHBvlIx360AM9xxSuAoJB55FGgAGAPANAEseD9aBMCFUnJ5oC40g4 6ds0xjVPFAC5z6UICSIgK2Sc9sUguMZ+/emA8PhccUrDuN3DvQAHrgdKYgRd2RnFIBVVlznoKBjl dXPzDntSAklQGPj+GhMkr7sYyKegwLEqOPpQFwJyTjINACq3yc8mkD1Gyc45pglYVHZHOD2pWQNX EHz+x+tMNiURjCcdeDSJ5hZbYhSy8gelCaJU0xzRAWqls7jS6jT1sVSOOnPpVGg3aPQ0XCxKDg59 6sgSQHdQGozBzyKAEIoDUFoAcCaBiUCFOOM0ADZwAGyB0HpQAlIeolADgMdTzQxITAoQNBtPamIU gnrUjVxCKYahzjrQADrQMUcEccUgHgAsMZHrQxbDsc9MjviiwhuxAxOcelIauNBw2OuKYyTcJMhh g9jSWhI0qUBA60BuGAAfYdaA1G7+eelBQKwLEDpimKwuDsw3SkIPurjPHp60ANjYsrZ4otYbGAkA igauOI3HGTT2E7oaBsbFDBeQowW9KB3H7CCGH3qQDt7bt36UWAV2BBxwaFoFhsSAnLcUMZcd/Mt8 ErtUdMUhWKHGSPSmhkg79x60CE9V6j3oAQLlQRzQAEdhTQhRg5z07UDGd6AeghGDxQMsiFduFJLf zpNkXdyJQM/NkgdQDimUCJ8w9zSFdilFDd8etO49SZISeeMgdqm4DJYmycDH1p3BDVikVcnpRdBc VY28vdnvigLixopyG5+lFwFMRVPlYEd8UXuAzZxn+dAxoXOcHimA4AAdOlIYr4OCowKEIaCVPHSm Jjoydxbdj2osNCP8rZU9KAHLIGUqevXik0IUESHBGCBigNh0iBY1Ugj27UCW5G1u6KpPCtyKBuXQ Tb8nyn60FACNoGDn1oBCEZPXOKADYSCwB+tFxMQEqepoBomE7FQuDtXnFLl6kKITTmQDP4YoGo6k LYyO5plJiYP92kAHjPatCAc8g5xSGM79aYaB260rCHAqF560DuJ260AIppi2FJ4GKQaBxmmCsJkY pAG4juM0wFz8wOaQXAY6k0ALnByKAAnnrSGITnvTFoIF44NIA6Ggeg4MMcdaLBcVMg89fehj8hwl IBHrSsTZD9y7V2YL0hJu4wIN3zcUyh5VAuc4x60ITEBBxk9KLAKFBzuAFK4EYjB68U7gJ5RU/IQa LjsOwXTjkigWiHlOz8YpCT7EcUTM+DwDQNuwkkPlsckY9Qae4KQwYJHPI6YoWgNknlkDJA4oZPMN ibnoPrSaLuSNgjpg+uaaQriAKWzu9qBrUHXnGaQyM/K2BzmnYL2Hksh5oDmTHoob7o596Q7D1Xsx AHtSv2Jt1IJcAkKfzp2KFjYkAHFAkO3BDjAJosAzODTAQ435/SgCRdkkme4oYrkjMSTjsKQDEdHX YQT6Ggdx4TYVNFwIy3Y8D6UDAOwJZc0aAOM5K8nNFgHLIFwDznpQ0TuSA7xsyARSFYaI/LbBHJ70 FbiMrj7pGaegxjSlV5UHtTsSIJFKlcYNIobx0zimA1uMYNMQOdrYHSgBwk2qxYAlqAGBgetAIlVV 7E/lSGCNubkfd/WgmTHrIP7359qViQlkklIDNnHQ0IsYUMZznH0p6ANJOODQUhYhnJ7Dr70CbJI2 XkYIX0FKxLuyJSC+ccUFdCUSIMBR15o1Iv0IrhxvJQYU0WHF20YxNnvupladCXb7r+dSLmP/2W== ------=_NextPart_01C8E823.DA10E9A0 Content-Location: file:///C:/8E69C634/Classof2004_files/slide0114.htm Content-Transfer-Encoding: quoted-printable Content-Type: text/html; charset="windows-1252" CHSAA Hall of Fame
Dennis Teeters
(Grand Junction)
nA longtime wes= tern slope administrator and coach and former CHSAA president, Teeters spent his entire 30-year educational career in the Grand Junction school system.  He coached at Grand Junction High School where he was a teacher and football and basketball coach for six years. In 1983, he became athletic director at Fruita Monument High School and became a “master” host for state level athletic events. In 1985, he took = over as District Athletic Director and held that post until his retirement. During that time, he has served as board of control member of the Southwestern League and coordinated activities for SWL and the Western Slope League. He has served as the = site director of state track meets, state <= /span>tennis championships, state golf championships and the state softball tournament, along with three state football title games.
------=_NextPart_01C8E823.DA10E9A0 Content-Location: file:///C:/8E69C634/Classof2004_files/slide0114_image017.jpg Content-Transfer-Encoding: base64 Content-Type: image/jpeg /9j/4AAQSkZJRgABAgEAyADIAAD/7QE6UGhvdG9zaG9wIDMuMAA4QklNA+0AAAAAABAAyAAAAAEA AQDIAAAAAQABOEJJTQPzAAAAAAAIAAAAAAAAAAE4QklNJxAAAAAAAAoAAQAAAAAAAAACOEJJTQP1 AAAAAABIAC9mZgABAGxmZgAGAAAAAAABAC9mZgABAKGZmgAGAAAAAAABADIAAAABAFoAAAAGAAAA AAABADUAAAABAC0AAAAGAAAAAAABOEJJTQQAAAAAAAACAAA4QklNBAIAAAAAAAIAAFBIVVQINQAA AAAARAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAUEhVVAg0AAAAAAAEAAAAADhCSU0EBgAAAAAABwAHAAAAAQEA//4AJ0Zp bGUgd3JpdHRlbiBieSBBZG9iZSBQaG90b3Nob3CoIDQuMAD/7gAOQWRvYmUAZEAAAAAB/9sAhAAB AQEBAQEBAQEBAgEBAQICAQEBAQICAgICAgICAwIDAwMDAgMDBAQEBAQDBQUFBQUFBwcHBwcICAgI CAgICAgIAQEBAQICAgQDAwQHBQQFBwgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgICAgI CAgICAgICAgICAgICAj/wAARCAJ7AbMDAREAAhEBAxEB/90ABAA3/8QBogAAAAYCAwEAAAAAAAAA AAAABwgGBQQJAwoCAQALAQAABgMBAQEAAAAAAAAAAAAGBQQDBwIIAQkACgsQAAIBAgUCAwQGBgUF AQMGbwECAwQRBQYhEgAHMUETCFEiYRRxgTKRCaEj8MFCsRXRFuHxUjMXJGIYQzQlggoZclMmY5JE NaJUshpzNsLSJ0U3RuLyg5Ojs2RVKMPTKTjj80dIVmUqOTpJSldYWVpmdHWEhWd2d2iGh5SVpKW0 tcTF1NXk5fT1lpemp7a3xsfW1+bn9vdpanh5eoiJipiZmqipqri5usjJytjZ2ujp6vj5+hEAAQMC AwQHBgMEAwYHBwFpAQIDEQAEIQUSMQZB8FFhBxMicYGRobHBCDLRFOEj8UIVUgkWM2LSciSCwpKT Qxdzg6KyYyU0U+KzNSZEVGRFVScKhLQYGRooKSo2Nzg5OkZHSElKVldYWVplZmdoaWp0dXZ3eHl6 hYaHiImKlJWWl5iZmqOkpaanqKmqtba3uLm6w8TFxsfIycrT1NXW19jZ2uPk5ebn6Onq8vP09fb3 +Pn6/9oADAMBAAIRAxEAPwCkGZpI1Hliwb3ixbsD9X3c5kDwqBVirz9mw4RwodpBVMbKcaeVYlWN i15DuYq2u3vbUflxzvdSo0mJ656Y5440utCQSemuM00qFirhVjuGIN9Pq4kZUUrxHi6ejhM7PU0b KclMRSVy1heLZhzHmSfDoJJ5MKpDRRJEbIHntYm48Bc6/VzJLcdpxFt4UlQE+0xjjBnz6umg9mYB ME88/uomPV/HaTBziOEzRCUYfV7KSCUgAyREq2rKe9+w4P8AI7V958JbToQJHMEceHpwouCUtpKj JPJ9I54Vm9P+FwZszOmI1EJEeGu80asWIL2YgAt4AEX04EO1nNXbKy0QQpYjFQwHVEEyR7op3du2 Q8/qx2z+o4Cenj642Gx4PPVwAwxbgb29gBPwtzEVWY6VESZPRUjFoFMUjM15Xxqop1oKJ4xNVttC CUqbAG48Py4Kt3s0aS7K0nCeHn1j1+eyixGX/tJn4czS0ynk6TK1AkEu95CoeWRyGBNtfDgV3i3h TfPFQ2c+VCRhGgQBU/HcCTF6B4yxWaT/ACchH06jvxPlmYOWqwsDDhz1U05bJWDjQLYbmGqy7XVW CYhcpTtYuxtoTp4Hki3GVN3rAdbBM/Hj+nThjREi4U24QdvPspcGupsUSOKnkSWokt5WxlOp08NP q4HDl7jK8UkCeerjSvv9YFLfFMG/k8C4eq+dOFQO0Z0LHU20/Pi3PLIpfSlAkiJxwnq92PtxouzQ hE0nqGOrp5nRGYqTeQq1rAfRxbu7vB+VdTtg8Jw+PSPLDzFB22QoqJoVKfqJhmHYT/LUp5jvDQzz 77MqkDW5P58k9O/louCkE7R5df4fpS4XehMGoMeeJ3MmHYXN5JaNBJJFYSWP+Jl8fbwJ7w7+XZnQ mEkQOJ/SfjhW270gAJM1MoKt5J1MkjMUO1iW9v8AbyHs2zu4uFftSfT9eul7K5VhRg+m/qZ6mdHs GzNgGXMQcYHjREktI8jEKwGy4F+/MhezTtUvLLJlshRCUDYMTGzidvs6PMozTdVm8eC9hoD8xdU8 x5gxiXM2Z8Qkq6lLyRQzsSo+gfXyNc07QMwu7sLSZPROGPr7eg+VCO2yVi3Z0gUHOMY1U51rlnqZ LRJZI4twJ8RrxBnefvOOhREKGGE9PTNKLWzSBicBUN1joY/JhG1mI2BSTYEeHAsHS4vURspctyBA pP4phklfSSRyRl94PvPf9fv4a2GYJZWkg7Ojn8aK7pC1LGFF2rcPxHLdY8sEbJ77KqtYNa/gbDkx 2l43c2+kicfx6vT4V5TZwifjT5lvO+LU+JwrWStHDuV03m1yuvgOIc03ebDerR4uG309m3CI9aUB a0xOM1bX0Yzd/XHKRxilQyVQi/l1VEguXnViNw9g5JGT3y37Md4IVsPp8J91F4SoLBFLfCabyquo rcahFDMPcUOQbAa6cL1MHV4BR6LiE+Km3HscipKWpmw+e1LBE0kWzRi7C2g0565fKUysQEikWlBx Bomlb89W10VfPK8oRDEsR7d79j48grfHfA3bhS2D3Y6ZHrtw2+vTsjSvCZO2oFTAk7FzdWfXd2sQ bjXT2cCTlysEKA2nbJjo6fafWlHdJIqPlLF2y1ilfTmMyR16gU3l9lkGvcHg/wAjzdbjDiBJVtTB nHq5xHTWnAAoGm/GcHrsTxKSsWAtLISZgD2toTfxvfgJN8WdSFSFccePHZ58ii++ZK1EpxqdJglZ h9F8xOojWFC7sToQo+njLd/+YWnSDPrjz1U61akJxNFWzxmyTFZqmjpz/o8fulUuPs/H6fbyZN1M lWylLuxREzjj50kctEPCDspIYFjlVhNTF5MrIy2Yjf4dr/3X4KM6thcpjSQPPpw5geW2gtmeXKYM o59KOJk/O+JV2X5oBUGORF3GR2Puhhb4d+QVm2WaHilKSUEycT6z+/qnoEu7+YqcEHaOZpA06mrr XqaqVpJWd2aZyTpYHsfo4uUuEBCBiMeZ/f8AChEjQDqPPPrS1oJBseDVt47SHsbXA04Hb8YBUHzP v520+q5nZtpPtU+buBkuATtXQbbaW8fv4ZNtFuFRiOfZ7OikCnyokxz+NOuB51rMqSSthsL1NXKo p0RAdCe3bgo3Pydt+8DjifCkHyn288KLMxvu7TCeNRq7FMXxkTSZlzBLvcsww+hJkYA30uCQPz5M F7vWyyzoTiRtHAjiMNmE9JjEHoILPK3Fr1K49FNmC9F8r5ulNVi0lTTL5gemac2Yi5B000txBku8 K3rdSEnSqcOHzx6ugzQjdyNJEqSaNPlvImD5bwuGiwao2BPeMpsG7ey3bgQzDdFT6w4pZ1AySTt+ XtmOFL2ne7TpSMKE7pL0vhxHMNXmKrqFfD8vUdZX1SV0saKSyG2ze6biCbhRr8DyRdyd2mLdYcAH hB2nidsY+ZEdJouzR7wkcSeiij5zyPmypnq6qmrfn/MeR3Q+612Ytrqb97cA1zZPd+46oSnE8Adp MHaTtPThhhwN7YtJEGgNrsMxXBpJExOF0fTaW1FwL28eFrbjritCQRGMTw9vlj140cNlGiU40D+N YhWYJJVYpR0zSVbkybmOp8fYe9/ZyQMpeLhSzGChG2Nu2Dx5w20Fs2tDq1gwfwoX+iucqvO+DViV wdZVLIdfdAvY2uPbyLO0rIE5c8FpTEzjM+44/Cl271445KXNop36jZiwTImDPEyq81SR5cZK3BJs Tr4e3hfuVld1mVxKQdA6MP0POyjLP8zbZYKAPEoc40eX0m9fsnZ6yXg+Xa2qSLGoStEadQvvIDZW BPawOo5mYiyDjQCsCRULtZipDhEUZHrj6f1zrgbYthkrQ4zh0ZmiqD/u0YW+w/DgJ3l3IbvE+IeJ Pt6aG2XbwpQADsqu/Eso1GH0z0s8bR1KBopW1uSDr3/ZyLV5ctnwaCk7JB6DhMkT5Y/gLkvJIkHb QW4nlWrijpXaKS9SypQhCjKwP2ydrXBFhoRrf4cX/knmLILKCP6I6TGJ6Ng4j0kUgHjdKejb6UL2 W8NeCjgw+RiZIB/kt2tt276uY975C4RclTgMcJM4cRhsjoo6s20bAfxpay4OPlrzAtcEkPbTQnx4 DWMzdbVqTInnn24UYhsEQo0ivno+3km+7b2a+zvfv/ZwUaHI/uYn7/ft8ow9/XSOUdP7+fWv/9Cj 2umhjjBWQowH2gQNAfgRzmY0zqEge8RhxiKkAuBOJwpPjFTVzxhWtDGCPe7fa+n9nDd3LQhv7uGz n9OmtW9xJ2U7VE3+jlhcDtZj3sPp4StsgOx18OfnR0FkgYUlsazLjnS/AKWuoJzFPmiqf5yJAoZ7 KFUAk32gcyYyKxcZsGkAka8donh7RwoM5q6C6YExRUc+YfgWP5rnmrKhaqec/NVFKw3Dcybj+8GA /XXgqQXbNpRkwMR57Rj7j07RNFC7xC1BMwSMMY4xs4x+NDb0hynQZQWKvqGFLh72neJdCQB2JPIS 7Rs+GYO9ygSoYTsG3gMAMZ9tDTK0IaQVjifjRhKTqHS4jVtRUY+WgQnyyO229vA/t5EN/ustlsLV jM89Pto4ZvAsiRQZYnnFaTOdZW1dS5jox5cMRN9fadeDO03d77LkpQIKyZ8hs9/l8Ksq6Ac8uuhB yRmvH8w4m1XFVeZhpIganmAAI+si3Ann2Q2rCQyB4ycDMY7Mf34UYWryjKtg41Lzt1MwjKtX8lsP zRZR8sCSVB18OXybcK7fAK+HDy8p40ivM6bTgDjUSkypRZ3wyTF0Q0xqrmKQr7xPtNzfjD2eLy24 LQMgYc7KUNWguG9R20gcDy5i2AZ+wqgl8x6T5qOP5lLkEE3Fyx+HBxZX1rftAyEk9YHHZRebdxtw ACR00YvGUV6ipkWXzPLZrEgk2HxPADnro/Mrx1YkefAH9cfZRbfo1PRFJqSpAZdnud1BAvcn7uJr VlKiCVERjPR5UVPPBAIpOYrWU9Bh9TVSttMPa40uTYacX5fbKeXAx+MdO3ypgqCUaqbOnubqKqxL EkljLSyusabEIFibC4PFe9u7zrSEnVgOvGlmWXSVEyKHeMxRushO0hjfYNDf6eRypiQR+6PSjduE qnhUjEpIFharY/oowXIbTQDxHw4JtzL9Db5ScMOmJwjHb0zGz5mw4dFJLFYaHMnk0fzHydVEAzlC tmuLgMTobjx5u4YcsXFEpkT0/Dhs6J+VLEuJXiaiDCYcuiOWrkCREf5VdQQAddOFxvF3hIQJPRT5 KUHGkNmTMNBHURyJLtpwB79tNSQdT/RwSZLk61CDE+fPPVSG7dTqwqHHn/ClBEs4YxbbA+Jv9J+v i57c98KhOwzXkXyYxGNIvPma8HmpKWSksJidzhbEjwt3B14JdzciuA4sKWQkdfyHxn1FbfuUhOGO NBmi/wA521MIKmMq7FdAtt24aanw4NE9za+FSjG3b8Px6cDWlvKWZwirPvSLmKHCcv4PhEjlVr2n o2mdQPeLbh2PD9pIDCEpwGO3bz8MKa1pQueFGl6sYhhWW8KihMjSy4lCZYqlbHyrm28gj4acUJaW 1E7OONXuX0q4UWDAMUqK6QTVkzzAgxxKQBuW3unThRm8LbVMj3zz6VoJpKZgpUwfEZ2ZSkEo8yNi P8fhprzGm6y8s3Ckg+XSJGAHT0EkDowp1agRTPV0KVFM9RQyMdAd42gXsb9uPN2aGYOIMjo4Y4RO PAbeM9NODhMRSAalqEnZDcOvvqSNoDAdtT4ckrKbC1uV62/vG1IMRA2dGHl6dHrkgbKGrLtK89HF WVEYRWQPJUMfdFhYklvbwDbwbuvLvCgCAoSTMjr29cxhPsmm7RSVCZoBep2N4jjjTYNgUhWlS8U1 SLguQ1j+fHt2Gbezc7x0lRx6v3jz9lKSwteAovtbkaWiovnKtvNqWLEgD3SSPhbx5IjO85de8JwI 6v0j0jzp922DbVBfNC8eIRgDau4743U9lUEDwFr/AE/VwaLbQUauJ4bcdpPEdO08KILhSVCFCeuf 0o1uDGkrcvYVNhxMUpjC1ZQX3N7DryEsyC27hWuZnDHmKUW1u3pBSKkU9Kyu8k6k2G5VA7H268LV vIIgbPOlbduSZVU0TGijknuf0Ks6BgbA6G2hHGC2HCExtp8vJE9VAL0pz9JmPHcy4dU+41DUzFZZ X1CCQrYfA2J5Lm/G6CLSyZebSfEB8OjE+/h7Qxl98HHlI4g+zkUNGEq+MV80OGFo4LhKipt9q1yL Em9uAtN0mxtdS1So/wAM4dUifb1dNCFm1/MOwBgONDLl7KtHEkf6K73LmWW576k3a9hwCZlnD9yu Arw7QJgcOfOhlY2jLCThspZYzWYHgWGNT0dQlRiM/ZYipIAFyfdI5IeSj8had6tWp1XSfwI9MZPk KLMwu+/OlOykxhueJqZGjmjZtg1lUH2dzf8AjwYZLvK08jS54euRjx88BE0G3HFAwMTRs8jZgwrB fTrnDPlTVumIYziceUcNjckRyRlVLWCobkEnUsNB48mi0sWk5K5dFeCjpGMDo+NESr7XeobSAYEm i7Q5swwYg3myK8c41fdYAm1vtezkZqfbKlY+0x5wePXt9tCQqGA41ixWgy3mSMRiSMOwsGNj9/G1 5O1cp1R1Azj6VVp3QrA0XDqh0IxNHjnwNTVwNvMsMfbaR2Fz/AcfYy5y2UFAahJ2YH4/AcMZpbdr Q811+dB3kc03TaHGPnU+XpY1MYDqUJNz2H3fRx+5yROc26itRgbJJw9PLhOHlNBFd9+Rc6AaKV1G znV5/wA5CipI5ZoBIIIkUXUHvuUhtSPq+u3Btuhu1b5Xl8qgTjJ24YT0ieAnz6aIMyzRVy4IEz17 Ph86Mf0YwHFsiynFPOaKsjdKmLfdT3DkHXxI19vALvVvuC8hbCyNJHHAxGGBjokT69J5ZZFqQStO 0efvq3bp56u8Zx7LC4NX4PHUV8KmnnqrgBlA0Pc+HJDtN93HbYLCZPnNIUbvqE4wJpE5zZ80bayW nSHYrgRwqEU7j7b9/p4ErzMvzbwUoQeqhPl1mq3bwM0D+D5YjlxB6mVSxhO3y27+zTjB0uKGkmB1 8/vx81oACZMUH+bHrMv5tpq6klYUhXds0sQG1B76cjbfa0t1OKaUDqIkY+ePl6fKnGnYWFDZQtUe OUuN4dE9JICWFnj1DKe3gST25jtmGWuW7mlRkA4bJ/Hp6qEaHkrSDQZfyiq+Y2ec23+bbLe9/kfl vM29+1+DX+d/s51H+5dJ/pxp2/bxrXcHV6z7q//RpHwnAauvmSSYAUZus0TCxkQkafZ008fA685v 2m8H5ZQwBGIOG0T5HHoPDh1j5uxU8vxExWPE8n/JySNh1ysfvyRyEE7VudCAL/G3DBm6DoIR5kYE 4dOyfQedGYy0DBINJWpkjllo6CGYLJLIGlKtby40N2JFtNOLN0smdeux0THynn5U6pYQjHbQGdWM xNi2MxOg83C8CPlUYO1h5wBDMN3tB8B4d+ZG3ZJCQiNOIno2GIgDgOMeooHvvyFEbZjbHlsoG8uY O+ac0YZJYODKKjcNx/RkkgNvHjpa1uOZlfG0y5awAMOPE87JERBNIrFCl3P3E/DbwPSAceNXCdO/ THTZvyDTzV7tSYjVr5lMFOiRi+0bQNSeY75TaKuHS5J1KOEeeEYcakfQlKcdnnQJ9UPThn7pFsxH EMMljwyqslDXTKF3hm93Qj48H28G7N9aWwduUQgjDp6tordpfW7h0tmTRXanB6jEMamOJbadUkvL PNawI08bAm3s4gypRQ0kJIiMMD+ETjjiK246GzJOPHGhEjzmcqUZo8q0gqEpkDVFcQGG+xJIJtfi K6sLY3KHHoC0xAiQTt29c4Hh0dKT+ZPLBQ2MKDmmhxTOmaaXHqxVmlUiRzN7ouVK2A7Gw4cbxZwm 0YLYUAFDh1bAY2jZs9mMVXKMrdUSpe3oo8GVYIaLL0WxQUhXc3l6AE8xMztwruzjQ8YZ0NGk7W1s FFMtdOQjBt8TkKxB8O3D/L2nSsJScRzz10nKUpTNc8aqWgmFLJpPURioBHaz6g9h34IM8ypTL0kz In2jCMOP4igpmSNAmcTSXldlkh8x1R7aDSx0t4DvxKy4VA7POOjpgcffQfU0Sok41ExTDhjFJVU8 hBEwZWBsdR9nuPhx6zvVW73efcR7Pf8ACvODvBWHp1kCopDWHE6cwNDMslMSLF0UbxqB+3ivfLeQ LdSEkER7Orn8aW5VYqgzQ7SU4AVRpuvde9j9B5Hi3lpQnhz6xw9vnJppAphxSOZ0ajVvddWNvC4W /vX+jgl3QaS9eA4TBPV6zGHGRJpdZkHAkiiuYhjWM75RSSbptzEFCNLH4cltFm2tYNwNR2nYATHl E9fVFOuoVjoNC1kTFZc0pTZXx+YirqTtphMLENa9gTbgOzLIy3dksQkK2cOsde0R+lUQ+e7hZr2c cnyU1NJh1PER5LMpVQL3UnhTlOZFFxL50kdVKnbvUISJopebqOtwypkHlvGlgjwBdQfbqLkHW49n Jwy+4RcJAkYcerpmPftpA0yeFJKpXEaw0qFtiuVeKEhexAANgCb3J4JWO5baMkY49PTh6GMMDj50 4q4SUkjb58/Ohyy1lyVcIp7AJK0YZmUL3I10AA15FuZZuEXJjniNox9+FXShS0EY0eT05UkQwunp qmoNPLR1YhQnRwJGF2/Pkh5HcOXCEFYxBiNmGEdHDhSV/wAKT1caHL1H4vhtHj9Dk6nm89aOip6h 53YuxaYkhb69lF7cUbxuhN0lgCBgecD69Axnp1lQUpvWemglwmDE6NsPqqhh8sjLZQdfLOmvj8eF Gba0tASCeMYeZ6vlxo2YSFE47aWGMYVBjdBNFKnmNSt+jBtYI2h79xyKN4srWEBSBq9mAw28T8Ip OlQGyg+jDYVOtCYlMAdi0hH2t3h2PYjl8ut279sIUQFiceJ6AMDs/djSh1uMa5YngBcpIBdZVMtg ALWF7HS3G8gs37W+AcV4OGB4dZHV19NNuqC5gY0msdx7EjHFgdPJ5NBGAZI4woN9bi+vDntDzlSS G0gQocNv7uZr2W2oBJNJCSeCoqZGSmjplmNmip77AALabi517nXkY31yt10qCUpmMEjDZw2nrO3G jZDgRgTspnxKCOqiZJYwYA2jFQdx9o5bL7gtrBBgjy+f4/CnV3CiP1oCs3ZMrqh3nhkRINpbyyo8 QfgeSrk+9KUCOviB5jCPXr6eNFj1mpRCuill0tWSnw6rSok3GFwYhoRtGngDwO78KKnkOACFdA6M OIn0q+WIiQdtCLVLFsLklxtJW9r24BWVGaWOkmcIpJ47V+XCsCv5W8GOTwY3sDfTtwVZZ4pUIjj0 +WH4dWMYk9wYPVQH5IyIg6jVtLROIIMVPz0rhQLkfaA2jXd+vfkqZxvO45laNUFScIInpjYJJ93z RMWYNxBJAPPuo7+CZeo8KjpqSkRUUbV7A3H1cx6l69ePikk9Xz/cKHjSUNJ6BWyh+El+G9076+ZS zF1U6x4T8/g0EwwvLmD1Assh2HfKewI105mf2UdjNuLBN3dJ1OLJjZgB+JqHN6t8nXLlTDSoCRj1 zVRv4ofpKwH0v+rnMmSsg1bDK9bTw4/hWHyNcUyT6GMfAfTwAdtGVsZVfoaR9q0zGMCMMBw4REes 0ablZou4aJWZIMURKreCkphSU1mdv0dS5+Op1te3IEs9a1nxDTjh59BjZPtoZXluBjxo3PWbAJMn dC+ivT+XyVhrklz1Wx0yMHDVKAjzCWIuTIe3iL8yK7Wn3cr3etbQKSCfESPKcdu0kczQP3YSHb5x YnDDn2USTEYKWjeSVZQp1CgWv8O/08gDKsyvVDBQB5A9OHXUjqtknCKQdfniiwfzpFxJEqgNqopB PbvySckVdpBMYxgRs9kevXwosvEtBO2guxPrRm2fE4IosadaPsqyE22rYa7QfuPJIQh3udSldPrs 4QPOInGY2UGXzElJ2UAvVHqbiGJ1tPQ/MCa8bNKY2ViL2/w7j48Fe6uRFy27x0jUCfefL5+hoM5r dqU5AEx7/ft6opTdDumTU8pzPiaRzoQlRRCCzAB1Eo1t9oXsw8DpwFdqO/CmUCzbclWE7Nvn5YEC OuaXbv5epa1OKmOPRz0TRpoWpnCeVITId3nRMPsMrEWuCb3A105CD1stDYVJ1Yk4bMcMZMz5AcIJ oZquDqw+3zoTOmNSkGOnDmKxipF0bupI+i37OSDuXmJWlTRjj6AHZs8qYuXdCYmjfLQ2oQ6jshBG nBQ4xoVMdHPJqhdKh1Uxw4AGgfaNrN9oA3A/LjyQU7POrqWSKBbqZhC/M08RG1khO19Ln3rX5C/a DfKTfJJgEJGHHEnkUptEAjbhQY5Hn/l+N1FHLVbUX9JGPA2Hbt4jgYz1lD9pqAGpMbOOHX0Rzsox svC6RQu7I9+6w/y/n/vfZ8vbfgB/KOaYjhHrMx58Y9/ChDPX18OflX//0qh1c0sS3s+zRlTtcnTQ fRzlq4joV0SdvHAkceM+fGakNlxTck+ys9NI1XIHjiNyGV1G03vfW2oGnH8n7pl9KQDPx27ZwHv8 6X2l2pzxcj50VlI1wybP9VWKyPCJqLCrgoGlb3r6+AB8Pq5lFu1lTTlqFEkK0GBAG3yMYYE4RjRR mt2oLIjjzyaKl1BxKXD4KLL4ZZGmAra8MfdDynaBY3t20t+XBrk9ihLhWonAnaYx27I4xjhhtwoM 5k3raAB24ezhIHx4TRr/AEP9HsX6q5zoqSOjeoheoWKpm2gqtNE+4kbLaN2HjwPb6Wy725RasgnY VDGPLbx6MeuYo1ylHdgrVs28zjW4b6c/SbkrK+Fw5+6tYlDlvKmAR/NRwYsyxJ5cK3uwY6k20Xk9 dl/Y3Y5Y3+evxCk7EnZ60Dd699nlJLTGJPRVS/4n3ri6NdWqo9LeieVTiVNgk4pkxmnS7TeRIPeV YwdNPo4Vdu+dMZzbJaCPAniB6zHAdZ/Wm9xE3TCtZOJqhXMmKY3PjSUWJYa9J5/6YgoLgDS5Fxf6 OYyZda2X5fU2uVCIIg4+p6B1jrFSiWX33IXs6Nnvis1dmNxQCgpaYQQxgRSSLbc3tJ4TW+Tth0rd UTjHl5bRsH76EzbehECNnPDGlHknB8Sq2hrmq/kKSM2Kki7A9hrfhZvNdWjeABUTsx/Tb0+lGFta rUCeFG7wxY8PwIorBwx3XbuQdeQFdnvbmdlHDQ0sxReuoedvJq/kKeRTtursSDta3Y9+S7uRu8lU uLJThOyeeqaKcwcUBpGPlQk1+NVGLQYVj0cYSKsp4oQTb7SRhWGl+xHFW9tohThUMEmOiTAHRPXh gBGzZRTctlSQo4AVCDvWVERdt1iUA8L272/X6eAwpbbRh0H9+z0g/uDLhK1YUtKHChLJCpJ3X8oL YXJJtoB9PCJ1wHCePQefSlibcTQuQRKss1M0QSSO0ZLCxXbYdj48DGYpKVeMweuZBnHbj7fjRtau eEVxq6eLb7pKnsQLkBrd/D2duet0snGZjpHs6PniKec2igyzpOKXA6uuNQTVODSw0yAgsCup08Pu 5L26mS2rDXfKUQTh+JwOyPwwNKu5xw20WVKoxVm804jCtu2gfZBN/EsbfE34K3GmXNRBgHo4bZjb w27fPA0s7haRhRken9Pl+vkw7EXnSkxPDGWeOW4B0J8Rbv24rt7e0XbgatCkmdo6+oR6Rs6aYvEK UPtodMdwOjxKmGMUj+Y7BZHjRdyykMPAaCwudfZwF71ZS0oG4STqwMAE6vYOAx6MDxNFdrIVpoI8 x9OcGzPSylokWZR7kyKLrpfwA4E8rzx63OpKsJ9PYR7MZoSMtpUNJFF1l6QYngmLIkkHnUCELDVR i9wfA6a8lRrfJFxahQ6IMeXV0dZnbRXd2i0rJjbx2UOmH5BxClwdqxaMQKqfopalTcADuFF+R0w6 q5uQmCATwBk/p1xx6KMre30NmaydJZsfy9iuM1U8U1dDVt/osVNC7ASxv9ogkX09nMlN3MiLVuIk qMHifnhz6At+/hcHAUL0/TjP2bcdkzBWYPiLSVW2dqiemZQwGim7Ht7OWvdzbpy676VAmMI6OmjW 1zNhLISNg6586FWXp1nWTCfkIcuTzVKqPKhSE72Uaezufp4b3G6Vy6CnTw2e7nGkLOeNJXial4P0 /wA+wTTQ4hlutUFQHEtNLr7o9qg/X8OAnOtyb1NutJQo44YbecR76MEZhbrSfEPbSdrso4jS4g1L ilH8vZjJHJUBgxB1B14CrTcO4S3xQoHjJnGQcdhw99PfnkEQNn6UxrhVXS100UytVQyAqkqq5Av7 NOCawyltYKVjxjaSOfL3bKo8sGTsFILPeXZcEhimkYRqZD5TixJBW5009mvAV2j5aEJaJJJ2dWz3 bJPXSjLlgSOFBLHU00crOp81yb7pdCTfU2H0cjluxK0iVQeiD6Y1T8x4zhUSqxTzJPKsLi2xbGwB 1Pj205a2sf2cxgNpxk0pFySrCmXHPKqaRoJZQha5soBJFtPZxbYJ7tcgU4HSRCqDXCcbjytiCgR+ alUdruLk6HS17e328HlzlX563CgYUOHkOHGeMTtou/N90s4YUJNfmKnpcJnr3i3gjfGjWv4Nax14 BGMoWt4JB47f1oxfugGyqKBKTOE+YcapqOmozLH5qwgRlize8BbQXGo5KLe67NpbrWtWMTOPEc+t BwX6nFABMzQ65yy/JkusyjmeGMQmJQa6JVN499rgnw+PCoXdldLXapUZUJjoPnGHocKENypwNpci IoxnRSGr6kdQ8rZRpIgkeNuhNc5JAS4BGvw4t3AsLW4vk27aTrO0nokRAOzb09NIs7zNxplThHhi t+r0genHHOkHSbLNFguZjHTV1JDK9HAPcUtHftoPHnRfJ7BrLmUsLOrSOYNY0Zkm4u3C6nCT01qs /jIU2MQeqjMOOYlUS4vFTU8WXpMwRpIKbzkPmGJXPullvrbmFn1J5e8/f94AdAEDoxjDk1L/AGbp CbbST4p9aqgyZlv+s+b8sYItN862N19JQKiaN+mnVSe/gL3FteQVuAyxc5kywtEkrAidkGTt4DGR x68DUl310W7dZ6AaMl6tscmzD1hxHCIadsPoMoUdJlimpZb3TyI97fa1sd+l+C/6j95EPZ0Go/uS QB5nkGi/cTLy1aScSsk1Xt1bzBheVsOmpRL/AL8ZkIjYDsTYC/a1/DgX7N8gXmDurEISJOGH7uG3 2yQDjNb5bKdAiTRKZZaurnZqiodfMQ+WACBrcMRYk2Pgfb+c/dyy0BsjbwA6sZnjsGNA1sOGCMSf Xo5NRsf8nBsHlqKiVU3MtPTjaC24LuIW1zYewdzxXl2X98NSidMkdXSTw2dcezZS+zFSG/ST8McP 1oOMg5Zqc64/G9T+mp3kZpJYlDqRuBWzSeHtBF/4gXbw5jZ5faSVEFMCAYMgHbwxn942hRu2VcOb J2eXTx2+o8uFWS4Bgy4fg0NBTRCKONBG1tAbC2tuYX5jmIfuS44ozJ28/hx6qkuyti23pTSQqqk4 Jijx1S/oZG3xMSdlu/e/t04IxbC7ZAbmfLZhIEk/Mz7i28VMqxpX4TjMK4hS1lHMsc8dpFeLw+As RwkZYetyFyRB24/GOfKvOuhXh2887KOrkDM747gG2d1krIbickDdbwNrj7+TbkWaG/s0qmVRjx92 FMJVocA9aWFHXx7kim91mO1SbDv7b8NW2irAiDTq3NooHeoaxvjCqTdlTS3baT/byBO1Voovkqn+ Hr/dx8+nhJtlag4g40XTF4RQ5lpTSe9K7gkINGFvbfibKGULbUknUkDYMR08Th69dKHTAB2UKnmz bPsj/efzL3/e8zgc/kTE/cfv6tkee2jX8yfdX//Tp4BEqgtIWBN7Dvb46jnLy4aKUT1x0Y+3Azxj zoZJWFLOo0qKQRYdSzYhW7UpaQNUTO32NsfvEHba/s4YZMwVXKdYCiD6QIOMbR8RxjGji3ENyMBR Z+pmIQyvFNK2ykhjmxfExO5JZit1B3Hw0AA7DTmXyi64kKWAAUkxGyNgjYIkRjJ66Dl24icPnVdd TiAzNmjE6yqO9ZtELOG2jsqqHb2HTwJ8LcFaQGmkJQU7T67Mero4dcDaHO7Sp3UpQ6hjgccYiDsm DWx76DfUF6YvRn6dcIzzj9MmfOtOaDIxwn3TBhsEbWiVu+5z3Y+3kgbn39plye+7tK3VCZI2enV7 9tE+duvOLDaFfsx7+ikF1F9ZHqe9eueabI+WMQky3lPEpvllijZoKGmpma25zGRusPDm154vOL8o cdHTtwHkPh7avb5D3DWtQgCth300fhnemLpH6c8br6l6XOPUrEaAVmO53xMxyOJSoLiPdcoo1AA4 N73c+zXlawTI0ET6caCyN5XxfJSlOAPPlWrR6zOnWHZSz9ilVhDrUYdT1U9DDUoLIFZiwAt9HObW QZVc5fePW+qUaiUnznDHaeiso7fMW3mUqOBgUQJJGqpQ9yirIqhVK62Yg394jS+uvs4PXn+7QThB EDDjt/cdvxpS2ygKIJGzr6PKl/S5gqRU0NGrhadHSPbGdqqCfr/I8I7nLkhtThAUT047Znjxnh7J p9t6THD8OeNGLzHnOhy9hFDB5m6Spjv3ttFrg6chrIt23by4WdgT09H7v30qXeoSkE7aKPidTJiO J1U+5iszFlMbGwFy3iTqB4cnWySGm0ggSBsx48Nsx7seNFSwDCp29NGr6eT4RjPT2qpqh/KqMuNI 1HT394o+o3HTsdOJN4mmnbZYjSpIJ+J6vI4enCnmkhQIVjSrwfDv8nNtA2nXxt7e3IDzG8IlGniZ 6fLyoPMWw7wqFL/C6MeZExTbdrXAPie/5cDKrkkx0+U+lGhZBk0uq2LZWl4veZrMyj22+niC8f7w bernE+p6fWnGmUgCsZhZ45iv+U1YaDwFj3HDXJbR550IZE8NgOHGcZ6+Ps2+WkUC+bZKUVFLSSX8 4Rl5FbRbk6Aa99OStnjS0pZbgAhOI9scImjnKeM0i5MNoJ6WQNCFZ7tdQTc/TcX7cKEZk+gzPp+/ 3mjstpV513h+GzYeHlp5GQbSBc9hYkD2cMbbM3JHhEbT74nhE4009apCCJ20YnpBjU+JUP8ALp5h NHSRzTVEjk2SOJWY9z8PbxYxcuG4xAKInYcAAemdv7hjQVvLUIxBxobaHpriFM0WYBG0eB1mx0CI WkbeOwX9vbhjl+5LqXVOhIDatgjHH3UgezRKYE4ih+yv0QTNGHOpoRRUUwJR6pQZiPtXFxYckzJe zwOo0aQEdEbKSP5/p8SjjQh0fp96cYVQJTY9XGurSAsdJVybwQdQNi6flwf7udmNhYq1JTKj6/Em g9fb0vuDSNlCh066EZLy8ZaqlolQLIy/oo0EatbsAq20A5KFplgQZAg0Gbm8JEUZOnyxhkvlSNTv VyRBI181VRWVdFC7haw4am2BMiin82sGJpcUdHRUsEVQ+BojQuq38pXk97QWsotywSoExXmnZxpc phtFiY8o0SAFe8qBXvfS1weGDqS4kBQwrX5gpJg1BqenOWMUmhOM5Yp69ISJQtRBEwIOhXtfw1vx 8Ww1ypIPnVV369JAMeU0nj0P6OYtXVwrumlJINY4owrQxqSND7jfDiV7I7VwyW0+ymv5tcJAhZ4U jcx+kDojm/DaekrstQYcI5SVWnlLe21y1+Fuc7p5ZeFKVtJAHRRva7wPIUSVE0HuK/hv9FcTpUjw VYsEqKndC06KJXZtDoxva/ETvY/kdyNKUJRxwG3oxp5jep1BxxovOfvwx4KWjq48rYnBNVSKYYZB Gm5CBfQ2Gp9t+RhvJ2GMrQUskSeocDQnst7W5lVVA9XegHUfptj2IYVieWKg09E7RxYtLHsp5CO5 3Gw0+nkC3/Z7f2r/AHeiQCT76GjeaMOJ1BVFWraEU00U1TKK6sjcTJQ0wZ9vvezW97XHDK2yt8Nd yAQk7cNuIwG3b6nDHhVF93qnjFPOJUWO4jHFhy0RijkCQgSjadxW7e6WvbvwMqyg2Cy6rD8MR5Yw ej0pQ06HhpofejXSTCaLFVra+FJDTxtXSmx2qEUHTX28Au9O9Lt48ETDaZPoB5dPp7qOrOwbabKz 91KjNmHQ5ooKykdA6uX8vwHiRb2cjzK82ctbvvuM49fT7aVXAS43pOykz6fepdF0r6lZTOY5Pk5M Br4ZI55Dt3UwcBhr3tftydt39f8AMmL5iNCj4gNoM4fLb0UFM0KfyzjKtoGFb9/SH1pZUq+lOQ8t ZTr4cbzzmqCnwnLlJGw8tDPGAJpTfQRg3I+HOkVpmFvfhpTagVqAkcRG01jcy47bhYjw/iao+/Gg zplyhwDLXQ6kw5KzNeHSjMOK4xTxhvNndt00pde+43vzGz6i9+WQU2iUSRtMSYGJPptNSF2bZe4p xThOGNa/OU82VOR8y5cx2nZkqcFq4q/fEdrgo+uw6gHb2JHfw5iRkmZJs79i9RtSZ6zEgxjiY2Ew OkVN1xaB1otkYERQtepjN2C/zj/OBhEyzUmasOhxg07SmSoWZYxC/nFiPfNgfZ93D7tdyH87nDNw 2RouEg9ciBJ6yIx/CkWR3AatihWBbJHV6VURmvFcSzXjcmJVbny2csiBr6BtL6gez28lPd23ay60 DIggidnHp6/T2bKLLj/KCVGJx6efhTGkXycfnT+6IQAzNYm/xK6+PHvzS3T4Tj5+yfnPyNaShKQe INAHnDNFVjtcMEpkkEMEhpo181/0paQEFVUgAAKLgkkkHt4TFkNili1QvDUAZ6OvrHs+IoA5vfpf dUnAjj8Oj3yBsnGaO70SyTBlzL9JNOpNTUIGPm/aBYX7gnx8e/MZO0veg3b/AHTf2Jnh6xhww8wK GOQ2iG0a1RJ6KMxh9FUSFIqaBn3e7HHGCSW+rkNFDqlkASegcnnChcl1MRSKz/gEckUtPXI1JXRA kxTAI6MParag68EO7l8/buxEDjPO0deymrppp1B1HhRfsoYvV4RmEQVz3Ri0agbVAO7wGgtp4Dku b02zN3bamcFDHgIPQIA2+z3UCLaG3YUcPWjX5PzTX0mI0a4fUxUyVjpSM9XKsMCNK+3e7sQqqL3Y nQDgV3Lzh3L7kMGCFmCDgMYAMnZ+A6aO79sOJCp2ClycyYjU1dUDiiTNRyyUxnopFkhbY+zcjqSG U2urDQi3A/vLvfmTV+sIUAEEjw4jDDbGI6KOMvy9l1oTjPTXCrxJZY56uWp86QD/AHRgSLfAngDz C8u8xudTqpPu5PMUe21s22ghNGT9D3oi6h+uXqNmHD8kqKbDsmU5qsVxKYFkWVkZ40sLatbk/dm3 ZlcX1k44NifbMefX54bdtAzO95mLV5LRPiPw40JP+xb1g+c/ln9XW+b/AK+f7OXkbTf+sHyP8329 vs+R79/ZwKf2MzXXp49//R46dXw4e+aMv56xE/3vTw2V/9SruHAI60ErR7CSGkFOANFPiO+pPOaK bR11cIQIPAAYjrBggGRGGFSAmwAPXSO6nZiy/l/CKvL1TVg4nJBJVywR2fyY47Mu/wCJNhbkw7ob nNIJ1JGGOA+BiJjp8qq/ehCY559Krn6352rYcm0CicviONqFqtpC+XHrtU6aXA+scm7JcuTcuIBx CRiMNgJAw8p65wMUGbu57sKhImOeOHnRdcipLPJHLKgmDsjSGzElACSQXBsLDtf6eGW8Su6SdKQA PcB0xMT7sOApDauFbpBHh8yYOzjAiI9u2cKOv0h6XVObI4MZxuaVsIMzCiw5tE2qxHYjxI8OQB2j dp7lmn8s0BqAmdkEjHj+nwqSsi3c72HFgDHhRv5a2vyBDTR5IlOG1QO0rTblJIHiVtfkP7lb33jd 6u4Ws+Lbsx4j1oZ3uUsusaAnCrPPS91z64Z6yZU5IqcdcCJC2LM8j6RXFlPxt35mT2f7xZjvAFNN rIYTt6+eioO3nyS2sV6wJVRFPV7RT42MwYXTxk1OFyhza4aR4/tHw769uEO+VrbpWQEgBBHR6nHD jPn5UuyG4cIB6aqktJE0kCK6OrBGV12kbQRpde97duBBbWvxhIjAzs+fPsof2twQYjnnppR0cZap hZ9FVr2Ab7I13dv6eFVypJBSRBgzhh1nDq52UaNBYTq4889PClX1GqKmufAqp6l5w9JEtySbrFZA LtbQAAd/Zwr3TUFKdLh1EGCYkxsE7egDiOFI7jWFYAQfnSXpY4hHA7RJE0dxLMQ+6UFiwvv090G2 nh8eHV26HCEpERPA/Az5cCBGBgVdBWGx0c/OhY6b5nw3Bcw0dHiUixYVihWjrN1yNpYbSTY+PidO I2bZKl6tPhAg9PnEH24DHqpr84EAAnGaOXimBw4fiiU9FGDQOqywSJ9kqyg39nAbvzuwFDvEJ2H9 5MeXl5bao48n+EbaeaCOEvBHIQsaELuF7H6vq5Ay7NYUfDt6QSR07PgRspe08nTGznbSiqVjcuUU HabAkDxGmvflLbKXLh3S2PF0EcPYY9cPfVlOpSnCo583BqKpxCtjDOYmio4H7vJJ9kaDw7nmQmRb tt5cz3pA1QNgE48Aejq6caREFKsTQS9Q5cIpKfLs9Six1O14XkYamw33Nh4a25S8dN2EOLEGDgRO GEYiRjtiYE8aNMsuClccPxoMMSxWgAWpUqFlFyFGwHQezxNtdOILuzZedBSgYEYRHDq6Yk/OjVLp bTNSqDMOC4hSTR7o0qRGyRo5Gj2KjuPHThrbWIcVKwBhxG2fx6Z9QabuL+EQDjQ8emjJlYaCpxHE GEiVrmmpoHc2l94XNr+8txaw78kDKt1A4kOqCQsxA6o88ceYoE5jf6ISDxqyjK6pNhyrjqsZKARy sG0jjLNpdFFtOwHJYyTIAlACsSKBGYXcrwofcvSJJAUaOenwqYaygEOVvtuCBpf4cHDdkG0xGFFi 1K4baFbKWRsBqZfmsIwxJI42U1dZWL5krKBut7+76zwztmSMEwBSVbkAzSznwbMmLTQw4aIcLphL 5cCjaihLkFrKvjxSm3U4QSYnnhSRxXTS/wAHyrW0EtPJidfHiPy6EeRTs5a1rC5Pa5HDBFukYAyf KkigTwihAwsVqQ2io4TTykFlkezLr/rAnlihWzCvIAB66UK4TM6o1mMIs4EciltNfAc8WFACtSgn rrJTT4ZBOxq8Ir0a+0yAxOpIN/A+PGCt1O1NbU2CcDWMYjl6KKeSGhqXkUN7hjBuLE67Sfq42biP 4ffWizJoOMQxgzVLQ0lP5FPIAUtZGG0kktpfjTb6lnAYU93JFM9JHI9XHI1XU2ju4Wmk/RjxBO3X vxVaJGzjTa0xjSkTF6+NahIJlqTTBW2yyAmTXt4kaHXio6gaoXACKReOnCMdgqoMwZKpa2kmVo2F RGkyncNSA9+NXDGpBCkiDTinliADGNF4zH6XeiOI0VZV4dk7D8OmrFjkQpTpGUN9SSg+PCx7Kbfu VJ0iT1Uqts0eRJKjHnVefVL0sS5alxLFMuYVFULVySt54gUJEli11bW5+PMZ+03cy47pRaQDPHhz z1VJW7OfNbFmi8YDg1Tl7CM1VswJcw/IU8jggEsQCB9/t5jXdbuLsrN5RbhRw4mAdpifd5TQ/TeB 1SQDhSLwamNkTtJckg31B05DuZOcScaNVMweqi3+pPIk1Zg82Z8Lb5evwxfPM6lksAfHb3HJt7CN 5u5vQw4mW1Eeh4fu66I96ctDtvrTtTyaNF6CfWPnPprLl3MuIVMmMUtHGMNglklkdqYWsCpNxp8O ZGvdozu72ZqVgkQY4/DjHr0io6ud2k3dqCkjbR0vVf1xwnrhhuGZimcT5gpXLtVl97vGwuRfX4ch Xtp3vts3U04iC5PSOj91G26dgq0BTVa2KVUdbVz+bSD5moAiglUkLHZr7totcntrpyN8uv2UMKUp vUvAA8EjpicSdkEwBwOyhVcXakEY4UiMxRVM0Bop3aVXXyR5pJAUDt73h8OHdnmAfCVFUqAjyA6O gUutLlpwkEbaLFX0MFPiFRBJGUKSe6hDeFybf2cl2xeWppJhOPqY2EdVFzrZCiAMOmgl6h44cNhO HQKTUygVClL6FdLhVv8AVb6+D3dfKQtyVgAccARzh+BFB7NrsIbJ+OHpPPVQPdP8o4tiuZvmaWJN kUnv6sF23I0JUXGncng93mzS3trUh04xhhiInbtgbI9nDAHNMuqxSZBJkjGccSZ9Onjs43e+i7Iu TM89bek+Tuosq0+UcRxCClxtmJRHjNjtLE9iRY8xcyBizu8zQl9ICFKMxjhB89k0d5xfPN2ii19w Fb3uJ+k30QdFeks/UWPJeDPhWU6A4t8ykNNuZUTd7t1vfmTr/ZdkFowbnSVJSJ27eiggnem5WgJQ RJ9taEvqazpgfUfrp1Uznl6lSkwPFcYrRgNNEAoFFHIYojp7VF9OYx72P679ehAjbEbIGzbt4bPI 1JuUukWY1bYopeK4DFVSiojQJUJus6A+6PouPYOXs83Vbo0L2dGPuxjrPJohunDrxAqThEeZImiw 6npXrFqWENKsQLOXe1gAASSb6cWi3sLpxJT92AAiJx9fYD5mji1L6cYwofqDoT6hMESKOo6XY4gx CMVdKRQVJ3RN2cFVIseL873GLiklKUxjgYwHX57ePpRzZ5sAfCZmg2xfDc6ZdrpKHHMPqcMqonZJ 6KuililXW/2ZAOeG57SUAhsT0jZ5bNpwjGZ6qUpzRWqAa2n/APhM9n7AMLzf15yPikiU2PZhjw/F 8PhkCqzxwoyEL9fgOZI9kagi2ct4hUzGA9wwHl0VD2/SynMGnCMFAj1mtnn/AGWMg/1m/rN5A8// ADh/7SPkeWNv80/qj/VLb9Hl+/8ATyQP5BaTOkzq1f58RPsou/NPT92Hy/fX/9Wmvqz15pMu1suT enjrVYtJIKapxaFQwMhIXYhPYX0vzFXKN22GcEJA9kT0Hn1oaXt/K4GJosGOUuJ0WNrS4tXnFqnE nf8AnOJrrH5cS+ZJZmtcA6ckJrLVtvFs/Zp24jhwg44/uwolCysTxnnyohvU3M7Y1j+KrRztJRxt 8pTJEp2BInKjUG2pub6D6eCrd2xU0wVaE+IyZjE7YmQdn8I2yQRMU1ctIdUDJxGwA9OE4jj8qGbo p04x/G6RsdSN1wlU3NLIDZpFAUhQqKNtwbW+88jXf/fGzsXEMKACzsG2AenHEe+jXKMmduDq2hPE yD0wcYPmMOAmrK+lTU9Rl6gpaZUikpF+VmRALblPc+wnmJPaY0tN33hx1CcPxnb5YVKmTKKUBPRS 4x3DkwCd8RrD58yxlooGH2WYG3j314E8o7y5IaQD8eeTRw6/Aihc9KPWSlyvBnSV3U1FSxkC3tts Bqbjmb3Y7duZbZupCgJnYI4c8KirfK0DykmMBRV+p3VauzDmnMmIVE5dameVkEY0Ivt9mvbgVzq1 duHnFPLGkyeron9/wJpvL3A0lKUjZRJ8RrZKvHaohLpuPmbRYgt8Cp017g247bZZ3DAxCjGGGGz2 R7vdR8y6VLM7aVxppK2qiho4DB5lhGB7zLZbliSBfXXhdfvtoeKikJAjpOJGPEYzwwxo0t3laDqo Q805faTLWAPCzSSUMLQTuAGvta+nAZk10E3boUmEqP4eUYdZ9tJEXyViOjz59lBCK2KORI4m3brk Layk/roeD5rKAonTBETiB8559tJ15qpSdI+dC90j6D5w665wXCMtQ7loolxCsq5bmOOOx2kW8WI0 +jgr3fyC5u1LQyEzBk48Ds9x/CaQXd0llEKJg8KsyyjlyTCMGxrKeZE87NGXAmHSOyncQRoRcfRf gRD5cWtgx3iDzyaMMrukqE/wmkNVZHzDS4jQ08d5ZaiQCKJRqL9rkezgMuNxrdbpVpxPUPTooy/L FcqBoRanJ+M4PTyRmNJKppIvLaUHaLkXBHe/BFl26TLKtCExJ8zs52zVNTbaZJ2Cnb1GdJs6dO8B yPmDMtKcMfMMLVEGDzqyyxKw93eCLXYC4Xgn303FuLZhtKyAFjEemHyolsd4WblwoTtBoj3UHCp8 awnCaWoDU1Wkm+mqfGxQ3U6nvbkZ3iEZVbJ1NgkiJjDh0E44Y4CaMH3yk4HCg8n6fYhWUix0dWZy h2wxFve7+O7hJ/axoupSsCPxOHD29Ip61uFLxJ59tJPLHTbMlV1NwPLctPMtJVPvxWpTstOm4tZg LXI0Bt48mvdi3bvoKQJTtw4bImZnj74mi7MnlIEg4VZXkyKgytVUVdiM/wAvh2AkQHDaY6QqhaU3 0+0wsOSpbWQQoKgYfhQTuboqBHE0Z2g6lwxViTU0AamnipauiogvmVEwkJXcb6CzKR9XDpJKTNIx brXAowkOc8KrKKHFRSzYqkgtFhFMdzWXU6HTS3DNFyNoEno6Koq0VBnbQg4T1brKNJY8HweSCFRu kpPMEbMNo00sAARxwXBOIEUhVamDQgZb69UdNHUQ5jy69IsLHyTBKfMW+m5tw1+AHFzVyoCCAaRP WiiRFD/k7NuVcx70wrGDTYgiK/yuIFCxu3Y9uGdrdIUImDRfdNLSsYSKFbD8oSIWqjT+YZS3kxAg qCdfdNhwwDRSmemaYD+O2nWmw+ahMazQSwsVMJLobd7G2lteVW1jjTyyTWCpwnFRNTTxysUQs7GF iGKjw22seNu25gGap3sinCnAiDyeU5ZwQ/nQldxOmhXTjqRJim3F1AkwvDHZqjaQ5UrIiqGHu9/A 9uJzaJGylgdVHiFNK5cwlar5iOsSNapdpXy9p23ubaac2hCQNtbLh0aYp4psg0sEDSxPDWVM2/31 VVKqw+z7tyeKinw4UhW4ZkigfzZ05xtXc4JistDAyswjT9Ku46gbX8L9+JF2pJ2xT+pMYigwrsBz JDTNh+Jp/OHnKvGIf9HYbGBt2IA+HjxvuVE9NNB0JNB3migkp6Gagq6erRJFMUtDUKkkPlkagPYX vfiW6y4LbIUJ+FKre7OqdnPnRUs6dM8o4rg9dFS5fqMNnQ7hS0e5RP5elr66+3kb7w7g2tywUpbA 8thoTZdnziVSVTRLMbyXFgwk8iGejcDfDT1asW3G/um6gC3w5ivvv2QtalBKSlXDiPl0cMBUp5Zv AVgYzQFdScMXEMj5lo5UeFzTuitKhALqvgbdvo4DN190lZfcJcU2ZQR04wfPYeMbB08DW+zEOtKS DiRRN/Sxim+mxrKs8m84bM8cbFQoOxtdtgBoODj6g8nWgtXUABQA48cR7qBO793gtA2dYjnpwwo7 lMTHReSTuLXCdzfU+HMX3X9R1RiPOfPo5FCNBCEk9dNtXg0YkSoZTpYr7hBHie3L292tXhG3qpSp vvE47OfSnGmyLVZvRY6CMTVEKkkW+0Ae3BbZ5c+Uy0ASNvPE7cerqosUgsuaqKz1myXPl52r54BS yUxMcoAA3G+oN7HTkq7g52b0lkgSVR1eUzx93wMLt06Cs8KIliiwZgxYxO9wAdjOm4g7t1txIFtN dP7ckcmtzbMqOkdHr7do/CgJcXKJIOPT+PRxwoe+n1DgeBQvIkhM4G1gguDoDrtFtLW4Fd+MvuLp gFPrH6T8QD5VS1uUAmRjHP60aTpvmXD6fE6PEI8XOHy0TrUQTQIN+9ZAV8VA+88grMMidaWoqOnR xSASTOwYgdRPpjOJ9bwsaTjNWZ539cnVXMXSmo6aYhnx63BaynWlmhDlm8orbbe/aw4ErTfveC5H 5fEJ9YHtMe0jp81NvuzZoc1iJqofOGKUmAyzxpMZoy7PEf8AiXJIyzJ37puSQCNs4QcOM4YfuNUv nilZA2CseXar+aQxTtGViYGzaWNzxDnmWrZASEg8JwGPDz6/ZRS23qVNGu9PdVl7L/VzpnjGYYY6 jBcGxigxLEVlCsrRRThmBB8PHhZu3dm3zFpxxIjUMOnA9J94nooRZtbFWXqSjaRX0beij+nTrRkf LmYssYNhOKJLQ058qKOIvGCgBGnx5njlFxlOatd4ylKo6hIqHrXMnWkhBJSRwotvrE/Ci9O3qkwC rK5bgytm5Eb+XY9hcaRTI9hY7gNRp2OnEOcbjMOplnwq91G1rnbiCNRmqTfTv+Gl6m/QL6z+nfUT B6ds49LDWyYNjeI4SpSaKhmU7XlT7LBWAuRxjcrd24tMwTqT5nhHnRLvpmYetwYkpMgjb7K21f59 Sbb/ADSW+R/nG7w8nda/f26cln8kro/iii3+Yt9P8M1//9bX9z/0cxnpnj2SMjV26fqVmKOLMebL LubB4Z3DRQsW90OU95ifo5D1xu8tKggpkn7ldHx8hxo8YfQVHqoH+sGKPlD+srU8/wDpWKRJgODk lfdWMFpCuotcA635ti3Qq4UlX2ge734YRs2e2rlZiTs8uefZRLcr4PNmTHqPDaQtNNi9THSKr+XI wV5DdyF3jwJ0NuHObZuLW1cdWB4E9MYcI6Pns6aLmbPv30hKcSdhkYbcOufnsq8zIPT/AAnLORsH wGmjW0UASYRqNWKgG9joOc2d6t77m/zFx5Z2qMVkFluWoYZSgbQNtBLBizdLs2VEM/6Sgq5RU08T AWLlrflyUsuCM1sUuaApbe0HEQPgB6+yia7cNs+QditlLvOmbaeSieorZd09Wpb39pFz2At4cAeV ZY67dEiNvkOflQjZQlKJO0+6g7yT5+E4ViuJRybErGJUfBdABfwvzL3dBDqWPFEbAOAj447euo63 iV6cabosDM9T87UBQXV5HD2N7e2x4A+0G6ftFpAVBUJPi56PfW93LdDipVjHPPRQJ02C02OYtjAg ks1NK4hQBD4637+zx4kfzE2tu2VRjBOz4AcfZS5y3St1fD2884UI9BhUNBFEhb9Mq3eQW/L2acDF 7dqeUZMJOI8vx6unpNFN1mC0JKeFKmjnSooIqZwDDvZS11v3Out/bwmKCletJgiDt4jmY84ont3l qJ4ig3zP02q5cYppcDw81L4gxiENOoL7vBha/e/hwfbpbzP3EsmFKGzZiY6p8ugY0MrVlGgEcNvP 60eD0o5sxXor87RV+Gy0uLVoJgNZGY3IP+5m4BtfUG/JNyDeG7y9K0adKjPs6eFB7eW076ChUihm xDMddX5pxfNsz7KjElvWQgfaKXI78B2XZRcnM3LgkaXOHXO3n5UXW2YJbbAAOFLHKGOUvnHEKkqz Q7pEZyvuE3I1va318GybQhydo6aEFvegtkjbQw9GsbwzO/WDA8Nq6Za+gwKpgxyeEAbZ5IpAyI1h qoIBtwTbn3NsrMUtmFFOMTPtoK7w3byWcJANJn8SPrHiee8/YPlydHoosDRqwJH7q33GMWHwt9HI 97at7XF5iEgwEYQfZ0bRzjRVuxl6kJKhjRBpPPzZhuHQUlJPLilPKFQxQ3Rxst9rQD6TyP7+1uM7 tkBtPiTt6FbOOH7qHRuUkeI4ddGhyD6YMdr1pq/Ha5aDcqy1FAqruF9WYsTZVsQeCHI+wFx4JVcK wB2dXRyB86RvbwstTo20N0XR/KuXEmbAaAYhiTw/Mtjcy7UVFaxYMbaA6i/fmQuR7qM2DAQ3gBQf uM3ceOzA0COP5FWleppYXeqFfODWQxhiNwNy3a510PF6kEYAbTRnbWmognhQ15A6V49NQYepw2U1 M6phstZJciOngkMqdxpuMjfUOGaLNQA1YbKVkJBPXRlcLyJX4ZOWkrvJw+EFKOloTGLAC1zYA35t tsBXTSFxIKSYoXMqwslH5MeGrXx1AaSdK+PZMpufsg+0cX26RwEUUPJE7Y99CHBkTAMy0cVPLQeX NFKZUpx+jd9mjAbvHXtxUGdWHGi4PkHbWJelNTDSzy4RNeqWWGqiWoUrUwxLNuZDYglT4HlxaGIm Yq7r+qJoRsi5+zvkuvNHitU9bRGUwJ88C0SybrjaxGlybcWMOOIOBjzooctW1YcKMfl3q7g+OV8u D45E+E4pTKq+avvRuHJNwNNL6cWMXuswYEUkdYUgYDChQir4mT9DTQ4pFZlRU/RyEeNj8OLF6tM7 aTlBjopipc0ZYqBJR12HVOESxNo0iEx3Fxow8DxM2+IxGNPOW6wRFT6emwKsqSKKZTC9r7xZhc3P HEhJUMa0CriINZK/KceIG1LPH5MY2koN17eGvHCiRE053wBmKQOJ9PsdSYNguNz0LMA+xgXjJ+j+ FuNflzEjZVVpSrbSFrUz9h7bcSVcSp1Zgk8YMbkjUXtYW5RTKh10xoHThSRxHMPytRuxmjeCEEBJ HAK3W51N78baQUqxpsuEkgbaQGN4jTVonlopxPTWBEMAG/cSftb7iw9mnLOmeM1YahSCpcOGH08T PWJJNNd5KeqVNS7brEW9vEfdlIgGKsLoqGykjj2XcLxWeFqzL6mTe7yymJHj27SVttv9x4huctQ7 AUBRnb5gts4GCaOP6cOmPpFz7lfHMjdTstYVQ4ljFO9E1VjUf2nZSAIgqfbJNrX4Yr3ayx210FvS udo54UXXGe3ouNQXCY5661SPUX6Yn9NHrRz7l3JuH1EnTyorXmwGsW5Q08qbgpNj9kn+HMWe1fKn bnL3bb7i2Tp/xY6I6eg+mFD7d24LgQ6RBUMfwoQYKBacUstUxZQpIjBs5bwtccw+O7RBC3xpTjMn GfwHPGh4pemCnGp64fVYl+nlgaKnveNZAAdfgb8AmY5i2lelGA5jYOGz8KPLY6j1UZz0udOMwZkz o2G0eGmaAr82tVVARQqq3Ju8lh27a8mPscsn7m6/uZKFR4jsw2+3hRTvI420mZ2VXF+JX1Ay3N1K fJWTY1ZsM3UmPS0jaPVo3lsVKgjS/wDbzJDdvcK3bzJdykJ9SAJnb07IGzZ5UEbzN1lnTjhzxIw9 aKN0+9I/X3P0cWJ5b6a4zi9PEEkaSmonMbM5L3BN/wDF2B05KNy240dJSBPGeHpj04+dFjF2Fg8f lW4f+Df+EV086jejXqVmjrlkj5fqHnKqxfJ9HHjNMqz0iUwMMbBSoINyDccGFpkbTuVgRirVHwHD GffxoNG9cXcr/opj8TWuV1Q9KOM9Nes2cOjtRLPTY5k/FqrKhEQILGKUrGVBNrOCG5ie9e3RvFWi 0yUqjESOke0bfdND+1CVNhc4HHnyoUOp/wCF96pOn3So9YZ8Sgny0lOmKtSx1KmqSmOpO0XubHUc Hz+7/wCVb1uNJBjHAQOO2CT1e2ihq9U4vwqJogGKdIM7YjFDWS4hJJvUsFbW+g0O4k/TwBo37y6z 8IRIOzHqkfLDEcTjQhOUvrH3TXWH5UzphDRUVROY431Vk2hjY/f34muN4spuwXCgaiNhIx58j7a0 jLrhoQFTR+vRV6L+vHqs6mUOTOngeaKFllxzGJwTDRwu32jYHUjsNOKN2t3WM2c/ZsAEHGMeOzHq 4cMPI0zDMXrRMKVOrYK3ZvRv+Fvnb03U2DVtR6hcc86GNGrsFovJNMzgXICyobD6+ZGbp9niMud7 zVB6icfOo1zVCrpUkwedlWl4lkzPxpaSDLnUuWhlh92eXFqGnqt4Gn7vlkHknOE8D7gaJFZbcJEI eNMuYejWJ5yggos3dR8TrsMTbJUUOGR09EJXXxLwruA+F+MNIKSSVEz6fCnk5a8RC3Caef8AMxkP y/K8ir2fIf1ct87Wf7zeZ53/ABZ33a34Z/zF33R6Vr+z9r0e+v/XCf8AEaxz08dPst/NdNZqbMfU jO9U2MZ3zkNsknmuCkVNGx7KgNrDTgb32zhggptSVTtI6SfWk2SoWVkuCBWsX1yxx8bxuhw8xRyR YNEVlndr/pmJZt21DZj4Dxv8OBbKmikazqKiABiJJx/zesj3RhRpdPNk6SY29PlHy8umaVXpwwGG oxuPHKiFA9Kvl0QiZSfMHu97a2Hx+rkZ9qLqhahlBVpxJPrt5xoXbm5egXKnCI2gbeflgOirWcjR 19W0MmLSLQ4fErFmYi5A1FvjrzD/ADbd5pailBg9JIx2cNuzq8salb8yEyTSM6lZYy1mzEKIitG2 gkRkkiIuxB1uSOCPcltywWUrPhUNsgQOO0H9/uLL5aHyJ2jGkF1GwA1AwulpHWqjNoi0TD3QdNSP C3BjlGSC0uSASrVsg9OzZ5/hhS8PpLE7IpZ0WVqyowfDcFw6n81wBfZYj2an6+ZEZfboZt0DER5b eeioxzd8uunCfbUzM+Qa/AcFmmrKqKHENp8mm3aW26eB78i3tDWi5uEEyUpPT1dEfjRlkv7JJHGi 8ZZy7Hl+GqqKn9NX1zl3dSGChmJ2+99Ps5H2e5mbspSgQlOzp59g4xTqyGkHESdtPlTFuIi8rcza XuBoDa3YePEYTwAM9HIG31oMur1GAcKlYfSAQ+8Bt3aKGAAa/strysfslEgnDpAHzn49A40/awVY baW+CYpLSVdPLCPKrKJlnpX09x1NxrY24WWV07ZPpebnUkz7J24TEYHZQqtXwUFCsQavQ6RZr6Cd eugC/wBdMLoKDrNl3zqNf0aRtPTRR2jk7C7aXPOg+S7xZRnWRJcWgB8baid+3urS+Ukkls0GmQvQ p156r0GYczZOy4avAIC5wuUA3lTabi1gPDQ8C2Wdm2aPtrd0+DEp6xSfOd4rNlYBVCuIoquY+m3U vIKYvlXNWVajLmLxyypJ85GVusZKjaba8CO9ts9bWyklJCyD1c+kUMMnzRt2IIKaF78PukjpOvxp scpGdJIEIEguGcTe23sPAb2BWejOiVglR2yZM47eHlFb30USwDOFWCerT0r5Szf1NwjNlbRgoyCn iw2lA3SK0m8GS2ijxJN+Th2h9mFtfZql4iR7vXn3UF8iz3u2Y40j8M6J5DwfDY64YPEtHTSD5Omi RQJWjBN1uNRcAAnTxHt4cZRuna2CcBJ4V5WYOuqjgaUf9TJcUqRKlGtHhaslK1HRi7VTBN2wEjUH u7Hw04I9JO3hXmGRBnjQc58w7Mki0+W8uYQvl4hKKbEJXsN0SvdhGSBZRbvwqcaU4qAYG00IbdlE CuOXOl9BhS1tRjcn8ziWZZaQQAFlIUApvtcgEeH08d0pSJ2mjltpRgAbaEurSmp6Vvlm/lttslgv ugHw0BJ+PErhJ20aItUgbJp0wXF8PWT+W11KJ5EAdqkhbMhHgD7PHjbbgJiKTXNgQCQaFHDsvQxy K+HzBZIgsy0ZN2UEA9m8Dfho03j4dtBS6WMUqFCfgD+S8dZU0KlYH8qeQAghr66kG3DNsKSBIogc AFLny8DxMmQVAp6qrR4qeZWFwy9r2tprx9LiThxPXTTiThUylyi2LYO4qaWPFdi+RK4Cq6SEmziw HFAZ1J6aYDkKGMUHmZ+mdRJBRVWFTPS5hoI40cThkMyQk/aYaePEqrSB0EU6h5B24inPK2b8wYI3 l1kEjtAyxTQn/Js0g94g9uXDquiqKZ4UO2CZlwfE6RY66BYfMZwqqF3W1GoYfw4qDgJ20nUlQ9Kz HAlmcSUDqaYvq0BKtb6uUS0SQZp8KCjjT7RJX0aMoqSxTRQ9iSePNAx5Uw5pRt406xY9XNFIlXCV KHZGUXuv5a/RxsKV0bKbDA0zNNONVQekCy08lQoJJWNbHtc2vx0qAFMJbPRQPY1HgU0E6VWFuHKB 9lSlwATb9nPBdUdQRRZ800NAUkXC70kit7hpgQqkeJAGvG3gCKoDBoFMx0eaKNKuomQYhTe6Y33h ht8LIban2cYNu5t21ZJTEcKDurz9ieCiKJUkhjhjlkhWObYzHx3BhYd7DiJ5JVs20pbbJM0+YBn1 amooYayplpKlx875kLK8gAN9Cvc8sHSo6TSV+2AVIpKdQcj4Z1PrmxDE8UAr2JXDcwQMrSCwsFlD Xsw9h4FMz3dYulmdpoS5ffKZbA6OFEvzz0c6m5fq/OxKqTE8Ga60NXTosZcA9m8pbfEX5jZ2s9l9 863+yMp6Jw9cD+HVjQ5yXN2DgdtGn9Bvopz/AOqHrBguCy4dJBkfB6qKrzdir+8iU4JYpe1rta3I R7NexS5vs2bD6IbSZVMQYmR7I49RFL8+3hQwyQ2ZWdnVPGtkX1/Yf6cfQb6IupmbKTKmGUOMRYRJ lTKZeKFaipxGoh8mPZYAlgfeJ5nn/ZPLstt1hlACl4DHp89lRxcZo6dKSZNfPk6Y9Ls1+rbqRUQZ QyZPmbNFNfF656FVfcqkuWe4Nr2tyH2cizO3Ki2lSkDHaIg9MAyDgY4+yhlYv2jxAcMKOHOyt378 HDrX6ecd6V0/Q/qBgeHZc6r5LeSgmoscRI3nRHYEKZALlTpyVtyN52b5vu3kgPDDHjHmBNA/N0qs XylR/ZnEHhV9Uc+F4BQLl7pvgdNVTzE1AhotsdHA0hJ8yZ0B7+wanklC2/Z8ABsojezAaiGxqUdv R61UuPwkMr559WGaevPW6vgzZTZqvjS4bh8Zp4Y65GVdu0G5AUCxPs4C0bj2yrpdys6lSDRm3mT4 SllWwg1YNnT0f9C8Y6W5g6dx5Goxh9ZhtRhtOXQsyFomCsCxNtbHglv7Jq4YU2UgJUOj2U3aNBlW oTI66+dVm7D5ct5rzzlOoQPU5TxvE8tSqCO9FWy0wOtj2TnOrfbLTbrWlST4VEYnowGMTiMYB6PO prya7DrAM4mmOiwqixicQ1FCHkNhGsdrnwsBr93AFlVg4pYCEmD1/ofdtw20bvkJR4h8a3dPwTvT EnQT00TZzzLl+PBs1dR6xsXSrq9on+RACQqTYbRYaDnQ/sl3YVYZUgOIhw4npjhwFQhnOYB+7WsH wCAPnV03zBYoFvZrKHHa+2/s5KPd0XBwGoqSyJKyvqrahlOuv1ceKJFMlUE1kepZQNo+0SBrY3H6 +3lQzTjjkEV647+YPZ2/etb281Bp7V8eRX//0NbTrL1BqKiiy9HWYxLUPh1Q+LVShriUgFlB3Bh9 o+J+vkXIdlKUtjUqDiDs6x0x0DGNtGhtx3kkQOOBP7qJ3X1UuO1KyxySST4lOHEZ8refNcqAdvvW utxa1vbe4Ji08lpnWeAM4bB7cIMzt27Kala1aQADtGBOG2YIiY646Dxo/fTjKa5EwTDk/l5jr/LR pahiWZnYd9deYq71Z2vML90glKZMYnZOG040LrO/ctWAkJE+X4YULMmasVnjERqnRDayoALjt3t+ zgLct0giQSfj5Ynnyq/81ecwOypArEI2mTeADuLkk39p04SvNrk6k+mOHv8ATpo4YcJEzspvNa+8 PFIxKHT3+xBJOumluG9jcutKBTAI2Y7PfzhFa/mKiCOFCrlHqguD0soaiWpqADslUWJOlgdb8Fyd +ntOlwSdmGGHt52+SNFvqVQXVub8ezRmasfEZXEA3eSp+zr8LcLM1uC4wFOTrxkSY+M4baVLaUFY gRUDEYdjX3fYtYJ7LfD48DVvcyjSRHT18+cdA20UXy8efxpuKEuZGJVpgQSBcjXUWAtxeu4CgAkY 9MmR+kdVIlo7vEip+GPEtDMDJukDaj3tLn2E9+OOOaFwRjGGO3qwPoJq9qqFbONP1Mwdt1y84IcM zX/MfHgcunVSVLxn34+ezywoV24CmxAilDgWeq7pxmvL2cKdZKukw6qikxHDyzBZYCwWRSBYHQ8m jskz021yGyDpJggycZ8/djh0maQZ3Y9+0THi99bcfoe/EL6f5aythGX40ipMGr446mA1OxPLWUfZ 962o7cziyftKsXEJt3MNOysfc73duQ5rG3ypQevSDoz1fy1RZtyeYpsxVd5VWn2l5XJ7BV737acS 9qFtZ31m2AQXOEbY68aV7pIdYUQftFFB6O9N8u9M8JmzHUwR/wBZ5VU1c8KqzREqrCKL43Op4E92 cjtrBnUlPjPHr/Chdm98u48B2ULFQ1dmlmxfGqho8JgKy1BlLLvI0Ed7E/Frd+3w4L3FAwpRopYa 0nDbFM9PBR4pBJjdbSPFhEEy09BRKPenItEiRgCwv2AHh9fES3QVTG3hyaOLW3IUOml1Dgn8hw+u xXMASmrKwiDCsKo0BaEP2ijXuzsvc/s4oACEycSej4Uu0eKE0l5sly0sLVeLRmnq62Vnjw9fenKG 4Uu3sAt+ziJbIQkSNvCjppWkCNopAZhSjw9j8tERIt0ZjqkYUX0BHf48J7l0AiKFGWMuu8MKRRwp cTLSGXzZ6gfKQCQ2JLi4FvDiKZxoQwlA0xTZHhFFPTUReokknoYY6h5qcgNIrabSNCdlvHj4I1Yc OeuiZWs6iRgaFvJ+KVFbHTVAqVknRfIp6rQM3lMylGv4gHhraHDbjQMv2NOMUZDItRSYhNU0cqlq irK76eexDEDbdfEdteHFs5Jgigm/IGFJjOORGXEpYqDEHppozeOEMVkV7lhYi3s5520EmK8h4zJF JvLWZ8+ZUqJqasrhU07SBUlkAIAI22YjXTiO3cW0YmadcYQsDCKFSl6n1jRLFjWHNDUsCgnQGSJx 7R42PFP5tenEUjRZ8RsqW9ZRV22eKnScSbVmjiIVlLC9yDxR3uG2ntBCcaanxzBcLqKbz1JCe9GH P2QTYnt+XGRcIChFbdBOEUvMDzbh8vnGkn8omyR63BA1JsOLEPpOFJFMrSeqldR5uhdFLhaiJ30n G0n618OPtXAAnbSRSVE0pYsRpmXzEjVjKQ80avYge2x4pKRVEpWRhsFOUtbQMCSTICbkFtR3Hs78 81EGm/EgU3VK5fxenEbiO32XiqlN3toeeadTqk7KTuFSTETQM450ww8vL/Lpyoqg4jppAJI13jQg jUG3NOpSvZToIIxotWbelOMYTUiaCobyZCFliT3wWA0AufDiN1qMacC0qREUA+bMkQVRWOtlUVM0 bLJAsZDhCSNxBGgO3iZ1E40+0+EGONAXiVBFglaapFdIKRfk6aEC+3b728OvYkC1jxMV6Vaqspsk HrpYZOxTAczMFp8RNFV7rybdgO7aL3C273AvxhtSF4kQaukLSrGhfjb5FTR10S4gkYRY4rpIHJN7 2ftb4cs5bpUBONaS4YMcKsK9B/qDyB0DzFmKmrI2oMFxyMSYksCIvlugLBrey58ONZTY21upQgJn nhTF1fOoUFESBwqiz8eb1gdQvVxn7Bcs5LLDo5kxJIaLC6aZDLPW7trzSxggm/2VsOBvPX9bhUMU jADq44H8cKX5Q0p5zWoY8BSs/BIXL/plTNed8+rR0mMZpoWpqN8ZMfmpG48uyh9bgEnhFkG9ZQ+4 2uEoI6/mTw6MOijfOcrdbSFJ29AFHe9auWchddupvTnCvQbgL/51cGD4tmrHstkU6iOSIsUlmisC xc3F7nvwq3ks2roldi2TBJVEx6Uzl+ZNOJCLkSMAJ6aOl6G/X7jXpoSX0/etDDa/J+dFm+YwzNON 3MNZEPdusjfbA+B4bbqb390yGbsFMbD+P40VXWWKs3FFoakHHDhR6+tn4pfQvIMdEcs49HmaeYCo RMOdJLqR46i318CXaD295dkqw22A4o8dg99G+VZTc35/ZiAOmg/y1+Lh0XzFlrFq6qrEw7GqaB3i wytYRl9CNLkg8Mtx+3XLM0ZJcTpPViDTuY7u3zCojbWkh1QzNhub+u3WzNeGoVw7MOYsTzBTIlwF FTVGVu1xqxJ5jb2o5ih1bjqCTjIg7NnGcAJnZtPTiJS3Wsu7ZAIg0pvTri+VT136bUOcJFjy02NU QxuWf7Bp/ODEsGPa/fgV7N7BIzBpx8SgKBxM7MeJ5OzHELN7FrTZLCB4oNfSLyXiGScdyLl5MpyU 9flN6KCnoUw0o0awrGALbL2I/jzpTaOpcSFoMgjCsfUONrZCfQ0qGw6abDzRUeIS0NRAojhrEsxB AshZW0b48ffOBjCfdTjTMCJOoUU/PnqZr+heY8PwfrbgYwvAsUf5fC+oGGpJ/L5yDYLI2oikI1s1 h7OBW53obsnNF0ClJ2KGIPmOFNBNyFTANDblvrd0qzcaaXA87UFZ87aSmCTxhTuF7Xva/D+yzC3u E/snEr8iCa0LtBOMpPWKEb+eYTf/AJK1Je1/8vF3t/xL2cVaD0Ur7xE/dX//0dRvqNj0WIYg1CY/ IjG2DaxCnYT2B3Ai17k2+vw5EWX5fCUuCIMwANkY44cejAA7eml7167J0A4GI4H9eYG2hE6A5Los 0dT8vJVQGagwyP5qpZ2YqFjOoI1BvfTiPeB4/lAhRidojgJwn93SNlGWR22pcidIPRtPps6+BNWl Z1ylhuLUfzOCx+RVUieY42sVsBpe/wCXMWc8uWbe50tyqcTtO3ZwPt64PUOLnLQ8mYii5tOYJ2hq UBRLobHswPa3EjiULSTjMTsx4bcCfX30H12ym5BGM1kdoJFLByGsG8tvHmmWAmZEnD2dXOHXTa9R xBw54VEEvk6IwZSde4I79/HmwUqI1JAjzA552Vptakg4nH99cleRVd49yltxYL4+PLPMpUnBEgce r93V54UqYuNKJJMms+HSpDUx1LjazNsANzewv4/RzV6ye6KQII2yDA8tvv6aMbF0rSDONKh6MVX+ kbgAoBKDQnx8COBpq6Lfgjb0z8tvTTxsFOqJjZTJiezcoh+0fcazX8T/AIu/F9mg6SdsdXDh5US3 9wSQE020b7YpQWIG/wB4XIv93DcJ/hn2A/v49XXtkFzSjqw40qcNnRZQrJZyNbE+Pj8TbhBmFmoe m3rxPPwmhdl1yUAJNPeJRRtSTRU6l5Au3zrE7NL/ABtyuW3C21pWCUxjOPr8eH40cOYqwOBoYfTv TZlx+rp8ESpqGrqap8vCYY2lEkpU/X7ovr9PJxBvr1xDrSiSqJEHH34Rt2Y8aD1wllKSlYgY1e90 gyFmCHD6eozbiUtfUU90d5XJRCLgRQL+8R2v2HxPMjt1t3Hm2gt9RUqo6v1NpJCNhowuD4RgtNh0 eKYteDDqXdUSSTNdA5e1h2uSBb+HB8FIaRJGGNIGG1GaiQ1rZ2qFgo4Wocn0cpFPCifpKkoRusFt ZdLH6bcQqcLmJ2cB00ZN2gRidppfrQ0OBHCsSrYUlrGlNLl7CSbRJIzFS5UeEYHH8GyMcecaWWbe pUDAUtYKCioGbFcZMdVi8ZM0YrRujpd623G+gYjX28cW6EJ6+mn1tlfhTsNBNnDMtViUtbTZfi30 rm9Tjs2jN4e4WtYcIbi9ccwTgKGGTZIllIU8Z6BQRVmF0VCWNVVGqdl0ijGhdvtEsTrrccLnG0pA nE0MrW4JHgTApLQYZOh+c8thGHeSOMfbNgvvfRrpzTYATNPXLhWTAxqE9JHBVSrDTGmkgksGbXdG SsgNvYdxHFaYONFgIkpVxp7y4cOpq+UQSCFpnaqaBfsicEm+nbcNOOWr4BmiDN7RShB2CjPYPJDF htJmOiXa1A6PXiLXYrCzXt3Atfh+HwUhYqOnbeFRQo5vy+uZqWixbDXHzEsaStJEdJLAagjxHhx5 4A7DRa2VJVOw0XzHMMxmmeWOeINTSkqahTc99vvWGhvxG9qmaXNJmmGDNOIYLUw4dXAtQyHdDVsh dV26bdRpccYDytnCnvypUDG0cKUceN4bNO+5GiUtcVdGd20ey37OOG4BOOHlVF2pAmspr8Gq6SYt iC1MMytTLK6AWW2va/b4ct3qCMTNMrQrVgMKa6D+QFJo6PF5aWrjAETqWsxI7i/PNqCv0pwoI2in qkxjMNDOi/PRLCBtAqQCzEd2uD3PHG9SdqqTuJTM0oYOoeLqHhrI4gBZxUwqSSoHgL66ccTfL48a TqtknZNKKn6mWCwwUYeoHvKFuWbTU2vp9fHRerOFNm16TWafMdZLPE1XHZpSrAL43IsF+vjiXFBX XSZxkAwKcHxmlo5g0lU9G8S7vKjdvHUgjjzd0mYO2kymyeupj4zTYlTbVkjq3H6SOQkDUgAf28VB /UIpErUk7aDHMGFYLXyebU4esk8AIZQQpaw26MPDlDCpq5eOzbQFY7kzL1WrXh+RQ7kaCUbgwsbs GA042W0xsinEXCj5UXTOPSOgwib+cZaZvlFdrPSkjdKFDHW4+7he7apJJ2UaWz5VgZoPaLH8wVlT Dg88DtLTPvStkLeYU3btASNBbhZCgsjop5aR0U+YpnbEsFqzHI7JTuY6R8TIJj9+y29z4HxOnNOv qR4iKZdtwRsoL+pnpsy51HxGjzZgqLS4rSp5c8m9mSVY/e3e6dDr48T5xl6XmvBtNLcqfQ393Cgm o+n2LQZzwunzJiM2GYFQCOlq6lSXi8pf3VKnuRyEXMlabvdT4OkUNnb0LaOnE1sb/h7davTR6f8A K1XUPSYdS4nirFmxh2i+dkW5ALF9Tfk/ZFm+UW+XpQhYQePT61E18l1NwVlJI6OjrFD36z8H9MH4 gnSrE8p4DVwS9TsNBqsm4rhvlrXU9SF01U3KnsRwvuLTLM2HcpcHeHYeP7qX2mcFp0LUkhPurT+9 RHQD1Q+knF5n6h4DiFFhKyfL0uMSpJJTSqG90b9QCw8OYf8AaDuatTrlvcERMAwenASAfdEzBNTb kt0ytCXGht9KKXX+o2oq38ms3wgnbUvGzqStreHfvyMt3uzRWXKKm3TpGMAETI27OjZto/vMy1CC mlnljHMr1tBVVVHOnnyKzMJDZyQfjY3PFe8tso26kqR4gJ4yfPiCY8p4Umy+6ClyPWkVh2KRzZkn lpHIamvaQMb3DX8PHgXbcdtrVChhBHn1wRz50qzBYWCkVbj6I/xO+svpizJheHYnjtRmPI6ssNVg WISvIqJ29zwGh7cmTcntVeYIIchY2pg6T7JEk1EGcbrKStS2xBNbifpT9cHST1NU9HFlbGI0zDVU yYi+FO4DlSt3XaTe6nvzMXdvfW0zVGlPhcAkp/CgeVuNOBKxE8aODnbIeUOpuWcUyfnTBoMwZfxW Nqaroa9VkUh123G4Gx10PDTMcvauWi24mQaMgRw21q4+vv0LdbPSLU4h1T9PeNYrjHSiplVq7BsP aoqarCvMa19se4mJb33W90fDmNO/G693lLvfsKhs+kDonh7MaFWVKYfQG1plXpVOH+1d6kfs/wBf 8T2/MfJbfmpfsfb2d/brbkaf7JN9H8ftPT5bfdGE0f8A9krfor//0tN/NOMpPWVtU1MhEtQ8sEqg k/aAH2XAJAuATfxHAPlClJahRGycDtg47IIx8uBMGl162JO0TgSSOj+HD9fbViXo6yhFV4LiGcZl ZDPIaOBnVwCAxLbSxOlybjkf70Bwq7sHSOdmPkNp2YmaFOQ2YZakpIPnR+8w1cFFlkwQRhGqQICy g3sRc99OQFvTbNpR3bceIjq6/TnpoW27qiRQIV/TqSpwypxOCJmqEDT7dSX/AHu/HRu2s26VpUCo yfbw6vdidsCnbm2Q4CCYNBPG8SEr3IVk97dp7xXsDwL6lgRMR8fb6bI20SFgoVB59tRZacTBmRCS NR326G/h+Q4+1mBTAMET1xjMzJ+OFMOWYVsFSaVZI1a1m3abTu7Eg9z8eaczJQUqIjHp4wemZ6K8 3l40QeFN80zRzwFkAELMVKAg3t7QQLDhnbPJUyRqEq+eJgA4Y88actGShzZSrqMVUUiNEQC9i+3u ABYiy8Ayrcpex4cx+NG9493bWHH30mzI08hkN2DfvG/f7+HZWSIBJJ29HH2mgr+XJkqNdUXkrHN5 oDOxAUWJ8dPHl4JTgf098+eHRWmG4Vzz76UNOJN6vEO9gNBoQL6ePCxi6KdoETx559KOnUgCaWWW Mq5tz1iVNg+VQ0lbLIgkCb+zeDEfDUnwHx4M91MievLg6Rq1ewe+Zx9RsOylSL5DbYkxFXvemX07 YP0kwOnzFmCmWuzRi8KBJaoASzMSSSim/lwi2nifo5mRuzu8xl9uEx4uE4/Oo6zHMzcOQNgo5VNi 1MIoGUgxln3vFbYVF18tPYO5Zvq4LRep40V/liTQdY1mLE88YnT4ZETT5foGEdPQ03uKxU7bkC2l 9B93CxdybhUHZNHNvbBAnjQ4UE1BlmggZgsVNRIqyvEPtysdqwppc/Ej6OK3LnQn5UoZtS4qeFOW DkisfMmN+/iaDbSQS38qhprhrWsRuNhflC7GJ2mlKmB9qR+tN2L48mKCpq8V3wYaWaqp6LtLUEe7 ukH7obvbwHx4hec1AlWzo/GhHldgUKwxV8KCyetrMWqIYFOyF2CinTRVQH/CvsHC9Ds7dlDhmyQ2 CVbacZcNp6mtqqhgRTxKTAD2VEYAH6xc8VJQONNoKgkUw1UUkdNASpILySgsDcRE7NbW0uNOMLxH lRmhlIVE1llw9FxHZKu5KiMUkcqg/ak1RuPTiaJMwaw1DAjmKQUuEzUk+IoyFajypqxHTxMMQe33 ntypQUpMVUgOomhb6EZ0+amWhr7VFPX3w3GaXwOxQBIN3jZtRxblNzPzoC7y5V3avgaNDhVSMGpK qjSUGggcSYczsf0aKxRkIPbXhqHNAwOFAp1sqUDGNNWO/wCkQySyUoqYXIb5mj+3FtUsb28DyqpV 10otm52mKCnGcPwqrh89HDvay3W223iVueMF1KgCNtL2goYHhQfx0aYfPNV0dSboW8xVBszbfEG/ KhekTNOOgrioFPV4bKwgYRq8rg7lJUCQ+wCwPE4cBiDVVNrHAxWCugxaFzLh1ZHUoZCAsqe6q3sd bjltRnwmab0pKZIioVV85UTQVMtO0Xy7EipZrB9dTZjb6OPpThM4UyUJSCBjNKqkqqYFJGkLGTYk jMbjtcgEduWZd0jbSRwCcNtLWmxjC8OhSraJZmjVgY0HvG1zYdu/FQfKRhSRQnCpWDZ1fE5RNBhA i2kRCWpN2GvbXl2X1bemmLhsHChApazC8VXbiVGwqJj5SLItrDt3W2n08Mm1CMRFFr7agJBrhNlv DWnmko3FFI4aOOWAldB7tre3jobHtpL3hg0CmZ8FzZgFWaunq5cVpFtsWntvtcmxJ+nXjLiFD7TN XQhK6RmPZxlEsMfnxeRDGIamnaMOzOPeezdtDcW+HKOLgzOHRTjLRIiPWg4HUCixESYfMqS4YzqX pRGY2QXI3lR4jvxP3xPlSlFuU48aCXqLQjCYWxvCS0s1FHL58cKglkK71KqPHtbXjLzZCcMTSlkk igmwHqLTYm0tFmKBEp8TRWjeZdyxyL7hSRe4PY8L0XQjGvdwoDbQvZeapyrW009EWTD6nejYexJV lI27gD2BB4qCtKtszSaApNOGeMi02dstzy5e3YZXBhP5UTBRJf7Xc9z7PHgX3j3fN2zLZhXuozyv MlNLheygKoPTdnDMkMtPS41JSzSrvpBIXjJdCdCVPbTkVPblX0lQVjQwazO3VEpBBqz/APCq6DZn 6fdaZMT6k4tIlLSssdLLvZ0e4uCS2gF+/BF2W5BdNX6lPGVAGOcaIt77i2U2gISAONW2fi65TyZn b0fZ8grIaKrr4oDU0DSrG010XcCh7i3t4Iu1fLx/KnHCIcTsPH20nyq+UH0aFYcRXzls4dOa6TFp 5MOi3pES7RDuLX+IB5iHku+YcbSl9enHHZPVEx8RsqWm2lKEATSPocmZ/rYZ2whHw+KFt0kspddw ubka9+Cu63gy1yEOKSokezoxmcPLCOG2i1zL7k/ZgBzz00InSyoqQ0y4nNeuiPlylmYkkNbx5GO/ n2DuhCRB/XE0Z2rC0JOr7qGx3YyK4XtotybX+/kbM3SmwSknCPL2j284+eSVHGjm+jb1I5o9NfWb JnUTC6yXyMJmSLEKMO2ySldgHTU28eSnuB2hXGXZihSiMDETw2Rt9MB64RQa3h3eTcMHTgRsPX7K +gb0I6yZf63dNct9SctzrNQ4/TpUvHEQdkjIGZfHUE86JZTmbV/bIeb+1Q9nVUUMLUJCvuBxoZcQ ocLx/DqjCsVo46/D69DBVUdSoZHRhYgg81eWSHUFDgCknaDRoy8QQUnEUR//AIbd9LHz3zn+b2kt /Wj/ADo+T5S7fmv5d8h5Vv8Aiq/v7e27XvyKv9h/LNU4xr1ekRp8pxo6/nr/ALor/9PTBpIosRan pmYGtklNPGoWS5JUCx9w3voe3124BrmWwooGEEnEQR5deIg+eFKm7NSlk6jB4kcfl54+RNXy9CMm JhHS3KuCxQJAVi+bnEFjI7yncb7fp5Hd4e9OOJ9OfefPGpBsme6bEbOeYoxlJkSlraNv55J8rTQD ckTML9ha9+BW5yFoyHBI2xS23egyMaADqT1Iy1ksvSUlckxi3IKdCrOwAtrbw4iU5pTKYPP76NHU kwTRGJ+o9JNjktVMywiskP6EtogJbXvYduEz+6+tGoj0EYbZ6P06KZdQuZIwj8KWtLmanFwVtHYO WYg99Ra2nAQ/u++lZAOP+aRHw6T8qaKE6ZRjzxpwgxymcmSWQbQCVs2ljbQj283e5AvQAuAs9BB9 Ojq24HCJmlbLRUJGFSavE8MnhgkjdfMGrbWAJv8AWeUy/JX2yEuDCZ2A4c+nzZunUTNcYn8+CMsQ UNlVn1C/E/TwruElClEATPmffP44UT3A1ripMzxQ2VdrKD7pOumt/q5QtFQCFET1CMMT1cT0etJ3 2QE9dYKKG5bedqNZrKQTYG/iRxzvSlJIPV+McOgHqpMxbkrxxoQMAwGvxqtp8Ow6l82rqmVYtzAL uJAFz4d+JcusXbm40IHGMIw27Th7tuyjtTZ04mrwfS50IwDpfl/DcQxekjxLMVW6VRjnKojsw8yz E9lHcjwHfmYW4W67WWspUQCqPL3UB81utRKRsAo3lbi4xevqcSxCo+Xwajj8yrxJFKebf3FSEHUK PDxPc8kVTxVKlYD40TssCMNtBxVZnqMw1bUNADSUEN6RI4wQUS99mnY21Y8RlxbqiCIFHrFnpxVt ocsr4FTYLhcbSIIElljq6+YgbrJcKi/BfZ4sT7OKigNinNJV5inOLFpMRxSskeFRR4Ynk06ygBIG UhtAdPMPi3gOULxUSVUaNWykpAG00xYzntRJFR0VjDGhkqqkEku4JPb2X4icv5oS5bkBJBUKTc2O yzGohmbdUVC++1ydpLhgBe/gLcTm5IMHiKFVrloTiOFP+BiGnhqq6UXWJRBHE4+27621HYDvxQ3E YmaVXKVKEDClHSiaopCpG6orY1lntYjdu+zp4C3FmhSgOjbRfpKMOuouKQKlUsTAMgiWnihTttX6 vEm54ncSdWJo1tmiZNNysFrDDVtrLZfOWwK/4Tr4cdSYONI7q11JURUrH8JfDX/msEPzlNUII6uI DcoBG0sO9rjjz5WMRswoNWK8ShWEUjsGwNsKOJ1GCSmOd74hTCK4IYAAaeN9ByjbakjwcavmCQ4A FihZps5yT1cVQZr1MUMM1ZSSXC1NLKg3GwH2lYEH6OKm39UDiKBDuWFB2Uo0zBJAslVl6TzxbfU0 MpJUxn6bi4Hs44lwgymkq7VMhKsPjNI6vzPlbEZI2WrfCMVkG5YHF4pDY/d25RTqFRwNXFg+iZEi k8a2lmqGSbbLdC3m0797g3+vjKnyRE1ZTSgMRQcV0cKO02HlUEQuFqCGNz22i/fiVDgnClupf8WN QUzA1IXSoqDGsQHurcg/E2NuOtOgbabdRJ2YGupeomEMpjeiFRJGpG6QgWIHsGgHHWb0maLHLJWP CmY55w5J2ZCtKu3zIqeK1gRrbX+PHUXkmIFJTlioxpVUOfKcpFUyoJCl0qo7EsHuT3+g8fNykY8Y pO5l7iaWOCZnpsUjlrMPYiogs1TTE2sb+AHf7uONuEzFJH7VQ27KeHzbW/PwmpqpEQkiGeAqqEWs N9vy4+VK2zSVNvMihEp6ytqIC71TyH/KK5NgVJ0tbhkyPBiaRFlIGwVhirZUWaQO0osyKpJYC4sT r3PHIUkTtprTJigxxbDMp4oJXktS1NQSkaWIiDj3W8dD7ebC9R6vKt48KLvn/KnyM3zuG3oqqiO+ MR6LMdAQ/tBB7cLrkJFGKF6tppMYXnczyJh+IwpAKlfKhnlAIicfa+lSB48TpuVDCtLt+NIHOeQs Ow2iqsVw2BmqJJxVDZcrZh7x7fZ1+PGblvCRVUkK6KhYLmz+a0sWHwu0FXSkLCKggWRTY9z2PGwr VBGEUlWnQPOhlyBnajrVrMPDijxKkk8tqItv85Qdu6Mqe3H7e5nwkU05bFSpFCLjD4iY8Pr8v1Ul JHTy76uKF9XjT3iLHwO4g/HhVm9oVp1JJBFLLRWnA7eqrZfRjgGT/UM8uH4LjFVlPEMqJFLjzxOp mnuPd27rCxt7OKMv/L3SISSFIwPT+NN3SVqISdhFFd/GgwfNfR3KmU8Fy/n2oxDC85LLhU+H4jKP OG1SdD4gjkKdvb1xb2yShw6FDYT7ccPShHudlzJf0qGIxrV/psry0Uck9REHmfdvWQaa/EHnPO73 jU6dAOHp5emHPGp4ZZDYw20wY1UpS4TiUcdOsIZGG+E7RexFtOLLF51x5JK/h8qUi4SdoopeR6ep qMyVmyUiJJXlZmIuTvN+/wDHk671uJRYoO2QBjHRjtjq/GNhAhnWT1UaNaGPaSpsUFrW+q/ccgwO 4wrCnHbQlNTsIcCcbTrFZjf3hfv4gDisOuNrBTt9DM87PfTLB2pNbaH4DHqIqczZZzz0Sxaq+Yly 4y4zhEMzFisM4JIHwBB50N+n7O1v5eWl/wCMPgfbUHb15eLfMQobF/EVseiURxGRTrvtdvgPieT8 UyYonCoEzWf+Yva9h9j2/vXtxr8qOeinfzQmv//U06slUENdiNC2w3hkMv6WwI3Mu37R+ntrccjj em6QyyrSTiBhww6OEHAgn1M0e5ahPfD2xt4GRxE7aP30460ZuwORcJwmSRhTqqncN5N76WBNrW9n IbvXnLdQWHDiPnzsg9PACRGrYFATOHPPIpfYj1C6w5gWf53HWweie8TrM5RiO/Zbe3hNc73Mob0q UVrPQDtgdUbeHXXm8vUDIwFBJjOXqKefzcTzV5k0nvSSMWO22h7ke3hJa50cdLUEnoMzhhTy+7wJ XjXdD0xwnFaqkqosRE9NC4MflgC+021sdNDy13vS5asYoJnrGB6DtI4GOoddJ3btK5Ac288xRgaf I2Fz4cYYiHNtpcHUfnyKBvI/+YJUogeW3pmJieNaZtpTIxNJDoV0Izp6gOuuHdD8jkNjmYZXp6FZ NUXYQCzAeCjU8yM3YyRebNpDU6ok4GcOoz07DxBiiK4zVNuqFnw/jVg2OfgmerKPq7D0uwKspcZx CCJK3HMSjEkUdFDJqu4a3J9mnB09uK4y2FlKtZjACSD7+feg/njLzikhQ0jjRLupPTXM3RXP+a+k +cYhFmTJNW+DYpJHfZI6e9vUnuGBuOY9725EuwuFIWTMzGw4wf0OHDoxoxsrlLyQoHCkmkRkAc6l bsgt/ZwHuKbSmAcOjo855w4YUpQCVEmp2EIWqHDIZSw2pHZgNwNxoL9uWWQU4nDpjnHo88a2g+Kr EPST0gqMdxGXP+Y42GX8GK0+B0aod1diJ1Cx30tGpux7A/Hkydke6qdS7hzxAgRI/XznppJnl5oQ ADVqeEU7yLHFiJiSoCB5XDkxwQo24xr8b/bPMjWiANtA53qpOY1ilTnTMkOE4PI5wahsaipTSLai +/IQDbsLIvNIWXHMdgoysbUJb1K20IeScNw6DFXikgLRU0LYqYG77VG6GM3A953Zd/wvy2ooBg48 +lLiJTjQkYhjaw0tDSiUPUCMSeYgIjjG43c3OrMWJH0jl37gqGBxpdaWcmYwoNczZrmpqaPA8PUx ee5evrGsZJAF3bR/rHufYOIrl4xAOAoY5Vlsq1HhspCYbVyyu5qmZ3kdWaNT+7e5AvroOILYBZ6K GTbWmBwpc4dVCZ5JXjPmzOSsdgTYmwAtxe2kFXVThb0g9FLuaVBKlNTKFhpgqSEdi/7xuPadOKFq OuKRd3KZmlXgtU0bLM8TBYy1o7aWIA7nvxUhwQMaQrZhQB41irZY2rBPIvukOqi3b29vhpyjhgUc M/bAppmPzGxioARQgBBBFjpf468rVVtEGad8PxhWoJKSVRKsasitfQqAdPe/Liph2RAOyg3mWXFS tUwaa8PFPBidPNBJ+i3HclrWDDsQPYQOPJ4Rxoudd1NlKtopP41U1OB1WH1sMKyy4dJJh9WzfvRX LJ3+DEcSrlKuqmRbhwx01AoszT0s3zVBN5CtIXEB1VCzarY290/lyrD5BkGKTXOU/wBIV3mx8GxK WnqWhNDPIPMSaEe6VNx2XxB551YIx9tJ7ZhbeG0UHFXHUxyieGs89YyEjKX1W1+2vbjKRI66WBKZ w40HubKyvpEZoEmO4HdsNgPjpxI62TsxIowt8vZWaDKDNtXUTmlmqpxKEIEUhIBIGnfjFuoFWONK bvJwBgAab58fMwnL3WUfolsbC4Oh7e3ihEGih2wCdow54074PiFLOkkVRZasIY5o/wB5bi19PhxQ 2nDGkVyzoIIGFOtHjGJ0RraaO7SwDz442sfMRfBSPaNePtO9ePyoquWgVYDbQgZfzrABS4jRzGmd 7Quml1a+quPZ8eKGXk4CcaKbizP27aGanrkzJSk4cYxiEW1J8PZ9JbDddfjw5SgKTI20Sd0UqIVh TrgmaZqSs+UmY0DiyhKi5AIIv9q2h4+kwcTBpGWSQSMaF+heplUPNCiRyjz1kg9+99dAPhwwQFKE E4UidAAkbawYpkpMaRKuhqvKlcGWeDaoLyjVTr27C/KuWxxg1RD6QYjGixdS8ZxrD6AVWJ4RKgja SlxRShAHlj3ZVbUWbseFjzqk4mlyEAnA0UuuzjheOIccy8q1kVOfIrqJ/dmhdQASEHcEDw4XLudW I2U6tpRBBNCRk7qFh1bTHDcakBwtyjUk9j5sZdTt3qf8LePHGngDiZFIljCQIpL5py98rVNi2HRC HbCaiR4gbShWCAqPiSO3Hn0gjop4p1baVuWMqyYfjOEYxTPskCfMVsSDVWkW9ja2g44zaRBBpI+s Cjcz4fR1WGTYzh0kQ8lWDUw+090G4sO9jpxy6ZlskUmYWQRRHG9Z/Uj0vZ/xrHsj4i+BY7hv+WpZ wyCspB4FPstfwI5jdme+v5LNNAXoV14T58DQ6Xu4blgGfZRdfU/67epnrP6h5Inz7Kaemy0i1C00 TnYZJ41ZSQLfunkedu29yrhhJJ1wOAMe3Z6e7ChJuPuotp8lasKT9c1CYVecizqAZO1tCLaacwGu HC47qSZJ2/p1CpdeZ0iDQb45gtHV0tUIthjnVmQqwJA172JseH1leOtKTPP4UWothM8KIlVyHJed KqLVYWcuLXF768yXtQnMMqBxnYeeqPbRe+oJXCdhofspYzJjcdRNr5SALYaewad+3Isz7LUWpCZx p6cIpQ04WCZpDZQATYe1R9Xt8eFSkah5UgaCdeNWv/g2dbqfpJ6lcVzPikrRZbximjwOrla+zzPP KAXF9fetzO3sIuU2SUrckIIjHhwHX0cKibtEYUuFp2pPPIreYwHHcPzHhcGKYaxlpKlRLA5UjcGB PMrykQCkyk0BLe7S4mRgam6/4R33Xue/s78c9tPd0mfX3V//1dTTplknE8UzBR4RSg/zOsVlEcm0 GMjbu3k+y9/byC99c47u3K40pGBOIkY9c8Ogj0oX5LbEvBM4HZ4jsA9OnmaOfUtl3pVQSUNDJFiu aKiNkq6xgCI31FkufC3fkFKTdZk4herS2evhj0xOEbTHuofJIZEJFATjWb8x17oZJAI6l1KbJFb3 Te17NodOxsfDgysN27e0XpQoEkcI8sTO2do20z35c8SjPtrhhGT8XzNPTVczFIFW04ktZgPZ2Hj9 PGc0zhnL29Eyo8NkbOg9Xlh6UU3z6iCEjDgZ9+2jM5RylUUcENPEulwHvcXPcm/t+vkOZ/ngdUVK IJI4D47B8qQ2FstSueTQuTigy9hsz1TiOeRTGoJGhP0kffwMZbZXN0/gNnl5fL20Mra3ShMn8KDj 07eoKs9KvqqyD1loGWVMFn86rLEKTDK4V7X0vrzMrslvF2YSrYUiMdsbTPsw2+u2o23usu8SdOM7 P0rc/wDT96+sq4zkPrJ6o6mRYps3Uvk4ZLMoIjSmiYWBbtr7OZKOZ003l7z68FTgPIYVEbFi53yQ NlaePW/rDU9duuHUPqPXxJHNmKulq1b2xC6ITqNbDmCe+y3XnlvEiVHbt4DjMdJwx99TzlVgbe3S I20j5KbZEgQhoyAv0nU/HkRhShJ6OniaNdaQkih56DdFcX6j5jgVkNHl+EscTxJ7jcigFlXU3udC eDrcrd5eYv8AiHgT6z1bf0jCi66WGW5OBNXP5BwCnwXAKHDaKlXCcOw4NBhtI67TTUy6F29skpvY amw+PMrsvs0sNBIw5woGXTpUZ2094zhuNYqPl4HegwoFldUO2WUNY9u9j4A8XHxbeFKGGZ86ifz/ AAbJsU9Lh9KXqthiNHHq7tt1BbSxPcknjnfECU0YW7K1mBjSiyvmSpnoKjFa4eTUV3uUtFTePlqW a5/w6BRyiFq/i20dM2h1V3i2a2RXdpFVaZUjS4B/Stdrk+Nh9XG3HtKTjQlsbAGKRdJiFZX1KYg7 NtRZFpvP8b6M2otraw4hZ1qxmhYhhKU6RTvSVFPH5lSx2zg9u66jw+HNIcUk0s1KJCTs6aUmA47H UVaGNirxHcotchhp3/hx5h2ThTirZRBFCRR/MSMXaLamosde5uSbcU6uimg0NO2lVBiAgEcO7aXu AFPY3FtAeKWnFECaYft4gzNcqqqWZV2rd1G7cB4/Gx9vH3FE41vulAyKZ56xfMiiLWMg2uosNTzy TPlTw1FJxrqql+UMqKP3bgjXwP3cdUIgikYGseKkxU4jPSqlZGS0iyBWjYg3Q9vHwtza7iAFCiy+ ykKUIqbX5hosZpZ5HOyZ5AKqFQLHw40t8K86KBZqbgH0pHPSnD2kqY0aSnktYrdr3N9fjbiZxMHw 0qbdSsBKqyTVlNWYYIWkMckBkkidj7yr4j6OXS6Fog7aT6VNr6QaQ9ZNPFZWYtFfYk8BsbnX2680 VnCNlKyyCZHvqRHJDVRtTzkVMyL7gtYgnUbreHNpUQrDGqFBBkYUiMZyrSPIKiOmWWqt+kmhttB7 2PKraIVS8XJUmOFB7i9DFSyxr5C3X9J5hFzcfTyqVEgRtpA4ypQM02+XRS1EdWS1PXG22Q3AYD4E njoUQaJrhCk4cKflqpUqaZtwZ2DRyFx71reFz2+jlgsoOFInWAlIEUz2moqmprqXR9xAp9djgsL7 rezlVL0yQcTSdbAXhsp9wXM9dQyisw2ZqaeO2+FzY6XFxe/t4qYuI2HGix61iQrZQx4Vn/Ds2IIM bHyWLUaqlNX02jMyae8PiOGzV8hX3UQv2y28RsNDblDOhwx1pZatauPdY7z732SBa54YtXOzHA0S XLZ27KE6hzKtasooXT5mMrIaFyAzHUg9+KVOKUIG2i9QBMqp0xaDBc74LVYPi0QSWaE086TqB7/2 18Re3KIdDidk042kpX+tVP8AUronmPphmv5/DsJ8zCp3kq5p4GOzyi1iCNfu4SO2xaUCNlHra9aY nZSCo66N6p5sUlShxQNDQQUsx8mNzIofyxfxRSb38eMAhP3HE7DTT7RSeqhuoavGcQNBSvQGnahG 5GkbdECilkN79ltf6TxSlW2aR6CTNTcMnxTdheyo8muKNTYhRMQTHL57vfXXVToOKLZJgCYpO62d Ro0OWK5xSUkGIUooZZ408ms1aOoRWsASO2nDNEkQThRUoFJkUWz1a+nWnzlhC5kwrZJXwRsfNhX3 lhQXYAfvX8AeQT2sbgovGw+jBQx6+cKHm6Wf934FVS/iNDiOC5/xKmkjFOxljKIoNgsUSKo7+AFj 8eYt7xZW7eqUlQkjASD+M+cbTw6Jpye9ShIIoYjnrD8SwCtoKhyuNQPAtIBcDywJPMOhAvfba/IO a3aat23SoePUmNuA8Wr/AEO38aOczvApI4CD7cI+dJ+lxOsC7o5DtLG5Gg797DiN+0ROIokSpRoF uomTKnGqiHF6WG08PvyntusfC2nJF3S3oFo2WScDzzhW0NFWPGlD0ykSjoJoaweWyHbeQ69r6fw4 Vb3Nrce8ImRyfj00sU3EcKes6YmuEUPmwsG86wWS41LW7a8SbsZcq4fAIiDRfdoKTIFXa/gYdJMr 9Yuq6YHmyFajDsKSTMlVTNt/SvHKHQd+1xrbnQvsgy9hTRSfFoTPqPwNQtvw6rvEoOGo1u60VBh+ H060dBGtJRU3uU8UYUKotawH8OTuVHDCgi3boQITspv/AJnh/n/Led+l+Z/lNvc/y3y3zdu/+Dmu 9ExOPJj2V7UmfWPdX//W1fukuWMbmzNUZ1hq382nRqSCpYMihXABsHXvb6uYy9oufstWiGdA1EmR hOzCRPHq6I8h1k9tDhWcB7/Kfxobp8qYa9S1bWFqqpkJZ5JgCbliTYixtyHzvLcBIAACYwGGz0x/ XGj9/MhsA2VIGXsEaNoGo0VEHvGNAPH2W9vEjOdXSFSFY+h4+8RhgRwivKzHVtFOOHT/AMganhCX wvdeRokG5R29pvyt3bG+So/65t9vr0jGaRvNBacNk0Yqlq8MwrCIq6nkEpqoxNCBa5008Sb8Az2W uoWnXgDwjYeuTM9YJEe4VZaylsdXGgLzfiNTjizq1wsdzt7W0I7KeDXIWe6c0Rt8gYExxgGDh8eN bfdCwdO0c88KMD6mOgPSvB/Tb0c6pZRxIVeb6ry6LNdIrIxJkC2IHgQR8OZd3mVZc1kjD7JhSgNQ wx94qJDevuXK0rwSOf0o0GMeoXKWX/Qzg3SLLNQIsVkpUo6gREbmklC+YdLXtc8vvpvTb/yRDDSZ PGCJj8eiqZDk7jt2FEYTVSeFVq0+Yoo6lykVZenlZxfVrgE6aezmPiGO88WkYkQVRs48eny+VTTd W4CCI2Ch/wAuPRpjNHRYpA708koXy1FiUBuR71u44C84yAB9JAlIPlI6ser4nCg73ZCsdlXVdC8q UuCZboZEo1w018aTiCIXKUxsyAkD7TAX+HMj9zsnRa24WE8ORQKzK4K3DBwFGMqsZwmkplit/pVO jVCU5BLSEjSyi9rdteDFYWSQBjwpGhqCD00F+Y+oWOmanD+XgtAf96CBvlJufdv4cUJtv6aiIpe1 AOAoMqbMCYjiVJT0NNJLD5r1NZidUu3TUlrH4eHGAsE7IHvoX5XlatJVNCdBiryyUlJTq0KrFI6l tCNQbfnypXqVFCEWWA6TtrDPClTJUPUsNtKsRpaYi3mM51/IcSXCSrr9lGtvgsQKlUdW0H6GUgyV ZaRY/wB1E7AW+A5vWZjZR+3bgyYxp2LNKggjupBAWwtuJudPhyjoJ8NVT94MzSwy5h60geeRdkkj FgB/dx20Z0gjjStQwI4UJkdXthRVY3b2eOv38MgoGkaEVBqJpnaJ4XttcM99e308TuKMJ04UrQwJ k08Q1kwXbEbeYLsbe068MdZNVdtkprHMrLKrlgWQWs9vEcUaRE8KRLdwwqA9XI7SQSOEYXIPflFq xAovcTOPCk1XMyzKmpg3AFXAP0+GvE7hmrMnUAKTM0M8bgxaNLd21AuO/wCXGyYOAxpx5kKVArDJ maqWFYghK/ZZJe5t3I7/AJcbdfWnHn1pH/LG5JGFMVTiqVBEhSSAtdJGTsB4+HNtupKZNJX8tUnZ tpo/m9AraVjkszWQxnuvHkvACk71m6TgKmmv/mUPkpujhlFmEa7dNe7CxPPayszFGNtl+n7jNONN QTxxww+ZZLAWj+zYD438OKe4g40vWwjTIGNIzH6KpXzSdAb2JUdvDjDbeBnZRM+0RQSVmIfJSFfI EkkZKqD9kAan28ZUvDCkacuKsZio65mpnN8TgZfLO6Fo9Bc/n25UXUfcKausoXA01Mos1UmIqKZq uN4nAWNX2grci3fv278228kmOFEF3ZLbJwrLWU8XltKHUAEe/A4B7eIHs5ZSRhBpFKj1mmOLML4K pdZfmDuBubXFtNSOa78oHTVlZcHUmaEXLnUyOaaF5KizwgM4cXFiDr4W4YN36xBFB2/yuBAFGKy7 nilmopKzDawPV0S+dJIhHvJexB+jho1fhSSRt5540Gbq1UkwRQl5e6i4bjctIauZaaeEq6yBgpdg CLm/e/bjzNyJxpEpogwamdQqKhzLhzhJylda8Sk6HxsQNOPKQkyadtrhWAqtLqfl2BcTmpsThJSC QL7gVWGlyUJI0I8eFtwkKx6aOWyZgUFuB51zVk+umoaDGZcQwsbqgQViiZKVZH3JEB9otYHx8OMA qbPhx5+FNv2ogGKMdlvNVZmhKOvjp4KeprZFnqWiuqhtBqSO4A+ni9p0kY0UviKNX0+x+jrcRpaC pxH5kwjzYoEQeV5agr7t72txcy6SuIkUUPChhqajC8cpMQwBoF+aqaaSOFmNg6kFdCttRpyt6gPo KVCn2FhKgRVK3WHI2GRZpxiHEadaPFaB2hoEmXa/mEEGzEAOpHfmN+eZIwypYUjxY8JHPnUs5Per 0jHCin4hlCsw7EFxCbciSFo5Ym097XX+jmLm+DS2SJSAVE+3njUhh3WiRjT9h67ZDHYrG4t3Nhf2 279uRhcuEDA41ZlBmKUBpYZYvIkS4AOzcNe/ft48Kw9GM40ZobIE8KDHHMtpBMssJ8mORgZWW+qk 6jQ8GOWZzKCkjHh1U2+3BEUEHUrODRSUmXaTbItkeolCB2G02sN19p1vccljcS2CbRwlsK1mZIE4 cB0bdvpQczW4lQ6U1dz+BF1kjyd6t8rYRXVwpqLMdHPg5eQlFLnUA3PwPfmVHY5mJN0EK+1SYHPT Iiop7QLXShLvEKHPvrenzLnnKeS8ImxbNOO0uE4fErTPNWTRqStr+6CdeZEvQ2NSjpA4mgG9eNpA k1Wl/wAOK+nn+se7+udP5f8AnC/q7u81LbP6q7fM79t2nAJ/bHL+/wDvw72PTu/u8pwq/fYTHCff X//XoCwPAWyxhGH4ZCu0mCOWawNizLc6WHbtzn7vDmf5q7UTiMSMccfT3RUjJt1NJAruqYtZ1exJ u0fcd+IGUgARER5fvjmcaLLl1SdhpuDVZMu3U3vuC9gNe17cVgN4jaTjsHy2UyVuE4GpZiqXhdZF LI42+8DYXFyeburhsqAxG09ZPHh+nQNppfZh6J2dNJynzJX4Y8mGtIZUV1WFSSQp9lzb9fHh67ky L1AdSjHo93Rt2e6hRZXSmwJpxmqMWmVkipivmfvKGNjbtp/RxpWWs2ywlyQrgOsdPXxMbKMGnu8J KYinWvw3O5yfLNiNVLUZcpAaino5ncxgj/VP9HDa13/ZdWi0ViRs24nhI6MfSkdzkBS2p4AYjo5F JDAa6bHqGlKF44U/RrtPuAgC+nfS3Fmc3abdYlOOM4wMeocR044dFN5KjjFCBhmRcHaVKnEq5337 SFCa9tAADc8Bru8i1OFKBHtMjbsI+NCZS9p91HK6L9OsIz7iVHheJyywpg7Bv0ASOZkj/dkdRfX2 ezkuboZcLhsd4DKenbz8qBGa3ugmNnRVsWBVMsFFFQYTTmigo1SnZ/te4bIFA9psOS/aJUpACRAo DEyqo2P0ctFCx+aWlui1QUtdzubWSZgSQumg8fDThxb2iefdVy4AIFBFiGdaioZoIKCGoqCZUevq E3EBtNwUe6D7O/HX30pMJHPVRzkmXLdVjSxwumAgh+ZhHmyESykAAlVF9o04HrhzUodFS1Y2OhMJ 208S7vmYqxBsYK6be4sWB7DTw4m0zBGyjBFscZxrJLUef9lf0hA98j6O30cbUuNlLba3KKdMPjjq quGeRjenQxqzaAki3hywWFeIUpLriEx00robArMQA+3ZCFuLnw7ceVp2xB56qqhHiHQac8LqaphN UV1lbcyoAdAhNvYe3NtOKgk0uUyQIFd1uZmjraWClIqI5fdbW9rG1+MKvPEEpG2nhaCJ2Uso2Ehh 97WXWwue+v1cNG0AgyKaBO2nlpJKeMmMg7RcbT8e3fitqNlNOomMcahVNa3lRse/7y6Hx48tYTNF 7rZ1VDdZLrMhsEXaWNwRa5J7cYKSYIEUXLUQCDTXi1QZaaMxPudT+kF9SOxI7cq8SQBVGYKhSYNW Fa7y3lU7Bu8F9vNqKQqlC2lYVOeipZo1k2hyoHl66/a1Og140BjNK0MjjWY4FRvSB2Sxb7G7XQ6/ dzamUbKQPoIUcZiknNgVBFWRwsoAvu1Fu/iOOspRGzHrrSVqVwiniDCaZNiwRjy17OB3v7LX4pAS cAIp1ainbWWaUw08ixsXMKhiv71gfA/HjThMithyRBpKV9XBikTL5ZidLoykEW+88at1hciKSPtl CvOgxrcveZUvKikRkk2Yi9rW8OXNuEiePrSMOz4aReKYAJp5AAF2sVC37mx104lS2lQE0qU6UoAB oN6vK9RHMZYlZALuuy4Hf4acRPWBJGmqhzVgajSzYzhaJJHumVbKw96x17i/LJKkGIpMuwaemcK6 nxuSPbJ8ju3ECRRca29h55xcKiDRU9ly9MBVNMuYaWmkaY07Uk8ikb4+576XPHQ4AI0xRcvLXDxm ueWuogwvGFjgnkYTBkKuxCtuUrbv8eONPiYHGk13kynESoUMuVupaVlLEuIm2wqV8hir7fDX4W8e LWLqNtBW+yNSMUmjS5Cz7heOUL0ctQ0yoQFM9942+Gnx4bMXaXMIoMXFotCppt6gZEw7MlFUeQwe rdleMy6Ose3Ug/SeOOoSodFOWt0UHzomuZOm2LUSV+HK6fJUaviqY3Ax3yTm4WAqup2jQAd7njXc D7Zpc9daxj+6oHQ2PMNJjc/85Z4sIINBQYVU6yx1Lnygx112kkse1/o5dhBKtmNFV0BOGz3UcDLD SYPiYpYYvlzRQ7JZpbbSGZlBLG2rHsOGKU6JnhRVp1UYLBR5EUMs8myaA0z00hI3jzCFZdD2v3F+ KVAKTjSROoKkDCiberTprjGO4e2MYXT3xKFvNrNmu2zEl0K63Ogt48iTf7JyporAx5FSDuzfgKSk nCiA5rwXOFFlhK/GMKnWhoXVaitkjZdgchRe4+jvzFjtByNx201d0ZQdpwj0iI9kdFSXZ3CAvSlQ pFUyoG8+26yl7XK3HxseY6LdAOzn9KEarcETT7RTiVCzAb1uBcnsdO3Cm4TCvOrtPyiKb8ZiT5Wa V7AIpdd2umh4qy54hxMdNKirw1XxnOreqzFW1CSjy1kKIXvYEe7rrpzKvd9AbtE6gSCOer3bKA1y dSyOujJenDqZjXTHP+V81YHWGjxXDqgGmmjNit/dFjp7eC/dTPDaXaVJGlU4Y9BHQPPoBnqoqz3L PzNsUK2Ufj1a+uzrrn2spMIxvqDVtg/ysTQ4fTTyItipU3sfh7eCXe7tBvXHtKwVDD3+kE+/qoMZ JuLag6iJNVpf5xsf37v5tU7vm/5rfzTfds2bu/2rafRwF/2iuJn++1fKP16MZ4UP/wCyzGzSNkbD 5zX/0KNs0zUsuISPRx7EhAiVtL2Qbb6f385yMPpUSoGJ6eHsGPRJ4balm/SCrDYOfZSEnb9PHaJB f3SGuTex9h4eMlGzo88Nvu6vbxojfbSVSflT7RQpJEVZFDeG7UAn+j48DD7xSdQJ9tGdpbtrGyp8 hjgQ/YO0ezt9HN4mNXHZ1Y47KXptUpThQMYxPC2JS1NMR5kR8xI0/eOvt9tvr5LO7+tDaQcCOEn4 jh09PVxTODVIHRVrzegHrinQfBOsn9WGqsCx6iix2iMEbOWhmjDKb2IOnBx2h9lucOBN2lIKAOEy BHv93nSXdze2wQSwpULosudqXE8P6F1U38tKRUBejqmddrI6vYhrjkDZP2dXSc0TfQdGE/PgcRsM CIE0Kcyz1tFr3YOJ99E/6W1RbDp6cxAPHK7wGMC20+Nr6flyQd/grvkGeGJxnCeJG0dXCZos3f04 iZxxodMNosXxKaVMOZUaJVM9Ube6t9do9vI2sbpCXiZ9pOIw9vs9OgWXDSCk41aF6dsh02WMt4LH SyGTEcbJxbEaqdf0ixgEKt7m5Ykt7ddfhlXus0VMgnadu35SKiTOrhKlkcBVl2CZQpMs5XXFMVhL NVlVw2mcW86V4t5Av/gvr7OSla2wQjHbQcDsnCi05yqoamubB4kM0MTiWq2NtBKAEPMx1PYBV7e3 2c8VlKZ4UoQkEimnBMGoTWtOKZZY4wWkaS+3cNQBc28eEzrw21JuR2xSkKnGlhFDJUms89Fjcsae nWIAXiZr3t4aacKXEg4mpAt0gJAissxi8unplszBjvt4i9teInsRAp9oEkk0n6v5uTERTwRBYo0G 4rcXJYaXHC14qKjRo0yAjbiaVdLCsQC/5JkO1kNrk9z/AG8Wp8ImcaZJ8QPCnlaxgsZsPdIZSwAA Jv8ATx8alGeFPoTG2nqISVYk2MFjiUtIw5udRlJ9Kf8AzCUCssNIkRAEamVOzi3jqL3HFKWZxFXL iVYmlHh0hplZmG97b2tc29v0cMEp8MUy4EkjhSmgqUqVJKG6/ZFtO+huOLACRRdcr0nqrtaHzZFJ b3SbDcNDrfjfd0XOvjhXqqQRmfco2/Z3KLAEG1uw446kkUlT4kz0Uha1qiOYNCoA1DX1FgdBrxhx CgK8gtqgkUyLESrPLGFdg3vD6e/Ei9QEkUbMoGqBsrPDVtGI1N7Hu23QDxtblUujAGlikgjprNPj LwQqiy+4pJcaai17fDinw7eii24AWropLzYmtXUrLa1z5ikfAeHfj7SoM7BSAmMNtZGzFtWJN99L uQwte9vy5VxwBeFLG2RxqJW5jp6YASzCGSWwVw1r2IP034yq6ggE0jdbIVgKZJ8UQ1DTKTIsu6SZ xqXZtSSfjx1IA4iTtpMokbcK9HWxPMwYWDKDGrAEaeHFSIUjDGkCytJkUz1NNDUs7BArkkHQ+Ph+ XGFtGOuljSpONQkwtiI1aIfZFri/c342lBBiqOrQT0U2yZejPmrLTLe5kCEDxNuX0mJplwxNNU+U 6WVHUwgW95j7AfZzbiNQnoplTkJk0j8ZyDSTmJo1AI90gqCPv5s2+EnbXvzIAJoE8f6fV1NM1TSk pJGwKMBrprbiJNqoU/3iCkmk9guJVeEVwoq4lVJLo3s2jt7OVaw2nGi67aSvEbKNFlDFpYqannpE DzSKKiHymH6Qa+N/Dhg0tSSAONR7mFiNSoo0OWsw0+KU0IqISKookc6yi4sNCNPbw+QoHzoLONjZ QVdQqF6GqnxNJFkECMKGOMBRTF7/AKRtfet4DjDwIVM7KWoa1NiBQI4DmfKdFic0VLXvLj2HTU8l VJKCkUxMbuVDvoF0ufo5a3ukCDxpm4txsIoxEGNz46uH1c9MtFTzogkhRgqbx+94feeL3iVYnYaL EoEDHGjBZCr5cTjOGVf6KelK1FKSgtKqjaNfEG/LNKJ40kuEJPlRw+hGG5CxPqXkkZ8wdMUy/UzJ Q4jDWqPLLOdHux/cbXi62t2nHApafbspE5cLQjwnjVg3rz/Do6VddPTbnbCenlDT5PzHBRPjuF4n hKIqTfKL8wFYAW2tt7jgS313ebvLB1hKQFEHz6KFGTX35d1LmqU8eutDLLlfPOcVoKuNRPhM82HO b/vwyGNrdh9pTzmBvrkaLG5LYMmeeHDkVkDlNz3zIXwNKrDmdZfMeIbL7WYDx1HcfRwG3IBTTulO uKm41HI9HVLFZ7K2xbDW47i54my10IdSdmNLoAqtnOCS0eNVkMqiOf5hipYahSbjtzL7IbgP2iCD w6/wjr20BrliHiIilHljE5qaqpKlCvmRNu8vvt2/w46lxaVFSU4jjHDbIMSPOm0pCwUk8+VGM6t4 JW1+Tcp53iJqvOJwqtQWZkDrvQ3ueCLPGwGm3QfCdu3ZHOPxowyMIJKBwotfmT2t5K/a9v7t727d +BfUzt1df3HZsj7enHpjhxoW/lR08Oiv/9Gh/MeHYp/K0xfCR8xJEC00KX98EX9ne3s5zdy26ZL5 aeOBxBmBs8urynqqc8xsld3IigmTN8E1QqVkLUcqXVo5t17re/cDxHt5IhyIBrS2QpO0Y/Dw/pt6 qBq0rJOHwpU0mZaERMwq19+7HUhhcaHseBy5ye4SZCTAP6ekDj7KWWrxGB2/hQVdQc44ylRCMAlD IovJqdWPiNNbHw4Ot0sgtVNy8mCTIn4TG3zMcYpm8vVkgJ2e740zZdxcVkbNij+VXVCsoR/zNyTf vwXXuVlC0hM6EnZJ6Yx65qrT3hUDjI54V9Kv8HfPWRPVB+Gp0vwrF8PpMQqMpUFR07zBSTIkjRy0 O6FDa1wStrcy7srpxdsyvHStIBHlgQeFQi4wkreQoeJKiQeMHEVq+fib5ayR0Qoer/SihgjixbFK 2qq8NpwLW86XTaAPD4cizfj8hZ2b7AgeI+w0KcidXdaNpwqg3pRSVjY3ieGX3z7vN90Wsq6a6C9u Y09oj7f5Vt1ScYiZJk9PR7APbUubvKCXtGzDnn8as69LnRTN/VrNFVgWW4QPk4jX4lU1GkcccaM5 ZyfCwJ15E27OR3mbX824MJgnEkfqZE47ONCTPLtlhmVHbVh/SvKlfBitBS1SF6fBmFHHNKVU1Dlr hQB2XQXJ+vmcG7WXu27QCvuFQtcuhSiemjVdb81z4VhdJlnDZ0E2F04iFexFoInYy1El/B5GJPwR R7RwXDiJpAwglUzRFkrpsdqjh+DTMKe/ytZX2JmqLtuBQW7fTwtul6oA2UJsttJUCaFbC6GKlgSO KX3gCty26wGl7jS7d+FDz3hANS3lFrCNlPMVzKDu2jQu1738NeI0zsNCpISEwK5iG84lDqkJBXzB c6Aj9vEZTJKqqgyIIxqONkc4ES3MhB321sPEaH28TujT5Tzspc2lKsONOryGGFQiWeXequw+FvH4 8Uq+zhVFNAqwrHhMLx0SUp/SiJUieeQncbXubnipKRsG2mnH4VjSgpJHpZRTSKbSkX8QVXvxtLQQ ZFKWlFY4UoqWXc+4yBVfRVBuTY2AIHDBp7USdlOraEdNOKTQxt5chsNFU37g9rjTmkuSZpvulxhs pR4XPHOyrA25dAyfxsOKGnBqmi67aPGlBUtBTqHuQ0fvix1PsFtOXbuAD5UXtMFSqZ5JWmLS7QBY MFN+3xvx7vJTjsrTjOgaRTDPH50s2xB5LEHQ2s1++g5qNQiaaTGE1EEMPlyRgaqujHuB7f7uNJWC MKUtEhYgbaZq6ogVKaCKPedNY7WHgSfv4mJmKWMpUCT86bq2nphStLKRukGlrbvr46nSRs2UXPrI OHrQcGqSXE56KKQKYBuK312/Ry7SAodVMhwyDEUwSVBWfe0+5mbbtbtYkCw04mVh0RQgaSdOyoua svNj1HRNFWtSzUrrKrISL2I7/Tbia6t9cA7RjSZt4AnClHQUYjpITIRIEG1nIudBbXi1tCgKJHyS azpDEsob7KOLgAi/08cQPCKSqGMGpr0qLLToPfMranQW0J/ZxWl01VKQkYCnGMJEE90AghgxHa58 ePlBANJ3CSRAp2JgkI/RoXPa/wAfHT9g54Iwxp9tApnrqKKMSPGAXkA3HW+vfS2nfl1NbDFMKbGz YKSFVSNE1u4Ukjdc+B+HGHFEjoFbKBB66T+JYfBUoIpQLyWG4+Frnx4/3gJEUjcTpnCg4xvINJWP LP5IE8ZLQm3gRbiZ1oLUYHvpOu5KZ66n5Wy3X4P/AC2VSxipfMmcnsEVgAPz05tloBU8aJLrSSqU 4UP2GywpWJEjGLzwHUX/AOCHbhiCQY2UQ3NkCNUY1BzGlI1Q6V9WLk2l88FgQT/C3Lq0nbxplptQ GyQKBnMFF0uwqoNBLCJKvFf+RiUeTC0ncbjcm17C3bjjZRMEYc+lFt8heqTNL3pNi0eKVGK5arcK /SYcpqacSP5sVUAL/o2Pb28XsJBBnhQdf8Jw40ZDJeLsDT4xSvuiwhPKmpmI3CCT3tL27HtxvSoC i99QxoxUeexg2X2xCSiZ/wCXMtdC9OpMgiJuSNtr9+/Ema5qbVrWRIFO2lqHlBPGKMxmL8Q/MGXO gWL4Thcv84Z8Kmw2mqQ12VHiaMKTY2sDwP7wb9pTZqdaAUY9RSjLMke/Md2owJrSww/M9bBnPE6K s/QfOV9VVSpc2PnztIdwt/rafnzAjfRs3jHfn7jjgVbTjxwkehHGsj8nQGAG4wFDg0jFkMbAo1mv 4WA/t5COnA0YPokzHnTsjvLTMpXWxXbYm4Og+riJRIXt20raE7aIz6gsDqoZv5vSU3lsljIyAkEA 6HQjmRnZbmyCnuVYzsnn30S5vaAq1EYelBDluepcwAure8IrXB3iwIYbR2t48k+7aGhRSmSMYmcQ Pj5UGEIIVVi2TXpM39F8w5bmX5mupoRJRLHrZ4T5qkaeNuOO3qXcnUP4kjDbjHEYST5YTT2Xp7u6 6j6UVH+qj/4f3/Itt1+j6eRN/Ohp/wA2dvGefhNSNC5r/9KlnLuJUyiCnrE2Ruu1/MBNvdHe/hzl 1m9j9xScQT6+07ayPZbKxB2Rzwp0zPknJ2N4fKxpokmKttlQkNcm5Iue/G8v3uzBlSEpkADhPDzJ 4dQ8ooteyhoHEUTjH8kVGBYjWVFJX+ZRtYxQlvs2JPt+Pjye8h3mReITqb0qBxIk7cOJjH40HbzL CjZspPYdhOJYnVtAAH+YJJlW9lJPsAAAHw04PGlB8At47Zww4bYOHn8aJbgFOGzhzz60c309/h5d Tev+F5gx/LmLUlHT5ahkrfJkEjyyGKx2jXUm3JR3f3UVf8QSnbHDDE/d6euyiO6u1MzKtvPPzrZx /wCE8snWD0+UfW/KHUp6fDul1S7V+GSVFQDIMUhby3IS9wrLrfky7kZY4vL1JMQlUj2mdtRnvDcB NyFIG0Rh7qqR/GWzfhOePWjFV4LVrX0lVBKKpImBUEzAru22Ha+vw5jV22ZqyLh0IhUiPgNvAdPH Zwoe7hWSyUTsqprKMUmBdXJVlpLQ15eESXa5JS/j7OQVn6U3O7gUBgJ/pbcR1+wkdc4VIjalM5j5 9FXMeiDPX9SouqeHUUopcZx6jkipZiLsqyIY/ZewuT34KPp03mYtu9ZEaiBj5/u4UX782zjiUqOy jVdMq2pnqsUro5hJRZedKVHmILzVJhkqaqU9xaMLtPx5k9ap1KKtlATvQBpmkbm/GcZ6hY5W4fh8 LGlVpcQxWre4UQoqqFkbUBARr7TYeHNtpKyeAp1hBTUbKeHwUCyx0cRnknu09e42lyw12sf3QNBb iV98RpAwoa5UwEwo0pgtPTU8aqzSS3KRRx3UIALDw4H3dIEDbUs2IUuKdUgMsKs2oUgOL3tzyQNt Gyxpis9UzGlmpwPejUqpAFhr8PHiZaXCDNJ21SqmKjeWljgqJyCzlRa3x8b/AA5RolGJpWlfClVU otSsc4uiW2xr21OvYC3FKVlRB2itlZTGNSZDDRRqjsAdofaLXb29r8fdWgHbHPnSIguuE1jpsQ+Y qAvlgJ7yxFb+7YG5PExWSD1UYto0Kxp2prSItmIP2w/wBtYcUMnUmDSvXTjT1K1EzxMtzAQdznXU WtyzLaQK04CgUrMFljphJKAWd7ncAe48Bbj5jhRbcpUtUcKmTV0skoAVpLHW17a/x5VKMYq6LZIG BqMz1MwmcJtY3RgexFvhx0FSTiaTvMSccRUCdpUQrfyw1zZd3f4Ad+OrKgOmkv5eCIqDUTTRRDyo 7yW2sGtoLEa2Ol+NuK6BV0NpKxjTZO8kQDeRcsF3juBft48qXDBwqxPCaSWJVwaF94IkjJstz7SO 3Kd/AjZSRcgkcKAiTFzh+YsQq5CxknBiCqTYAG47/Rxl5wI40otQFpCan0FYK8CaX3gfeTW9ra/T zSHRBNWu1qb8KaU0tcBTFY23Hb5Ysb3Fu/c35orBNIgrHGm2rxWRaeNFk2ttsygdz48VsrmINMPo 1kkcKm0mJNuHnPudgIwWOoN+/HVuSmkzbcbaXlCoenQlrygklzofvHx4rCgkRNbNspQwrPOgQW2e YQVZm9ttPDmzeAGnfyK6bDibJIzCFl8v3VEo2gi1hyrj8jDA0+izIBNPTTQ1NPE62ZHHvMdLfdx9 p0KE0XONEAk4UmMUieKocKpcEEhh7beHfinSCJpMqRjSZrI3jQTX3A+4WvYA662PNrKTiNtI7hSt UTWah/TgJKFIYBmZvFbX04ykCdtJHSQMaWGGQQS0LlBvOsbqut0JXT8uOtOahjiKI7tMnAVkjw96 evWpsY443CENc2AW/FI2YUX6Bp6ah51oFqqRKxbtKU3g/C5P5jmnIPXVWRjHEUW7qDgGD4xhwpa9 jEZHV4pENnjbtuWx1t7OVSUYAmk+ZAySKi9HM1YjkjN2FYTmpVqaRiKLBsxQhvJmSMgKspHY7dLn x4ZWbqkmD9vPCgZftjTKfWjs5oglypmKaqwqwwPMMaVlGUuVjPcoT20J04qfTponPiEmh6ypi38+ wanEahZEV6Spjcgh4bhTr/DjN3bB9spVVmV6FgjhREOrmacS6fZhlwmnj+Ywup81Z6WYMIypuwUd we3MT98bq5yq5KUiUnaOfwNTDk9qi7QFHaIqqXrfTZLrMxNmbKlL8pJU3qauKGQi8vjp4ft5Fl3m 1peNLDSIBxO0bfcOPDE+8aItnmwNRwFBhh/UWvSvoIZlLgHypQbm9rgg/dwD3e6TQbURHsPnzHCn RcqVFGUw2pSWGCYABZV3WG4mza+J5EN6nGIiKPGAUnVSIz/geHY5gGIQ1UK3eMtdjre3tAHDzdrM Xbe5SUnjTt4yVNkVXOs0OCYxJQzbhPBOytIz3Dgdje4NzceFj7b8zCLrV3ZhaQdUDpj4mCOeqOls KQ5E4VYh6QsVpajNhwipCyQVqbxGxBDd1Pcnnt2wkrcaJkKGHMzzE4UjvHSIVsgxRk/8yUfzfyvy K7/62/y77OnyfyPzlu3bb9V+RB/ZN/vNGkT+Y0f5unXHlHPGhr/ME6Zn+CfWYr//06PVr8tw0Q86 tcVKjawjFwPgbc5oP5XdhydI0nZPt6vXzrI7L8xt0IMq8VIHPud4KGlgiwSpMzkndcMBtB1sAOSz ZbnWC0oMFRiTw6zwEdFBO/zpZWdJoI3xTF8XUu6EkgK7KSB2Pe9xf8uH1paWzUlLYAGzH1nYceG0 D40l/NOlMxhSmycsiVcUEt0ncMXeyhWBY69tL9zwUpzNq1bLq8BCokx8vQelFVwpbysBsq/78NTN 1F0/zTiuDYnWpHhOLUgMkQcMpLGx7gDsddOIuw/tSVdZ64yoaUYxjwxjhGyKe3q3cCbRKhtpk68+ obNnRrr1mbKHTvGfl8vZqhbEIYIWsFl3srWt7Rwd9ru+17lTbptFeFXCY8/x66CO6m7jV29DvCqz 85YjNm7qbLiuYKs4hi87ebNUTG7A27Anw15hvmee3V9bF1yCqPIRw44bf1xwl1GWW9uvSigQxmjO HdacMli92nqGVpJW2hRZSO9x4/fwW5Fbm53cdBEaQcZj09vw20R3w05gjVVoHpowSSfMOY8Xjcmm oqBhIQDsDsxGultLXsDwy+n7K1G7eWUkJSBienHqjowkxNN77nQ0kbZNGr6XJiwy/mCmRD8xWD+V U8V7E1GJVEbyKAO5WFV7+08zCtUw2QMJMD51GugFXWKfsZwtcBwJsJwyPfU4g0lFUyAgLVzpIWWN SdWWM3v4Fr8XrQEo0gbaU26ZVjWPDMLrfloWqqxfNXcKjyTdS4tcJa27b2v24TvJknH41IOUFIgR NTaenJncSBk8s28xwRrrpwqLI2kVJtk5pGynmONViKGQ/oveLHuSPhY68sptJOznn5UtLxUKnx0F qfey3Zg0zH6fq5ptjbTJXGEbKTCsZCwqLL5RJBFvsjXiF7YcKeIAAJp2pcRFVTlY/d2LawOlz7eW YdUtPRSdSYVtqPWJVVVTBZrqi6n23vp9HNuWxU5NKmXtIp9w+FYUYEhPKBLkAaC9jzbaRiPnTpdK gTGFT6WWn82OKArNJILIOwFz8ePsuA4DbVitwjEeGp9DQSU84epJkMt2KBgqjW35c13QSZImlSX9 aNkRSyjqqKk3UpdBKRuCLrYHxNr8cLiZgVRbKzjFdx1EK2fdtJ8QL3/PlmzOwV4ySRFOEZRIJCvd lIIP0ft4+lXTtpLCpx6ab5FR0KsPetcM1yAb8uFYTwph1wBVYjU0kUcdheRwUZlGu4afff4cukSB SVQIcmknjE7QxCYn9ERuYt8BppzYGOGFN65VSAmPzTszkEkbiR2AsR7eNobGJ2VS8eUdlBBmVKWO RHAJeOXzJJG8VFxbW/GLpI0ExTNmVzgaUWXIKOqo43jUe/c28Cx0vrxMhIEHTwrb5Ooyeipk2Hxx yzyox3KPJt4aHQi/08oUSZ4V5TZJApoly67oAsh3lt7bvG+p768XtNgCOFKp0mNtTaXCpHq4g8hG wrZgL+PHkNjGRAqq5AwoWqNKaFQoW4NhITpb4ezniuDFGlpb6hNPaCnmBswv4aX8RzQ4DgadeZAG HAV1U0lEIdswDFhuUKBa3blwkTgJ86L+9EYbaS9dQRO0RpWMIFtwib3bdgD99+US2AcMKSKMo2U0 SV09HMiVkKzxsSn3Ai5seGKnlBNErtspQNJSeRZ1rFjYyKLPtS1wpJ1PieWbdE7KL3U8ONY8JmtV Qh7hAwN9NV7ePLNkzjSNxWoY0soXWj+ZWmfbFUDcUOlmB0sRbjpA20XXKZNKKOqJhkLyFmlijRXs PspddOOJVIHTRME+L1prxOcT0UcTaINIgT7zWJsOeJ4GqxKqLr1BwWSup6ponZY9reUx7q6i/wAO 3E4SArqrzqhEHGgj6Z5jizPV1mRsWgDYvS7qukMh2tKsYKlUvruI4Z5esLwI8qCGZMaDI2VY5hFc mPdLKWjrD5s2CSIKOZ7bijHb7x73G3hy6gqTjQZdBThGFO/TDM6YfNPAxM1FUK0YlT93bYWse3bi ZqIw2mquqIIor3q6Wiw0Yjm9pfMhwwfLYrhpYaB1IjnUg6bgeQ12h5Q05qcIxSNm3CpC3RzFSSEd NUd41j4q6uoanqA9GxlWOkkQB9juz+8QAWILaEm/YduYvuWSNMhAQlOAI6Dj0ScenhEYVMrThWI4 9dIaHfR1UM0m4MGLqBawPt7Hl3EBTeKcccZjZhs6vKm3rXRs2UZzJ2eIpaJIZ5FDR/YbS9u35W5D ef7uqDsgbaMWFpEA411nvMbUtB+he0cy/aW1zutYcpu5lOt2CMRRxcr8HTRcsQ6C53zpl5s95Uwy fFoFnZqinw6IzOBG9ibWNrfEczB3Q3euHrHUlIcAGAEgxz+GNRfmd422tXTSp6DYpiWV81YZUe9Q VsEq09RHMpVwS5VlYaEWt204UNg216CoAE+vkB7OPyxREBxk+6roPPrPM+c+Z9/+X/1t+wPt+X8h u7f4eDP8kNeqP4tfrpiij84rTH97Hvmv/9TXzoWVkJlBZv8AJtuIJP7fDnP/ADC4WFDQcNkzt/Dn hhQ9trtMkcabsUoKR4vNkj3Ml7MB318dOLMmzV1BA/h47J6+vzk/KlDL4KoimfLskVNVmCxaMklN xtoewIN7duCe4uFETtnDonqJJ9B1dFCa3KVACPdSlr5EpJ42gkYxm5sx0VRZja1yPo5W6ze4ebCS JAMAHow8/wBKafsW2TrjbS4yH1jzH0/xyPE8LrX8tlXdEZD9gOCQOayy0DT4dZQEkyZmOnpPV6dW yqPK1p0nEU69SesjZh6hYHneeoeZEiWCVN7EqupP8ePKdu8zK0vCEyMcdnGCNvvHsFa0s2pStIpP 4LmB8z5uqMdhRoIbsKd5CbEaWLf3cCm8Vk1b2HcnBWO3A7eJn02Y7Zml2Wul58uRIig/6k4rOmfs CYoY2LByRvHf3Qfd8NeH+5I/4TLZDeMk9ZmT5x5bcKJs+MXIUdoq5v0jYXNSdJcYxOvQvVY3ULRy IbXEMgVEBt4m9/o5MXZZkybWxUdOkk88/rQS3ku1OPAcBRqsh182FVtRis0Y8zEK+pOBxvazVFSB SrPpptSONtt/ZyVrQmJI8qIlJnZTBWVFTjGJ1gikeSTzpMNwdhcssKLtvCDoqnWxtrqT4cqtapg8 /hRnYtp20t8sy0lN5kVPD8ysKrJWYjOf0au5CiNL/D+3iZAPDh76GtiRA4GsuLzQT1ks0LKJJGJZ VuLWOns4keSSY2VIeUqGkDbXl2pKm5gSwuddLn28ThGJkQfjRo7Ctk0+M7CALuDGQlXIOoAsR38O XCwkY0lCgDMUjsWZUjlWI2Mw2E/D4/XwsuFBXCnQSo9VYYljwmAVEnvtHYbQb3ubac0ttLafdVg7 rOFKSOsi+XjlFhvHbXufpHLquCgDpqqESqvU86udgItNuUs173bubW1N+NMnUrHjz0xT6wUDpArJ TwxUNVD5d1W5lY7j9r4nl0kJNO/mCtMU7y4oY5CWkHviyovh4m1x4cUKciINLUkaNlJd8UaTESwd yoUq4Ui/tvxK0oJXIwNPuXKiiIpVUeNhIys32SDsjYknQW14pDoGIGNJpkSKcY8YVoCYyQmod2Pb TW2nNfmFaZjCquET1102NLOscKNsDjbGAbFh7eOIfMDrpG+kY4U21NS0CCpV90JJTbfS48fDxPFK XMQRSIkTp4014jiqSReVI4CsFTYDrY6jtbjwc2mmXWhIIpE1k6NP5dIh2gEtroLaW42pM7KoUkpm gqzBSTiKuL3YFWk8y/hr8OM3E6YpsOYiONT+nVY9bhMBIUKYgY7k31J+vw4mSox1kUqXi7QjmOKS ZYg4VwPeAItfv+unNd4mZijItgpk12GjCMsR91bKwLAWsdbcWhZIkUyFBJxqRQlZJdyH3mO4gmwI vfwGvHG1jjtplUAkRhSijUOwdHBUEKQT4+Ps4mW7Coo0S6Etg1GNZPTzPCzAIbWYanT2aacbZK1K ik792NIpqnx16c+XLKdwOlyfEeHfjqBpptISrHZTVFmKL5l1kkN7bdhNlFu3h34pYfJwPCkF0wUp kHCpMdfTzwWY7g19Xa9jrbvrxcXNW0YUWurjCkxGwiq3qLGy6Sm4A2/X9PHCniBRY7piDU2eM1El 6EXdbOFT94fd355p2VdB20WuNlPHCsjVm+mQKbyNdEN9ARb2W8eKVOmcRRcsYdVO1HLULG5JLRBQ qlvDx009vNBOPlSApSTNSKmt85VU/wCUiGu06dreF+V7xOImqNATsxoKc0zw1MFZDNeJX92J4tLE a66ePjzYTjsEinXmMJFFBnpZ4cy0VZRSGgzJQTiXDK6AlSRuvY27g25dlXiw4frQXzNKNBBxFWd9 O8QTMGTJMT92NMXp5KbFKVDpTV1MwDG3+vfcOH4XKZGAoIqWkYU2ZdrZknmSIGCYv5lRtPuEhijN b424lWqBNJDtoLPWll6rk6ZLmrA28mtrYP5PVQzk+XII7lkIN9QCbcivtNKmrVToM8II29PuoY7o Pp77SRVA+NVM8WISkoYJg/lywxkgiwv7LW5jYrFtekaUjb64dfp0+VTIi4xBFKbL2DyY/JHTOnlz Sj9A5a1yT4jgPzXMPyyNc4dEyerjz0UI7VtDw0kYnnnCn7E8k4/lqUVKBhGt2kIYj79LePC7K94b a9VpEA48+frTdxli2jiJFRcQxZq+hp4aqYKlhGtmJ7G3je3bhixlRYe1pAAPRw+frXm7kEaSKuS/ BXzDk7Eer1V0xz1AlVgWLzR1Cw1Aurbjsa263j4DmW/YTnZTcFpYGII5kmoR7ULZTQLjUg9PRVjn 4rH4LEeBNiXqW9LuFPN5bx4hmDImFr7sqs26SWJVGja3078Xb7bmuoeLzZnHYTs6vI7JoryveMd0 lKzMjbVTX8zzj/L/ADP6t1n/ADC/9Uv8hJf+afzTy/l+3+U/1e9uEXc4bP4Y99P/AJ1mY1cZ4bIm v//V1+kCuhdPek+yAgtbQe0X8Oc831HT4ojoHPvn2ih+i2SV4CDTRiVdS0jpFJIqM1ybAeHh2+PD HL7dxyCkgD2fL3gfCrrSlC8ds0lauH9MamnbVD5vYklfaBY9uCS0dKgpOkbZj92MbMRjjQmaVCQQ fZTOuPNPXJFV7iR7oZSioDpt0Km/1EDgnFu0pkK2TtiBHuGzHiOOytl5cQozHPO2nKuEkyNWQSkA BSyOLkm/gLfw4WW+lAVABAmIkbZ8gfQezCvOqgzIpGRpUYniUdGAUgaVVZ/c08Tofuv34ZvOpt06 xGqOjhs27Pb76RpYbejHbw5/dRsMuYZR4FhEaN+iYJYnaPeNhoByAs4zB26uFSrA+yfQxtjH1od2 TCGWYOEUF+fKgU+YsEq54ZYYTIjRTxoLhd1joR29umnJf7NmnCy4EERj79uwenqOqo93quEd4kkV e50MpoMM6K5JpsOi/R5jkXFYTNtLMrORG5tfTaC318yZyDKzbWaUc/vqPb65Dz5VOFDaUpaeOeqJ K0dF59LRuLEbKWEU9xbtudmAPD3XCSo4U20ST0UFeGYhVzYLi2IUsnys0szUgrHHvoJCEKQi3cqL L7BqeFveqKSqcaNmNOsAGlJTZlgpKRMP92hSgjSNIF94DaNS58XJHGHbkAiDs+NC7LUBattNuE4x JiGJMqs0iTltryeI73+viEK1K66kW0CUIGyhNSMlYbXDkj7J0Ntf2a884YwNL++Cx6U6J5jgAEBt Qw02gd9e3NaCSeqk7mlIiuE9PFsQFLsPGwsTp7OejpplDsTGzopqqIk99KjVAbi2tyPD6fjxOtQA 2Y0oQcRHGuoamNgjMhAU7oxp2sdTxtUnYJNOaCFETHPPXUKbEwlQiKu1nvtaMWPe/YcRrB1RStMa OunaKpCx7pJdzG1y3cD+/ipKUEYmk2yIptq69FkLqbhFMahftH7+OSAINbNwrZ01ghxGOMRuyDzW 1ZiBrrzcgRHTTqn5VE0p6fFaSVAZIgitqwFvyuOLQoHhTTrnd8ak/wA4pvM8oKFD+6L2b48abd9K YQ6TiTUyCvoVjlkkRRKP8lf92/0304sSBo6aVOuFQEGmTEMVoauGSiSXy/MH207Ant9HPaW1YGkT qSnGkjUFY3t5gmcWUs+vxsOM92UnAzFUS+VDACK5UEsIladl983DBewNj2vy6HDh01V1OEA0x5je N6CvJjDDY72I7WBtqOOOqSUmi8zMUz9OKal/q7h1XYhqiJWT6ydPbxC4hPdgjnjRk07DpFCEMGhZ fNFQVmbVW0uR38dOI0Mp6Yo7FzIGE1iegigBvOdxDBi1tePonjhXiG4JpvpKeZqlGgqdhVdu+1wL 66W4rSxgYVReHUpVBqUFYpK0Vc0b3swH+LU+I4jdt0qAHGrXN1Bw2Un6mqxOKKSWLEhKyWIWQDdo 2p0v35pllQnGkxdQsiRSFq6/GAzTyRtMt/eKd7eHfiq3CxJONWCUiQDTWua4HTZVJ5Eze4Q4sQb9 zcA+PNsvpC8dlMvtrAgGRTpQ4tI6eUklt92DjQgAnv2HDNJTEUUr6ZpyjxRZJAjSMCx2m+22mmv0 8UFShhRVcNkEkbKlLjDQTEBreVcDsA39vEwcUdtML8URT1HKtZHC8OkzNukDaXHbT4/Diltw4BWF FjqcTNKcSEeXGiEg3D6X8OKEqM7aLFjExTc0UiSF7XsCGQE+F/bbnktAHbz0VdpdIDM1vIaVSokV veJGna1jbTx5bjh86UrUIx40Wes+XOYKV0i3rMbGRjYxyBrhfHQ62+PLsKSVHhzzzhQRzFJBxo9n R15JaKto4LGirYzudNAzgXDdvtC1j7eCBgy2ZoFXUa5qRF538+wqaG8dHiPm4VXRx2G2bbvHf6zx ER4wOFNrKRwpS9XqWDGeieOYNjDGTyJzF8yV3GF0iH6Qga2Cn3gPZwA9pdmh3LHEHiNvzo/3XeKL qRxqgjMeB4auKVEG4b0kYeZIu26iQgMRra4F/HmCjrlxbuFAXKcQDEdI2cOkjrHnU/2rs4xWCnkj wZ6eaJVKxn9H5Ow3IP8Aq34UvN99KFbfP4HHnjRqHYAKTFWuehP04ZA9YmKf1UzTmCTBq2pZ6aKa mZR74uACPjfku9lnYla5sytaFw8k4AnCRyD7KB+9vaA/YwNMg9VWpZo/4Th5ahwmsrf6/wBVSoIz LT1SmMhD+7cWsRycbPscuktkJ0lfQSeeHM0AE9oTnejvBCDxFFGyL+D56uvS710yxnrpnImeMAwe oTETU0v6Kd4N24rb7JPjyuQ7s5llt4lKmzIOEbNvSKS7xZ/b31ooTOFbjfRXqBDnfI2D4fm3CZMM xz5WOkzBgONQlGWRF8ttHFiCfZzJbMMu71PeAYKGINRju/m7YT3c4pqD/skenP5j5r/N5h2/+d/5 xtvlR7f5j8t8nvtbtt1t7deBz+WN/wBHnn3UKYbnbz+Ff//Wp+zTguGYNQSKMLjp8QlXWNV+wwFr A6cwx3mfZaUrwJJXwj0mZGzoFTFllvOPRRJ8x0VZPmVt4O12LoFa/ifYe3DXddWpnZjjsg7erooP 5olXfEThz6U+y0NRDTCe7EILgXIIHfw/o4W3bS0OagIxw/fPEdZn2UbW6yUwNtBbii1j4jD5Z2k3 BeTUC1hdmDAn4C/D9twJQTOJJ+WwcmlKboCQeflS6hrnocPjqZwWpLLHPHci1vdudT7eEUqfcDRV iNmzh+H4nCJrZukGZ56qh4RB/wAaLDniBKVDq1OwL7bm/gzaX8eO5lelVmo4SkdEnb0g9Ht409bL TrASR084Ua5cOhpYExDF5QWUGSmoj42NgT4HkKovFDUEYK6YxHqefTGjW9vBGNBNiMkXULO+EZaE wDV06YbTwRoGXaWsx7kaLzIzsZsVsgggyfu524Rx9KAmeXKlHUrb1VsfZIyrT4TguXqYqgw/JuH0 OE4dCmnmVSwKoUf8RUEseZMaEDjiKj6SVUj8zx1FdlqCioGtW1zR0Y2H7JqZLs9vYDe/C65aUYAN GTMapOyk3SYPBgmV6N6uoVYYpqrGass1gNyFF1B1IRPd+JvxuNCQVHCjK3T3izHpQNzZsOLVFSlF TiHDqYjyIt1ncsSxdye/t78ILi51qJgQdlSHk1koJEmlLluWpXEqaWEs29gImUnTd7vflWxpoVgy IoyVK0jlJJCTMiDZ3v2tr8TxwmDhS9JGmlJTIWS4S5bXQa39nKNJO2kjpOrA1iqZGjdlA/whQgN/ Zxt8kYVdpjCTUb5X5hl8yMbAC20/HvxhIK1Y0YNp0pnjXH+WyCodltHFawB9mvgeWbWoTI2UneTM dNMktEGqZZtotH7w3CwI+rja0KM6dpqqnYhJGNMFRUlTOWVS63udbfAfDlEo0nAY0tUfCDSExfFv KZfKcs0YvIym2uv1c0VrlIikjasZqNhuO1ldGZGBLrcRBu4PbilKjBJ6fdVHVFDmBrnJm4UCxwpM JpfsupJvf42vyrigDgZp0N654dFR6XN8i1DTyykul1VB2JB738Dxm3cHAzW3WYTgJpkx3NVdVPT/ AO/FqdQ25gjbQbnW9u9uKXFTFLUvJThFOC5uWnjQQsJPKPmOxJ96/jxU88ngdlFIWta4VsrMmcI5 YpagkoZQNqkXsbW8Rxk3AieNb0QYHCnbB8yR+Q6u15VHlBjrcknXXtx1pzUmRVVNqUcKTGP5mMeF 4ihcEsjknx+yQO3KrUQggVZbXiEiademmKwy5By3Or3Q0yjUW1Hfvb6L35uSWx01RSIuDS0/rFeN X3ApHcjQ6mw7W4m0nVgRRnilVJfEs1fNGaOKs23IQkdx2v8AC447bpKsDtpOu70GKlQ5ugp6QRgb 5Yl8tpO5JA+HFCjCIBosceUtc00nNiCOck+WWUSR7dLnx8O/hxgHCZpYpc4Ckn/WpvLdt5BYDeRq SAe/Nd4IwqyQUqANZI82eeVUSK2t3Ww0tp4csxcAjDbV3mziYrrEq7D6hTviW4G53tqdfbfioKBT BNFXfFONJrDcRkaYpTtuVSxVL30uTfXjJUsmEmkbzvhxwFKk1bRtFIE8xXBJZe4axuOLgsgTNFrj syBSpwmGOYJcBl+0z2Pfx+7lkKPCkK1EbaV8MetKkRs8N9RewN7+PFCkiYnCmFE40rolHktOx2SJ ZChHck6G3HmG9AKemi1xR1V1Ur5akqBd77iO/e/hxUpJUJp9AicKC3FflKmepo5htaY217fC9x8O VRIwpHcOFIwoAMXyhUVGJzw0c4aWxcPGbMhQ7la3fv2PKtskHCiC7ckY0af07YpLSZhbLmPOaVca G6CW1gtQLbdosdCQbjh5l7wmDxoG5gnHUNlDlmTKxw2ux+MDyzhMqYxSSEX26ssugt7wHvD6ePKb 66Ly7KhOyovWCeH+qeOS4Gvn/wAwihxOKmAuJZEpwsikHv5ljcfHgY3uYLlspI6KOslKg4OFa9vU iqauzFjq4ZR/LVVHUutVhDkrJEtt1gD9pfEcwyz3IlNuLIiCZiBOyfPpPV7KnrK3ypOJ4UGUeYnC COdNgU7bE3Ot/wCFtTwPLyRaVlaeET1fL09pxo5U7A86sK/Da6h5xyh6oumEWXa5hR43XR0ldTgk hoyCxNrm1vbyX+yi6davEISqFCBEzx2bdmJw/Wo37RrZDlopWyK+jRjgxPNXSyfCKaq8jFK/Dokg qOxErRhgT9fM07ux1LWBgVTUFpuT+XTPDn3Vx6GVuLUGSIsPzQwnxjC5Ww+SQgE2TS97ePELli53 SArbGPoa3kt5iueml9iSUcssk/kIJJB9pEBY2PwHFtqtaU6ZOFPv2rKnNUCah/MG3ZvsbLX8N1uO Qef30p7qv//XpT6r56UYrJiDqBT3IRNQCfoNuYNZy0/cP6BtOzh5YnaMfl11NyrgW7Oo0XOoxenx /EI6ujjG7exKlRfUEez2fDgw3SbuGSGjEHq9cRGPrPTNA++fDhUoc8+2jedEvTF1B66YRj9RlXBW qaPCIXqJq8Kdq2U3Fz7PHkis7jP37CiECU4zpGHPJpIjOEMRjE9dEbz7k7F8m5ixfCMWgaHEMOme CqUC5GzTxJGthbgEDyW1FtUeDD7R084T6ijsQsCDNMNHXSVFPLQTx+bFMpWUyKQNbX9hH0eHG3NA XrQPHEjZ5RM7OERW0LIURw8+ecaUWBVwwnGMMSsjJjonE8W9r3AGlrDXUd+ILsF5rwjFWGAiDtn8 MKU27qW5x2e/8KyZm6q1VRiFY0tXdQfKSMHTXSwB9nstxrLdzykBATKlTjgMT57OHRHAdJQ9mPeO SrZ0dX40KvpQNPmXqfQ5hmglipstSRTU6FdpqaurrEoYEUvqdWZvoB5NO5uUm2JJ+6B1ET6fP02G g/mV2CkgHZzt2c7a2P8AFK2fLYwiinfzHwZZsSxeNDe80tPJMRp/huFN/wDDyTVKAI1bRQfbSOFY cQgGCU1UEtU4oMPM9K0akiGFm8gEWvd3fQW7AfHjVwo6SE8aXMHxCKLf1TqaxRkvLUUbJFHSjGcU CXKzOyCxLA6hVXS/t4QZs4U6UihJkiZKjO2kNTU2GUuB1RCb5qiWloZZl90BWZ5iia37IoP08LdS UonAn40NbNbi1JAGFCrlqiWWKkxSnJFOzGKaLwRo9NPp8OKEDUAaES/CI40OtJVQSYe8ke1ZVeBR 5nfad24/ToOO6gTIpy3WoCKfKJpFTzZX91g20Ht7uvGULIBNOVkjQSt5m267QQoJvuJ04lSnxEnb StCicBTwKTy0DFbSSG5t4afTrxtKzqgUuKwU004rL5FPUSEl3hVpW2d9qjd8eKFAHbtpG+6EkRiK RsdbV1Ece2IqJtsiXv2b3reGvKgqAgDCkankTjgabMSoZ6xvKZCLruZVAsPvt7ePhrUJApQl4JET xoNcxULU8rxRU92jJTbbcbnw05tTfh2U0FScTTUaR6CmaZ1+XeUHYrkWA79wb8qpvQjHbWkKKnNk igjxCqk+alkD7Ct3JPc29lvo4gS2IJwNHgUCKh0OJVLecYwRAQGMzhrn2/a8L+znhamJHGm3tIEG k7mPMcUFTIZv3RYJr3H8eaUuPZVm50ipeDYw08ESzHcSPNmfvYH8782EGBhhFFVy748DBqXi+c6T BoKUsoCsSG3Gx73Itxtb2mOnypmVKV11ywnO8dbAkg9x597Ib2Gw3t3+HLodXwpXbg7RspG5kzpH GapC9twK71J947Ta2tuVBUR5U68ClINOXQ7O9ViuSMOpnlXZQk0RUdgUdlvc28BzdspxKfOeqqXT ie8CuNCli2ZmpESNJgAl91tBb2nmwudmylDZKttJOLHYj70rFb/pND33flfjqTApFdqAJjbXVFme BqiaFpLuSQGvcHWw7c8hQV92yiuSBhsptxjOSwAwxqQWP2iTpbwseeeJwFGFu6Tj0UnHzls8uLar JIpEnbQA+INxyyF6FYUolRxNSMKx0Gq8wMBFZjckAhreAvx1LcY4Uw/dkiFU712OSTKkSPvHZnB1 FxfS38OPlQ2iiVTgAqZhkk8KySLdWurXBPbvoBe3LKMEUmW5qgdNCXhtRJtjkFnU+8wIuO/jx9Co FIiJVBoQMEjWRWljHlvC1yoNgQbX7ceZPinYabfWQSDsoRoMOaRDJCLHaCQfe0Gtx7Pv4Ytr10n0 4zSqpaVZKNpG1ce5ax7i3HQ2Imi17wqkCkziFS0IVEAZpC8W46nQ/wBvLrUIGFbCyROygVzhWT0z mso22zxH9NCR7rgaHvxCsqB1UnU4TSHfEocRehxTCZr4kjGGWP8AfWNyCdB3VW78UW70wR60F7xK gTRkumFAmYZYMShcR4thEq4lTqD3aEEsF+Hu68P7ZSVjVx5540GLowcRRmuouImRa/Eo0EclbQpN EFGnmCnUkWPFZXhjsoqEio/TzD8NxbL+HzY/PHDT06hjLU6AK5Isd2nhxI+ppCZcMJpVaaiuBVYP rd9Pj5jz7S5k6Q5TGNVtYHjxmgw4MXmtorIYra+HIE38yy2uXj3CQVHHDq9nR7JxxqWd2LtbSYWc BVYebemGecBxj+S4zkqsy7iRUH5DFoZY33aXI8wC/fvyL0NrSdAQCOiI98iPP0woa/nEKTIM0YP0 i43jnSP1FdNcWx/CKijGG4jCtQk0L2EcxC7gbe0jgt3YYVZXaFlOlcicPM4GPnQM3reQ9aEavTk1 9LTpDm2hzj09yljlHJvStoqeRjruU+WL6H6OZpXBC4WnEKE1A+W3CVNlJ2pNLDBHCVmLlSEUy7jb sWIt955e8SClPlTeWghaopQNUEyjetyt2Fxex7cL9EbKNzJNYbP30/xd/jb7ub1Cq95jsr//0Nff qhR1E1PEse+Vu0cUQuTfTXv7RbmH2Urd77WvYriAcMJiAOGHT01M28ABRon40ksF6aZqE1HiFJEa WGQe/wCef8TXYkd/17ckNrLHiEqICZGwmTj18x7aAOvDCrqPS96p8F9OvSjFMpTwKcQxeJkq549o 3lwb6jkkbu72XFk042kSFUT39olageiq+eomYsr5vzhmDO+K4fEtJXzPOsfukE2sB4+Hw5FG8IbQ 7qUBrUTAMx8428BQmy16GoJhKaKDnjFMvPLUVeH7Imvuj8plCWU2Nxcnx4kTlBbGomVGMOGPAccB 7evA04vMNezCOeRSbwWspsfaOUMVeILE8bkA7WUj227+zhfmLC7YEoMaeOHTzs6MTS63OvA8OZpG 1fSjFv6yO1TWuuGTt59LAG277kMAWBsACB7b8ETe+rDdocAXEiNuyPj59YIxk0gO7rzj4Hv8/f8A u6qsV9J2TUwPPWRUqJPnHnxWlrmhQACQxSWiW3YKt9Pp47uTvYu6u0IjwxI9vph6eu2l+c7ri3tV KJ8VXPHEKfMdTmysLtPWVVZNhNMEa6L5NQaFj3sQ7HTk7BcydtR2G4iOilPmrEoqevzFJvJipVgp KPb9kxQ1LIV1P+JS3Etw+ACRSq3aKiOiiw4lLimaMQq6uGBK2ZIKvDIFqJGRI6WlKGSZDE6/5O4U X0JGoI4UPArk8Y66EVk4ANsUj0nokxKlweOqinlpCsku1xtEso7d/AC1+EC1yQCdlSDlY8Grnzof MFVYII8PiHl0sRJRDYku2pZiTwyS/GBwo7aUCJOJpY0MjU8kQX9IjkKY2JF7n4HmgoelaESRxpZ1 uNYfR4d5zk3VlhjiA953bQKPaeMPvicK0lRmg5rusmAQT1eHwUM8s2HqZKysVozGAL7QoJ1JINvo 5QvgThVmn1jERULC+t0GKwVVQ9FNFh1LfdM/lrI4UfZVQfz4lS+qJIgTVn7opjEEmkpinqbyfKrU mHlaFk3R4oJSPOIUFdit2Op1txledISrwDGk3dOKUCo4UFtT1qp8RrK7D8LneCqhkaqkrJZQnlxO 3udyABbw55OaKWfF4aqppoSRiRUil651qO1PX1aS6BRWQHcH9ml9Pr4oTfKjwmfdV0rb/iEGlfhW fhibCSoliVZNxTzHQOxHsBa/c8WMOuR4iMa088xhpVNN+YcV+cnl2OXQbY4th0Y2uSL+A9vKrKgo 4bTSy2ugEYRNBjiEQSZzLKskhtakAsG1+nmw43JFbTcqUrCk7U5tp5qo4XDGtP5a7VYWt7mp8fbx MbkleyjBBSGyqcaCzN2LUsczK0m6R7FnPbW3tt2+HPKPiwxFN/mjpxrlh2ZqWCmVEbazAOwGv2b6 HW9+WWSBFFq8VTNBxmPHmzPj+H4VSO0cc8iKWDDQG5YnXTQcSIb1q4888mn0JUkSTz5UMc/y+AZf WhBYOimdZLEEg3A+r2cU3AA2cK1alSjqnCi954zDMkck0cukg2Nc3C6X5YOYCacfIOw0ofTbjk4y 1Chm8wTyVDszOG94yN2P8OJWVw0CcMOvZw93TTjiCpwTQzY9iywMY66Rgs4MFwbAAm/5gc8hcEdd GanCkCMAKRuKZotFamcxICIvdN22otvgdeKAV7MKJHiJnbSfpcx1ctRTbXYAtd2QXJW97d+WQPPH nopOslOynHFsdqHaOchmTdtJNr69tATx9RMVdDqQIptwyuSUuZC4dTdVYf63fTjiE44093xIiacq OnxieqWWnRjAuika38D348bUxgabWZSZpf4RgGOVAiZhKjXDKGA+7TjyLRR20SuuAHhQs0WBYmix SzhiHGwxsSDe9+bW0TTCXUmRsoScOwiUopCa2ViHvY66AW8eKUM+lUVS3wX/AEecQTReUWPdidNP pvbjKgccaspkadQONCplqphM0dGzkk+773b3hp7OK7RycKSPJhMilM0NRhExD60tS1oze9idbX+H DBUDDhRc4gL86DnGZWirArJuiDsUfwHt8eNFeMVQRBTxoLc8PQs0BFlVmHm2FiptbwvobcoXQVDr pAtogHGgPzFAmUqqTFqRi9LVFZkUdoyxubW8CRbXjaiGiVcKJHP2ggGDRx+iMYrqXLuM4VUBY8cd aWnA+yhqUkppFa3sOv18EGXKAbBBoLXaVKUekUIGasdkr6dMRXclJMlNCq692i8qS1/AG3H3JjGi kETtoffSx0nf1DYtljpUanyIMaqno6qpjNpRTwI0wYG/gO3KOZQi+ZU24rSmNtaF2phzUgSeHnVg GC/hq9R/T5n2mzPhaf5wcnR1Hmzwuu+phjDaEd7gcjnJ9z7jK77vrdQcb/oq6ONCW9z5x21KHUwY 2irHc4ehT03epDLuF4rmzIlLFiqRhZpxAizRSra+tgwN+CK53Qy1b6Xw1oO2BgPUUWWGZvOW5SF4 jkU+5S/Dl9MGVqfBxU5DosZq8EUR09diVPC8hVW3KCzKTpxfmWQ2Fzcpe7qFJA49HVXmEPBooWvV JoxkeWsFwIPQYBQRYbhtMFip6OjTy0RVXQC3YckC1uFd2kHhQecsEIKijjQdYdmSnwrGcyUFTOiR Um2qZiewI9pPgBrw0KO9Bj+HH3UR2r2hfuovmZPXZ0LyfjFXguNZigWopmJcLMqFbeFvp5GWa9oe V2rndrXiKFFvY3CxKRIpH/8ADlPp43W/ncFt/wAlfzh2233d/bpwj/2X8m/pmJ6udtLv5PedFf/R pZxzPGVKWRZUpo94UhJCASNL+Gv5chG1y+3YlWAP7zj10NLjMFOqOOykBjHV2nw0SwsyxtGgmjEZ VrBlDizJca34ZC9ZEhREjrPEDoB6eE8cNtFRbWvpFBTNm3Ouc55IcJoZniLCFZWDKgIN/tPa9r+H s4Gcx3jYQklakpAOPix/QTwiYxp1NipRlIJpXZsyviUmB4PgdfjsdJM6mWrRCSzSM2vY6fUeAF/f FD10FgeFOqMSRtjE7Pl6GjU5QpSAiYJ28xSH/wBnCrxOKGaXHHMbhWA90BmGpbv3P3fDvwvf7Y2r c+FsSJjGYHRx/EbMQKWNblulUlUc9fPrQh0fRfCclYaK2KXzJEKeb5lydD4/D4cB932mOZk8gFAH qT04+frOyhZaZKGUlRONNuPRyVNIyUt0no7yQuL322H+LXhnk5QHQVEY4ElXV0Y7MYw86rf6u7IH DGh79OmdK6lzZlaaypU4XI8/zDAEiUwsqE6XJQm4768ljcVSUXQShIgAmdpM9JjgJjE4UT53dF2z JKsTVsmRMREeD4HJTKY1XFLyhm+2kMwmBLG9zcj6+T2gBKQJ2mo1IM4VBzlmI4hh9PFAwC1EJppv KO5mlLzsxBF9dzHiO9cDkCaU2Y8U7KTebfJy7kBMM3NT4tiGF0OAQVdPpJtFOKqdhbxZnJJ8TxvN ne6ZAjaMaN8rY751UbZoDcs4Y0eIfzKW0KVEyjD4VuLU/l7EHvWJPiSfE8DwYTpEbDUo2KwMJx40 ZvB3rPMhijce6hEe/UN9J04+VLDkGjJtkDEClhTV9VHiEUU9ODFcB5ozpfX7uP6serzqoUoCm3qP X1i4E0eHEQeQPmqirk+0qs2wbbX11OvhxPcK0p1UmAkwaJzmSbBlwmnwn+vP8oxfHY6StqYPLJDx hrKrsBpce3w4nBZMauHumi26u1gQkbKK71RzNimU5KTC6PMhxGlSRp2lw+Q7ndidwFje1vDiDMbp qACRGzkfOmrdYB1Y7ONF4Xq/HiWNwYHSwvTPUzxq1RVsxcBX2n3lsBqOJkoSHQkQevUPnt4bCeiK Zuc1cUmTw6aCnE+s+Y6vGW+SxH5aeuqZaOd5XIiCJIwFypPs4juLUrdcUsnRsBBI9n44/IqbZ1SW wo7IBjzoRMI6s10VOs02Yw1RGUXy4XUlm3Bf3mbS2uvEthmOhZJBKRHGSI8uBjht6QZjVzeBxM7K XdH1YOH4kktRI9bTwATyzGXzAVY7rkX0sfZw+czlLSoABB6+evaRsNIENBRGkwTQu5e9VuH0NHFT VA+d3uRFSNN+kRN2pTde30HipWcNJZ1K+2fXnr2dFPPBQOBxrPmT1BQ4lNDU4NKZQGXzYTo6p4qb 3N/jxQm6YUJBHtpTb3f9I40HS9WlxCpaJK7ypqgsnn7j4W93U+3TiFm6bWdKSNvy9KPGb1KMTUyt zhejeeuqN1RuFOVNhopA8e2nHCpttMrwMwYk8/rxpS893gGnZUFs7JDShxMqbz7ouCNB8fHTj351 kAQYkdPvpKRjs2U59NZzmHHhi1Q2xadwqbjYFwSdtr+z6eNZaoOanAB0Ye75fAVQqGoAGhuzbmUP RU1MjBVYyNKx/eA0UXNu2unFBcUoyTh50sQkJmKASsjSvWoj/wAsl2LBvYDa3jxWAnTjjSdxBUTN Lfpa1Nl7LFMrqKdy5mRAQCQ7knsdBbiFaCGgD93nOPnVrVyVCTSpzfmAVdHFOHOyFlkkRlsQCoA9 vt4zbtmerCjp6NO3bQU4vmeOksX90N+652jX8+3hxSsBMGQPPn30SKBBiZmnjAsxQT0jWW7jUWNt B7b8Utjr2c840xIMkHClrUV0VNJT0uJD9LpJON1ypYbgut+w78UrWEkADbSUY4jAUoIJkmNPNRU4 EMSHzGFtlr9ydOWSZVsq6XEpnHGlfh2bMKoZPlvm42mX3XePVL2ta9/DnhcpBgU2VlYJoQ6fqHT4 Z5ctkZAoAIAIAve36nmnL1aQTtwpG0ylXhNCJTdUsu1tIS2xZWJUFCDYn89bcTKzPUnrqjlnpVgZ FN1B1gwqnqxRrV+a0QM0pU3VI07lydAOOou3As4YVpXdx4jjQr4R1Qy9mKKMSGOmkN3gZiNRcLof jy384RrhYiqi1UBgRS+w7EIEmSqpKmOUkgqqML6nx18OL7d9BghVJ3ZxnbQsQYxTYxhMRmkWSRLu BfVXQErw41AxSA4KMUjcbkp5qaN3jINrvIvcH4c0pQIIIov0krwoAeoGHOJ/NppHmjmTy2sFXS1z bU6j6OFzzQUZ5+NKC5MhQoLcv47S45THLuIwif5+Y4ZA0gACbjZSPr4ttVB1GlYoKX7ZZcJTQyen 6srMpnO+C4hVulNlyVMdw0TEgwhi0VxceLj8uLbJJRqSdgojzEA+IfxUYLNVPLP0sy/jcMhVqx1m pYQbkU8sgOtv+I8PHkgtidpxoPOYLwqxH8KGF6z1IZZmjdYqXDKKqxCVGF/sU8kGnsuXtxXYtAhf +LSFbhbcSrhNbSsWNReXLG6gshuTob3/AC40qxMgijlN54caY4HjppZZqNfJ84tLJHHtG6/b6eL1 oKhCqLCkpJKMK4Nic8jNG8hVQLCwA08Bra3Li0SBgK2LtUYnCoAImLEAMzAbttzftxQfDXlmcKoM /E09Ref+hOa8fTJ0LvLiOFSskcRN7hdt7La4F+BXffeK6smld0JCkj4Vbd3Km7l0BXTWpFmfrpmf MGJ1mMY9jM9TiWJSPNPJNI27czXIF/Ac5/7w5pdPvqWkRHXxx8+fWsocryK3aYA0imf/ADlVuzf/ ADCX/J+d9pb/AOU2W78AX5l/+kdvSdnT5/vjhR3/ACtn+jX/0tU/Ca/POaqg02EwiamrHXbLUjaV I0HvNqBrc20PxtyBb7MbezSsvqE7YBMnrx2Tx2T0UdKbdcUkIBBPz9BsG0eyrq/Sl+Ed1V6pZag6 kZqVMOyqENbLjOL3EEcK+8Sqrt32+OnHGsnv71gFLehuJ1SqTPE488I4+dzm2ZcDZMr6Bs9aLr6l csZc6M9Q6zJeT8xDG6DCUtNWIFQGQaGyxjQfDXkObyZEwi7CEu6wBjjx6vYI2iRwperOnNGCfSil YviFdj1VBXiRmmhN5HZgdBr4X+jia3Si3QUKHhIjoP6840pya7W45JGNGNwHEp6vAqZonvLGguLi 1xb6e3IizC0CLgkif1/ePWpTcWVIBFJPM2ZcUhCQSLvRm95W1Fhbh9keU26hrSfEOvy+M02q/UU6 YwoOK7PlIMdpcOmRI1kPlEqQDYkG/fgts93T+WUtJ+7zwj9eeNJn76VRpo4vp56EZ/zJjmN5uy3h UmI5ZwSjqcRrpKUbzBHtIaVz2VUBPJk7L233Uk6STsJ8idvR0RJGHlQN3pfaaMHAK2VYBj9TS4Fl DLdHhRUtUw4cYqiWRo5EapEta5ZXsNxTyx3015Nl2CNAThFAy3GpXtpMYwsOXMXyhSrUBo6qOFIw WJv8vTTz1FvDc3GHUgOiD0RSpo6kknhTl1YxKFDgdLIivLMiYbSAkEtJFCF8CLALESTxLmr5LmBw ijjKkkJ4Y8aBPLBzNmbNxxKpgWhwGjlipIXvsiBEYAVQftEAXNhwuZQ4sEnDoodZYEtjpNHNoKdY IIPKdJJgu3eSFv3P09uXSsIPlQjYBOwU9vHFTRxrGxmOjOVIJLE3N/v5cEcDXn8MYiioeqfrU+Sa HCcr4BHHJjeNOIqlp/eURKhYi3wsNOI7q/ROkDDmOGFE9whyJqvLFOsGI0UdXR4tQRVNfXLsOISF Q/vqCNptoFFhbw4HLjOkNgJ0nH4dPlw2bcDFJW7ZwGRhQAZozHWYtVpWxATqpC/LTe77wB1FgRf7 uFr14m4UlSYETBkzPREYfgeqqOJMkK2UG9VgWZ62sXGsHhC1ULJ/owAVlQMWvcXvY+z7uKstCyoq 0zHXiOsYCBztEVaWVp0qThPPXQdY/g2J1ZnRsKakrWaVHeEsCTuL/v6C/jqRxe4hQegpwwIMmNk7 fw/UOMtgJA0yBw4fifjSNjwnMXmQlWlijVfOChwVLhrjdcdgT4a+HFwu2VJIUJSOmROOAx64x2D0 otvbHSCYxB6Bhhzx6K44dmHN+XVlqxWBDK6uyykPob+JvYAL7L8VLZbCxpETMxyPjjs2VRq3WUJC kEHq2eyBP48KdYsxYbW3xHMuKLhdTUpK9GtKJQz2sqkKiMO7eJF+GVhlLaGSVKJT0+Imfw4T0eZo qvbx7BARiDx6OOPDypOYZ1MxillTza1pljfZBLTXMjox0BFwbfTY/dxCqwbMkEzidp6Inp9NhGM4 g0bpdQ3ioRsGO3V1CCNnHjj51IfO1fNUtPTVrUoZSshpyQSNxJ7BfEX7cZatO7wxEx04xx4SIj4E RS62WhSZCT0iY/XmNtCxhvUusxWGNqqdzLQ0/wCliZoxvkjA/SEm2hW308LswZcVBMqjpmIHpExi R74oztTpQBG0/OnakzrUYtOlNBMXdWEKU0DK+r3WzNY63Hs7fklUNZ0GdOzHAHbsw6DhOBGA2Vu5 aLZB9/6c4+8yOTc0LlmielrHWmnhtJPAWUMrEbyWGtjrw2buO4b0rOKRs6efjXrREqkTTpinUAYi 9FEKgtHXMz0YBvuRXKsTa9rkePKNXYUtKeKsfQcerq4noo2QyoSY2UZzI2VqOrwunrZYlf5mP/Iu q2W9x4214IEgEdHPM0XrIoPerOCV2TsJFXhcyuI9GpoCCUVRqDt8beHEN+VNpkYkedUS/tgYUAeX eqUGP4eYmZlsQrrIQdVF+5Jta3bhS1fQRrMT0Yz7pHwoyUIEHnnppqzti3zmGJHSFTV7y8QRvCMb 9ewH08VXCg4ISQDtx6tvOz0oqcVsMYUkum3UCrSerXEJ1qIqFBJEEZQWcyAKWJ+yB3Jt/HifLrkN ggzPCZ47B0AdFIby4AOwidvPPXQk4p1ayvh9OJ6rEmxnEmZglNE/6IPpe7W3N9C8Mbi+CI0gk4YD r2Ts+dNPOqgBCeeemkzF6isVq4ninKUuHOTSpCtkhjUiwN7i59l+eF8oHxJOHX64D5+2OKS4aWlQ wk1jHVqWWTzMPeWpgH2mWMrY7SdC20W08OJXM2bggIJ08x5iqF9aR4hS+wnrZjE1ItHJhsmIRShY YIhEVk3Ebh73a/025vvLlyQlBjh149OznaNlFysyQkSRz+FCtk6LEszV0Zq2ly3Szkg/MTRxqbk3 JL+H3cMxlhw1Y+vPwpl3PjpkTTP1BloenWF40iV02IU+JWpqnHqadDHFTpIJJFTUn3iBck9hbjbq lW4wEiY9J8qRqv0XChAg0FuW/Uph2GtBQYbVmrETjypcSmLsI1F73Og0Ph4cKL29bQkfszpOE/qc Ts8zBG2jRpLxxxjn50bHJHXynr5KarwTE3xOv3rHW0srNaIHVmUi5YD2cOrFDamwpHPupF/MHJ0q GHXR4+lnVqHGtsLhqctYmOay3a2oN/vGvDq0dJI6KbffhAMY0O9W0skT20IvIi6WAJ9nDFSFCeit MrCTNAd1C+Yio5kgnMG5hJErmx3WNypF/DiNxqRjTodBOygGyRJPm6SSljiakxuhihqVcNtM03zH mq62A7KliOK8tZlzroNZw4IIIoxuYK+HD4M0tEoSpzTHVYTNJEBeKCEvUKxP/LyQKOG7qkgyONBj SVACNlCBjWaayPp3kHDaYG0FRT4fIpN/0MrM2mnwA4qee0hIB9KLEoOo1aX+E1WpW9ZMFxOnfbSS yYlhU99GCyB1TTw98C3BBkolLigOFEl8UkpSrCSPbWznHJJ74kcqwJ8099b6k246pI4UYoVhBryv 7rgMFY3sR4qB8eeIxFbkRXB1MhDFRqBtKWPsPLJVFNOpBFQ452pZRu9yIEMGH71vDw4+psLHXSZT mjbsqmP8RjpPW9ROouT5sPohUipgqKaYILqyFTuX8vHge3iypx9SB/DGNK938xCHFHorXS9R34ZG YsY/mecOldV5NdRh2rcr1AsrOhO7ZY6EnkSZz2KG4aLtqoEyZHHp99S1lm/nd4OJkdIqsf8AzAdd f95/6k1nm/N/1M2W1+c/3pt9Gz3r+zmO/wDsa5lMdwue807TtiY9mPzoc/25s+nCJ2c8eFf/09fD BJcHwDGcEoXWOnppKiBaqRDYLFvXcdNPs35hDkTLl9dIU+olsEE7fl1fh1UPleBJ0YGtif1N/ig5 Zw30l5L6FdDtuFViUcVBiFfRW3MgTa7Ej2205kr2qdoNsu0Rb22BCQInoHUNnTUU2eTPJuCte0k1 rT4zjlfjWNVuJYjVSVE0zP5s8pYksSdWLD4e3mNqFvBGsCSYx8uj2fjQjaCCohRwHPzqJgIkmqqi IXSnsVO69hbXvflc4ul9ygccY249PT7KMN3SE3OGNGPyY8VNhqwF7tL7oAYg69/ZyKc7dWXivbs2 zjPs5NTK3JTBqbJlOvzDisGG4bRtWVFUbU8UY3Xv48UZMH3XkoR9x2Rz07T8qSOnSrZtobMG9DVJ XVEWOZgxp2r4/Lq2pICVWE/a2HwP18ybyDd9SLYNuqBOBwnDy/cJo4s8iU6nV01bd6J8x9Pug+WO p3T3OYmmwbqNg9Vk9MWpEVpaWSpGwk6eKm3wvfks9nztvYqWkjwr6Kjrf7dG8cUhSRq0maKVnTEg 2IVuHoq1iYXVS10DLe2/yWpaVbaHbZb/AFcV3bmtRIxg0FkWa24nCaasfnircbyVXVkqpDRUb1cs DMCRUVSlHuBroDa3x4kAlwEnYKeaUQFig46oYycxZmShpJGQ4ZT1NDTBCAxb3Y1k+tmbiJ1WtSoN GeVjQBNNWU8UxDHsUocHw+Q4fRZfX5Z6xxdRJFYSN7CxbjLrThOkYUOcrKQdXTRwKhKagho0pKqS pluiPVO1ybrckD6eWTZBI2zQlau1wOFSVxCr8yMREiMqTPWSG4XbYk6/DigoTt2UnvXFEkHZVbvX HEP5hm2bGK6b5nzGpqjD/bDEkctQUa/70iyAkfRwtSooC+Mn91E7oK1gDgKKRj0dNmau3Ru0Kq5a CkYC3ui2ptYfVwF3bX5hz12bR54SJ8h1HqdEA7eTTBUZXxKKcpLCyyREFdpG1lsde3s+ni5yycCU J2npJI4HAYfqNmNNJCVKifWhMy30+xMRCoQt+nG8qhf3e+hv7eCXL8tU2mQeHpHJ6aoEJKo4ChI/ qbgdLh61OLmOWYhnBcAbD2t8R7eGy52GnmxqV4RSSrMvZPqF3QeTCVu7lCgAFx4D+jjCdBEiJx9/ 402q20nxHCgfznkzI9XG8VK0BnDIHdFXQAEnQD2X4R3aWA6E6wk8Bh648NleQMZxj1otuaclYIsd OafEUWmpi0VPJJJ7wdmZm93wFz7O3s54XzzQAnVO0iZ6eoY7BOHXjVe7K1qOmT5cKCvEskVFFVfK M8TFoxVrU00kUzEuN4UvCWANrEBtQfYeGjWZOaJK9OHTsHAkDZ1jbhidlJ3WGSCoCIwOEeuPrzsS r4XPg15HoUqZHilozPMZrxsbAOFpzH769xe48SD34+m/UdqpBGGJOMbRs20hu0LShRB9eqNmOz0j j1zJwyasi2CP3HqF2IUP+UR+4t4i4F/bxPf27ugajABmCTHADhhOzy2mjmzvkFICjhhwOHIw/DZQ v5KrBQ0mID5cSYjXmH5TEJXX9G6uQXWxJFtx8fHvwieU5iNUYQACZHn7oxGEYgUcPW4KgQrATw91 POK47jOG4itPIi1lRIRUr5tz5sYsVN9SQ+3vfwtxOw06SDMCBMYbCTIwJxPRjShoJUnDp9h/Sh76 WZMxvMWIHNOLkrK6n5WEE+XHGbGyqLC1/aOG9ta6HCvGTJxO0+ydnkPfShCllvQBjzjR8MPxKqwv CaXDo6cyPHTJOdgIZpZ5Lx2tYWAGtvbwQLuiR1UkFnrWTOyg96g4tNQZUmw7EbTVakMjz/auzam5 B9vEi3VJbwxgbJidtaeZAOGNVX5sxTEsl5nq0eF6KDEyuI06U8jeUFlT7W1ARrb6r9hwvVl63QEy mQBwM8OPwAxPuorVmKGn9KjI8p47J2/u27KiHqBiUuGIfmHDMHUO8m42C7vtITbU9/y4WMZee8CV EeLaOmTtx8vMnaYpy6uG4lOIgcPl6Uh06h4jTf6LXTucPdm+YhUsSynvYIxude/3+HD9rLHFKUEr JI4asP3jb07caDN1mDP3/aesYnoA5+ZrvFOqdJSS09TlrBBQrRoyiorW84m6/atZSdexIv4W4cu5 QuQFLHVHnPRjPlHQaCg3gQVKQpRPtHy93XtqI3VXFcVl31soTabKkC7FbWxO2wWxuP234yuwUZBV OrpMRGzYBj0cRwM0pts6QkJOkx7PQTt4+W3DCplJ1kxDDZI4BK00ccYV6YhVuELD91L29uv1d7l9 ru+5JWVRJ6TxPVEyZwjhV73MmpISMZw9kk4+zZ5ml/UepfMEWD0VJRbIKh7tJBTQAGNF13CQya/H QfDhk5ZkspQVAGIjo8o4nDnEEZuUpEwfWfww6pj8Uf8A58881sJZqiTcy7y8rEbCHKgdxfUjW9z8 PGreVBJBKyUjhPRJmTxHT5cMaWqumnI0tkwPKesdXyxGzHhS9Zs2tT4lQ1s71OG1dPKqiRiQZlK9 gqj8gO+nx05lh0JUqceGPmeHvjpw2mmWFlR1JTBHAfE9XT6UmBDW0FVLV0Aeane00Il3Hy76C4Y/ UT35VSVOpKVq0xgZ6OierEjhBkGhJbNurxmQfSJ4Hb88eHSYnpFnPGcs4vh9R84UpJJEpqwoW2hW XVht0Go8Rwr/ADyWicYJM9Mjow4jqH6vPWQKeOA9vnO2OJq2bpP1UypmSbDJqKvjwmoRbVkMxZBL KpZFPvf4iRpw5t3y5iDz7qKS6ANJ21YD/WKXEMuwVAlDzxwo8+w2uVB1+vh5cueETTNmSV6eFIDG q6XEqOnpyPmWlciPS5Yldqrbid1Z0+Hbz00blkBUGg2yBV4RgmYaXGYX+TxDBS8U9NIbp5Lblfad fe96/HrF5JIUcDzzwoLZylRkDEULWLbsQpsKVVVoq+gSWplXSzTP5va3gqG/x4ZPgkhXRQcDsJPR Qh16UdVHhcUdYvy9Usdfg0jC28aVEVgPYDwzV4ox2iiVZA2cKt3/AAbaOmps5Zo/nj+XU1awSYcx ZREJ42kqTa/tKgC3BJkLmhtwbSaDucI1uIxgJNbK6SozNIHuu7S40PcHX2cuUEYUvQsK2VzTaEdy AGF1CrfX6O3NKxp9ER0VnDX2FbBlJT6joAbDXlCKqFAAU1zqkizIAGJW+nhp8RxW2ogg0neSFJI4 0T2TBp8Z6qrhGYEFTR0TTT4VLLoQrg+7rbtwztnll9WsAwmiNboaiDE1XF658ST025iqc2Q3OVsY P+lIqgGGR/pHa/fkM7557eZJch9BlpW0TxqQ8gZTdtBHGqy/9orA/mPn/wCWxW+Y/wA4NvLX/I/L fy3zO3t4E/8AZOc16tP8Wv8A3nTQi/lKekbY55iv/9TV1XG6rMWPzNDLdGkCR7dQiKAbkEDvf7uY oCxXl1mkERtnrInj1R1efGpCYUhWpRxPPswoXK6snpaGnglmO6MaAa62uO1/bwGBxTzmpUQTOB6O k48OHDqoK5i/CjQZVVZKJXO/YWJLG1ydfZf+nggt2VKEEiAeJET7DMeWyemiO5ulBMJwNL3JGH1m J1S0dDZ6up3Kl2UfZUuxJI8AD8fDhXfWjt28EBIUoz7scfL04Uf7ro0uhRMUq8Nxiuo635GcmNoZ DGdp0a2lhbgczXLElkOpgbRtHy2c+syWq5VBPPTzFH16P1MGBYTU53qkWRsOCrTtLtsdxNzcjQAD hv2dgstuOrEEEgeXH34elGljlQfugOG2lFQesnJUuL4tg9dWRU81TdGqH0uVIHYXPhoeStlmYKfS pR+3p4c4cYofuW4tkjVs540OWE9U8BqaOCTDZYa6nkX5x6mUq32tSwIt24L7O/Uk6eHxpDf5ai5Q VzTJnqiiwfLuIYy8xGPYtLTVZpYgTsYRSPAmp77XDEfHXh9cK0Nj+kdvrUL5oz3lxpTsFFvzlm+S mzjgkdTJ8taOFahorMC5KyWOo7EEHX288VkOEHYRQc/LgT607YxjUCV2YcQZoY6+lTEVqGqO5ShL AbVHjI20jjiUomTgTt59lVYUUiKeOi6zVeA0Uqqs0WMbVmaTvFE2+RhcWF2ZdTxpyAjqnZztod5M 3ik8AKNhgjfN0VGzTrHeLy3i7bfLvfXv+7xq3xTjxoTvpIM0oqrD618A8kwtGKiFpHVbAiNtdfq8 OKxwnZSW6SJOO2q1M2wU2Y80ZolrpUFAmM1LJKBcGKCBYlFwb2XaAALa34Q3IbWNJAIB2YGi5lso BVxNBJQ5JNdiFTV0lOTS+bujKLYDaRa/EaMrSo+IAAGRhER5fCP1o46BiNtL/FcCgpYEkmUF1G/e ug04fhJKcefKtsdIFAjnb1EYDkaJMLp2E9Q0R2GBkJBF1NwTe3x4jbu3HHNLQn1nnZ+MUYIt0SVE x8/dRZcb6vZ5zpKlLhO+jo5iVhOl5HPawbw8TpbiNdq66stuqAJOAB+MDZ0z07NkpXbxtGIgRj6c 7KCzEM4SUnmpiecqiosxgnagIRRtIvbcLk6204utsrQgpCUDZMbf1OOEjZ6yUC88kYgAbZM8/PhQ Y471Ew+krzAlbUYhSyWeQCUJdRqSfdI972/x4otMjfdcJgAg8YPpsnjjhgqY20UXu87TcEGTBk4x IwA/D3VFr854BidNTxpWyQOLF5ZGKraR1O0bdSBraw8dPZwzcyt+Up0JgefymBjEbejrSjPWMFpV JmIxnzxA9+3DhjTfheLVEtUpVw0MZsaNgnvFXFxeQDaQBcXA+njb1ohKcfCYOIMYeUScdsbejoft btbriilZOnp24+RhXDHGlV/WvD5k+Xqo2ikqCxWKU21t23AG+h1/P4B9eVuhX7OFAHqPkcPds2Hp mjA3jMDXIOzEc4czUasxqWrlNXNiHzZp4I6SjnEpkCxxEFVGpuBY/Di11bxKQqfCI+cTBjy6OPCn QGEohJAMz6niYj12ULXT7DabNNAKeaUrWO2xZgE2glh7zAgi4HtJ/jwhXaPd4U4Y9PnGziMTOz2Q aOLPMAClQOHr0emBozeVOneGYri4qq4rVVcKx0K1Nrh1iQQ2Xce1hpxLY2yi4dWKZJ6uEdBw6R+8 4YUAI4TMUcjKmGUmAUcVFJTIKRQRcLa1z8PZw3FyG0wIjojD3cKNFpJEp20s6rFqYzrPFCrQ0qLG gUW3MtlHh8eOjMB1c/CmG2SlOO0mi6dVMbgxSCrkjs7i6lRot1F7XAv304juboKQdhw49G0z6fpS N1oJ8+carA6l09RNVPPVvvjIenTy2X3UVgNrEbvAacVZQ5pIbTA/i4z6Ye2PQ8STZlYBcySOnDq6 xQE1GJTYeHhkcQO3mCJYVRhsbU3A+DDVgSR7OC+1swVDUAR0npHn07cDM4dQjvNcyU0ShRx+IOAH p5/DBJefUGRAO5HnbkupDEhSV8zcTfvodeLG3XdRx4+e3pj2dA6KD762nsVmUq6SfTbxwjj0yZrJ Og3xsk0aSQgKpYRgAjb3DX18b2788txTkahKTOPp0xz8PNttIX9wHERPv9OvjsrNE6RNA8rNGjbm V3C2K9wTtGumpHs8ObYbURA4EcfaIGO3pxMdIrzaQk7ZwxiY8+A48MR51NoKeGap/TxyEH32aQIC QQGv75ta30cbDKgjDSMeMwImQOfI0a2RaUuColOMYdPT1+ezYaVslNhtSIFedoGQtTiJgu0xi3YE dyPG3fhM68+iUgbfTH49PpgScaEbNvZqIBUJjEHDz2YfDgcOC3wfD8BqVhpUqGkEiveSZVuEOhF2 I0JGp1+HElxcK7zUqMOvAxsg/HjjjhRkbZgDgdOAEk9PmerHDppa0OUcMlQKZVbaAu07XupXXQXH e2ttD9XGkvLWf4QJM7OMRHunbhTakIBwEY/up0xLLVRSYfGsMRMMKmJhGL2sQdft3t4G+h4kulkn GDEwokgEe75RJmrpbQ4TBxPM8P3VCXCMUw+NHpPNam8shkuCdWv7pIAPs78S3rGoiQmfQngNuBiP eNlJQ+CCCRI+Q5j50ZrLM1amVpK8E0VZh4iDhNHIVNysLkeOnK2rjjTeocT6bJ4e3A+6i1bSFY9P GreeimMYnmHp9gFVXaS4jSwxvcqX81VI2m1xoPz5IDC1KbE8aKWvC9hjS/xWmagSkVS0T0cyThl0 s20sNfDjdwiOuhEgapmgNwump8RzBVyFjTyUMMuJ1NH4NGTsRvadzkacpZNGcaCuaI0g0NWB4tPj UWHUpYQQ10UslPcg+WMNpmTa1r3B84m3t4fNkupBHxoGOwknjT/V4vTjJuE0tITU4hhGF0dfQzqQ X8uNURkBt3Nhfi1TidAFFq0QrGjs+nnrtJ0zzjSJgsvlR4eYqqqIJXa80AW4I72PEdxcutuakKgi l7WRd+yTV73R/wDETwCWtosrdRUNHVuEalxKYMIpUckqyvax04hy/tOtU3H5e8GhfA8DRHcZBcNJ KkYgVZjlXPWW854bFiGBYlHW08qiS0bhrX17XP8ADkmNhDiAttQUg8RRci6AMHA0sZNiBTtOxhYk C1j4XvyiZNKOG2mubF8Lw92NbWRU4VSv6VkX7QvpuPFAtXFjAUjcvUJnGibZ7zRRVPVjKEWCYjHL IZ2Ws8hg1l1004ZhSk3KEzwM0TvDWgqjyqmz8b/qClDRdPen0VX/AL8M5ViRT2YaQIdze3XTmP8A 9RV/3Fk20NqyBGw4mKkLs8CnHDPCarN/qlhtvl7m39W/6vdx3v8ANfffkNd0er7OeHPRQ673z29H ONf/1dYXpphqwGWaWNjIFXe8gsTZRbta4HfmI+/eYq1BO3Vw/cR59dD14Qgjn30I2LxGVoFEdyTY ve9vE+3gIsn8TAjoA29G0UDrxrxSdtIerwwtO0hWx1CMVtcA6D7N/wCHBLa3ZKDwnbwBA6zx2UVO WmpWIgxgeNL7KazYPTyVojbc4KoSCSCNDf4/Xy6WHdv8MTsOBI9ntPoKFu7zYQmTE7OZxp082KRT XyKUma7l5Li+oJ/t4F0d44otzh0dOHnOPVwxOyRK1s8jaRBodMTxvMOG9FJWo3Ip5vPjdluNygbh qO3fuOCzK7NwWQKcAVbOonHb19XsqQ9xlJVcknaKIzlnLVbj+N3l3o0x81wxkNvf1tvB73Go/hyV MuR3kBKYRjEn4Y+nWMOujrea41KwP76sb6MZdOAYxl/CKmqY4BUMHxZJ3YIlNGjOQb6kXFgPG/DO yahwBUkJnnnhQVvrp1q3JScTRnM25sosxYJXz4hK8PztWaOjlgWxuQsD7raa2VF9mvDtawEYjjUZ uoUlcgzIM0V7qhBLLmKCowpQy06rO6ubtbezvu0Ov7vETtye8OkREddMW2WqKDNO2eYJ/mKzGFJk p6+IYTU7CNK2piCqwv3s0bMeLVAJUVHYaJbIGdGnGaHLpFlvEMq5SocImiaWeqFNVUk5BtEqKEsR 4XB05u9eGnT1eypMye0IIkxRgsK8yindJom0Y1AYhipBOtu/18QIf8OzGjm7TEUJUuaIjgdVUSv8 vHDvp5aiVTa4X7KAey44rFynRJoM3WrVpFVN5hxXDMv1eK1VVHLjlRBLPej1igUySF1v3Lmw14Qp uG0EqGMc7Ko+28rZgKYcp9UY6qrCTJ8pTqCdhAjRTa9rAez28V2N6XkatiennZ60x+WTqgmY55FA t1x6yJh2H4nTYfI9RVVIMFOsDkBdxI3bhYWF79/r4XLui+ooQIj+KejHDHGdn7qE1ratIAI56vXk VX0+E5yzDXz1qYXPiMsJaVZoo2YPc7kJG0gePc2J14LGmkhEBJiADBxw2iZg49GMYDoAeBeXcSRC OE9PV5e3Gs+PZa6m+dRzVWFVWHiBGigdRLZEIAG1Rex+k+Phx1m3ZZVOGJBxwGPSSdvI6yp/Lrm5 1I1BM9Xs8547NlBZiuS8zUdXAIIqiqkWPdIWV2uWsD2Iuo7gE8OrDM2nZSB6ienoIjHy2nCaCGbb svW6NSQFjHaP19Z+FJZ8pZjnmbbh88nkNqRGzkkm2m0WIJvxw5k2TIVIIx4RGHnhx8+iif8AllyS kaSNuGOHHHo9P3yf6rYnSGNTh8zq7NHKWWUCzkDsVXbYHW17cWtX2MKVh7z8DzBiqKsbsrTqTier ZjG0SI+WyaVUHTzMVHS3MTRMU8xo4ARZQtlPcE3te97fTwsvswaWso0fHoJ2Tx6+qjvLMiu4SpKs fLj7fTZIxqFBhGPUSNTV+GSPDte5csSSoPjpYkjhU4UBzA44cOqIxjAcejpwo6thdaTrRA8uHMna DUykoYfmmVFl3SEKsNUCqBhZ1ZS6tewPt7fTzbj4A8KYHE449U8PeTxg7HrayEqE6So9Ezh0YHDr iMNtDR0ey/mOmzVRRxRyNS16GSaOEEqUF2DAHULpbtfhbmBRcNEiFQRM4YYcB0+oPpR1ldm+ysgq CgfWDxqzTpTgkK4hsmpH8yP9KFYFb3AGnftwMZe3p1CDt44zh7fb5UN0sKIA484VYFljpvQVtLBK 1LcSKDYjQsw1sfHh6ywhSINVl1tUUINV0lwmmpUlTDo90f6VXKXCkENfX4/nyztsgp2c8+tNLLip xwop3VfpLSxUkyYXQwySVAKz1DXDqA26wt+fC4pRqAgdcx7NlJFJIMEmqqetHTubAqbFHqKcoyB2 3DayruUeII7ezvxOpJZXhgJ6zgI6JAn3caSKcGsTz1c/rVfeYKeSWvkVlZvLBWOxAASy9tzW8ew1 5JWWupSwCITBHEkzxxj28B11Dm8bxN4vwCRxg9XQPlicBSfgpJy/kzDYsaiIRkSENruu4tbT6Prv xWb5MgpMgzsOPRA8+Ozo2UX27K0zIx24zhHUIw9p2cAKzTUyUzFpZCZGYbvI0FgAbLuA7+Nz9fE7 i+84RwxBHnOO3Dhh76cQ02gg/ck8Ns+yevHA1JaOq8lpaWmZuzNJbf5aFrhQbahh2P580zblagCA AOGzp2zhhxHzmlbpU2J0YdPE9Xw/CKYw9QY5ghZdt2kWMsilSB4i2t9NR9HDFoeMaRM9BOG0xH64 0iXduKnjM8Dj7scJk9NSanFqtFWWRnaABk3OCzXbTVWHwt3PGEMtkREziBww9SZ9lXbvFqBAxOAG GwD0n48cOIdsNxa708+1y8W/9Ku0btSVFiQBY9+/GbhkwIMSRs6Bw2xPu4mlIuyRK8COAnjxgfDh 5UssOzDi+Gz0tRTVbvHoPlAWKqHW1tCLHxt+2/Cd1gBSkqA2ROIn2cOv0HhFHNtn7qBB8Q4kjE+X DYDzgB+yPnSrxgRCu/SBT/pGy3cKqgEm4sQL2/bwiukuWixB8I6ztngPYOA90iQKbcblOB9vPxod J4BPQxVMDxNt1dG1QC/7pS9j7OJ76FsatUEydMiejAjn30TafGZEDnbU7BzNJhZq433p5y00tIqv YoLnVRob9j4cIbRtWjWrpHCRx288aUd8EmrVPSpmX+sOTqumUB/kK6WsowgIurwhitiB21I+HJKs 3ytqQMPxpEoJLvVRg8wLIqwxV8JL11REUlVSQLuDYn/iI7c29qiAMaN2iScKBAYYuE52nkqj5DVw joZXJKgxzOVTxsNvE7D6Ukg0R5uySk06ZOxqnhhzjVLIHpKPzMNwpb33QyJaUqfa7C31cOWrj9mS MJoA3CZIBpPYPm3fiOFUkyELtq6aeIA7YYdnnqWvoOwA55VypEHhSm3YC1EDbQW5q9Rz4bmiDB8t 1by11aIZ8TlBJ8h9u0KLW+yBwGZ1m7qYA+XtxOzrE1LmRZajuimMBzAre19F3pc6d9QfRj6fqzqR gEWJZjxnLdJjVbiUy3nVqvfOnvE390MByXBlFk9bIbeZS5AG0e3Gses7D/5xxbbhSMfL2UK2Gemn H+ldf/MOnuPTxYdG36LDJnZowg9lzYfQeGeW7u21oP8AI1qQP6JMjyFBt+5eX/dBPXQlZo65JkLK tZX5ygNJUUEbs1RH9jei99b2F+/Dq8Ui2bLjuECeo1VhS1gAHCtVH1Rfil9SswdUcwUeSsbanwDD qh6OGSNyBJtNtD7NeYcb8dsd+u6X3TmhKTgIjo49c4VImU5C1pGpM1y9KXrA6j5n6lU+J5gr3kpK c+fLUSuTZje3L9l/aXmFxmQUtUieJH48ecKXZtkTIYlKcaQn4inU+Xq/1+6TSyV4qzg8MsjRXJVS WUA2vww7d95E3eZ2yQQTMn0FGe42UltlxWygK/zgzfOeZuHl/wA//kttw/yPyPl/8rcg3/ZCRrjT h3vd+mmdk7Jwj12UMP5Hhs/hn31//9bW8yRRx0+BpU77iUbruFFge2igDtzBveq/Ll1oASY4xt49 XHhFD25SnGcOfWnSsczzptNltdVDW9ovZj4+3iVCFIalUTw6udnTOFBi4TqUI41GNH+lDPcBLu6G 2ttb2A8bcbtrkEQIKj0/u56cK2uzLiwAcMOiljS06yUaxhVsh0VrEXOvYC1r8Nc0zfuLJLUDVJxG B+ER54n0mh1lOUSZnn289FYKzCvPhSCCX3m0RR2NyO4sfb4cC7F/3cFQERtjp+Pp8aE7TBEgUY2u oIKbo1T4XK1/k0kDSfuswXdqQD99uS9lDiX8vB0gJE/PpFD7cpkhats0VjpvAPmiqxbTHJsSS5LM LnuZDcd+DrIUo0qgDUBx2+zr6ePHZRtvNay8CD+nsqwLDMOho8uCtRllqUiCyNoLWPYX1+nlnL3D ZB56qLXmNSQKSmH43HiVdV5U8/5enooosYo5lIN6uOfznU/TfQce/PFzwngBz7qDbmU6FFUfupTx ZWp62WoxqZNTIYzEBfdupyDcf8SblAoISVRx56aaXbA4Clxh2WosenwiatCiCBhURU1hs3r+8f8A WNzcni5i7K0jVtjZ8aLGcqCXZijN4NDTQIqGKNmYtHtI0DRCw0t4W4/q6hHGhUy2FI6KFTL9Ph1S 1NNUJ57lXjjXt3sSbAEd+LEkDAjAUmfRI24imHM2HPLE1FSxxyIkr1PlPYXYk66d+/C55xZMbaTM 2qTjxNEH6pdOquor635TCjvq2NXO0Ngm5Qddfp9nCuVd5iBHnxpW4ykpwMnyoCH6V1dHE9RNhiTz VKi9OTfX6EB4rcfT3ekgGen2bP1ouasQXASTWfBfTTgmccbgrM0SpT00LhYsPpxaNWtcXLan6/Hi hq0YWolcHhHOPy9lKnWsNKdlHCyl0DydhNL/AKNh0EjGysrquu3QX9vBSwhqYmTSC5lMQIAptzd0 gy5LS10MmFxTObv5cca6XN9DxY7aoUmKYZdUnacKLxP0ay8s7S1mDRwxMpRZNqhu+2/b9vEqUobn SAJ6BHlTroBOONIdelGC4dNNFSZbVYGaRvNdRtfw3dueZcUNoEmnPyzagJ/WmWo6R0AXShpo0RGI eYAaXvYaHT8uGKWiYCiI9tFjtqlKpA2mk1V5Bw2WeOGCiWRacgmUR2BF+31eHKPW4WJIkbKaUSSZ MTQY5g6U0mJSPUrTCBlDhCoH7xIsT37d7cTOZWwGwkEJxnDn0jYK8m5cb8IwGBpnk6IYRiOFwUVP AvzDkjzQxLbjYk3sbH224X37S9P7MAR1YbOMY+/icOi6bhS1kn4cKF/pT0rGVMW2yMJoYVK07Ncn 3jcgafqeEjjXdgnSIjbGP7qPcqZS44knb+Hxo8mSMm0nnQVdRDtL2Yta1hY/Ad9PDm0FRM8IoTrQ Z8NHZybRUkMEUXl+YIk2ogF9u49xxcgbANlNtMKg9JpZ1+Gb6dvLk2JKbASX+zbXi5tvAU0U6Ds2 0AebsAo2hcOPmB7yyr2FwNDpbhS+wmcBjRdeoUFTVVPqkwHyaKaCmgDNOy7kuFNgdfD268Svkd2q YgRtk+WzaZ+NE1yyScTs4xVVuZchzTVjS0kBSaa8DSMVZmBU2N9dRbS48NBwwyjOzqAQkHbwIG3Y f0nr6aBuZ5S24oqkA9QBw9o5664Q9HKuoBxGoQuJl86dbgliVtcX18fv7cPE3jjhECABtMn1+3Ye nHDExRSjJmNeKjJwMjjEfDZjA6zT0/QaOskp0aWRGAWNWdnYMAFFiWDjX4ccuLm6aXoGmVdAIjbh 7PaKW/ym0SjBMc87CKfj0PxKDCpIwizQhZIF9+M6gBQQLX7Eakf2Nqt3UKCylJ2dPqI4TE9c7Kuc rt1+EDCIxHI6fPjsFI6v9O2a0RvKkhMKIrNsFrMALBSoIBNtRw5Q8SiDp27PFx6ZHs9MOgMO7swu QoHHoidsdM87KRlb0LzhRzRedSRvHFulY0zKXVSg0vYBRp31+PNP3Cu7JXBjH0HTBx2QOj4so3bu SnwweGPnjgfcNh9KTH+bLHcPaczUbQMWLLG5ilIjIJuRtA1JA/p4kXmzenCADgduJHOwe6lzG6Tx b8R9sbffMelYY8i5phWFUp6iRiu0ogspYkIo+xa1h7fu7FtjM2yCsJBMnETtgn2z0g48YrashcYA SlQnEyMerYRhgeG3o41PSnx/KjQVFdBNS7mbcHcDdqDt0X2G/h+3jGYNtPJEgSOBBwjiBgBPJ20/ Yd9bKJH2kjo2ThM7IGAHTxoxGWc3VWKYZR0VHDJK4ssoWUOVO3duu1jY3PccCN0lTWtBKUjhgeGE bBhjEceFHTjaHU6ydonZ7qHfKOF4uMCnLxfpATVvKVG4mxbsnc3078etWlBkAaSnaOHSdgEzSVek q6uemj2+iivxjK2MNhuLo9XRY5THEoCij3Z1XygmnawPjw3yd95KTqAIJmZPVtn2033DSlykxVjt ThddLT1OMToX2mM01E9z5al9xI0+0bWvw6UknaKN1FIGFBV1Hy6lVTO8DhWxGRa2mYaFHG0BSbC3 EyLbT4hhNE2YuTh0UXLNlPPkrKdRhUaBnE0EkTwEllbc51I9pUW4quf2beGI9aBJT3znQa5w0OJT 4VPXRFlixilmrKWIhbruQ6rYd9DbjJWSMY2cMaOLK2IVHQaJDhGCj/OkaWN/0+JyIcQgqArtEWJG m8mxPfQX/PgCzgRcp0gSDiTPmeocOvhsqYcrttVseEc8Bz7q3qOiH4iSdL+mOTcnYjEPlcr4PQYF RqxWyxU9IiDtb2ckS17V7dlAbdZkjiKx4zLch5b6lpWcSa5Y7+MjljC2mjmKrGpaztYWPwvxv/Zx s0mCx5baRf7HNyUyVGKJD6mfxSMrdTci47hdHVLD81TyxrsIUXZT7PHhXvV2ysXlgtCU6ZBpXY7k OtLE9NUFZFwiq6h5wpcGw5w9VijtO7AksQDcn3hbmH2XZe7md33QAlWPGZGE4giOqeJih1d235ZG o8KtnyJ6csY6V4BDiGJV5p2xenlq6R4vcJ2LfUHmQeVdlFxlTSlqUEkifdQeRngeXpiqqMxZ/qoe ouM5nzJirVbYVLUU8Es762idlUDUaEjmNNxnjlzmSlOYrAUE4kbJAE8AeO3galCys0ItQRhO2gO/ 2lqDfbzdP5pf7Tf5Ty73+ngZ/sJext/4Jt/inb+v7qVfzRmf954V/9fXOytAIcKVASyqNjLckgW0 8eYG7yrm5IwM+g6en9KHlwQQDpgU8Q0t5RNptvdCzG1tddb8RC7OgJBx6MdmM+XkPSiYJKl4DAms eJ09cstNL5G2lq9YpZAwD20JGt+LcucS0FKUmT1gxjxmRztNCi2ykrIUBhSmoYzFAI5QRJG2x919 GuLj3tdOB/MnlvOnUMces8+tDm2ZDTcAY0p8JpCKtZJBZVO5L7rE6Ad+El6+lOAHt/fz76YSozMU PKQLP06npmN97VEwRybk3IHb2X5kL2fW6jlKAdonbt47aHW6Kj3iqKX05p0hzHNSBQ5ErQsCxLBj JYHsO/fTT4cHWRLX3UKAOBMgz1Rtmes0LN5GSp4KI/CrMaTLgky7FtQDykCKT7bdz9fGnmQozNER KZiMaL+cmSnOmHVFJI3nRSMCEJVW01vY6g8XWLaXMTiR6c+tN5i2lKJIwowGWIPMqvkqtQAspZwD YC6lSfj25WNqejzoNPkIIUKFL+r38op6Sv3XFTI/lx/4QBuHjoNOKmLfSNR2++qtuBa4inSjjaQH zKgx3JlVwexJufvPNJUNvCj0JhIkYU6PnA4TSSLDUFWUyFY5CLm1tdeXfuQQccKZXbgrwTSYpc34 viVT8yXbyydqbiQLe3XiJCiBqq7yEpEAUhc54njTyySLVB1XcWWEjS/b26/Twte1KI1GRSq1YQEz ppKYDguZMfhkXD1ZV0earqRYKW1IQEa/w4rYy5x1MJwAqwS22QCNtCsen4pKChp0qRSsh86eaZ/f eT7W4/fpw6TZtoSNStnTRfdYkwPZSKejzPh0sq4XXS1wkdlbyCXtYnxJ48xb46kUlU4lRAUAB106 PmDNWGUskNdhiuXXWSZizWHt47+YfScdh40wqyZcOBoPajPWDUK3xjbPUu29FAKrYm5Ht46zdhGC sTVLjLlLTCcBSax7rBk0AfM0yUtNEDECWAJufp0vflnc9YSkd4oAD2003lDgAxxoGsd9RnT6ksIs M86TZtjWH3iQSF0t8f6eJ07yIIBTsInnnqoxOQrJMqoLavrUuMNImHYRUQlZVX5Ex2YoD7x7i3bl ms7WtJGgnq2YdOMenTw6AjucqQggyMeP7qz4di4zA00a0VRSVTNsKyCyOWF7e5cXA04vTe65lJkc 9PPCi120TPCPh7aFXJuTsQqpFilgMHy4vCJL6g6g3blVkhOyKctrAHYPM0NFDkppZaepCiFYLpOS QxNtSRqQfbwtU2FklWzoxoSsMpaSIGNDxgFJHGqUzS3Mto12dlAW19Lcq2Bs4UsZSV4xRg8t4pFS rCpAaHy0gge+pKLZiT8TxYtaSISKsWlaqV1ZW/MrsiYpB4lbE37m38OL2VYRTLzccKB/MEsaxSKr 20be4a1tPG3GH2wFVRxkqTJFEA684HTYnh8rRgySPvkaTUXN/D4cRhA1wAMaJb9GkGiVRZEEbpUN ZmJ3gzE3H7tweWs7ZLKyrjJ6cB5TFBC/sy4kwOFZ5MMpKaWWLy1aKDbTJe4DMT3BGovw3Q7sVx4c fiaLrWzAGIqTTUlLHUidlDizXs2m9beHw4qbzAKxwgc88yZDL5TgKWeExZfxPy6aZ7RuVjm10HvC /b6eK28wQ4qZ52dPTT6LBR2DhQly9MMCnpGGH1pcopdF3k3sNL66duaCm1QRFFzmsE6xh5UwnpOF /wBJdGcVS2dbkkbTpb2XB15RbJ0wBhz6024tJTECaZm6GQCsSqMXnKhvHHJqFB1Nv6bco1a+GJ44 dXRWu/S4iIj50tMF6IZe3xs1OiFQCIgACo2272FvZblw2lERzzjSVxJnFM41Dzn0NyTj9G9DJRxt MlzEkliQ23vf6+N3CypJSrZ0VZDEA4YGiL410QxTJuORPhFTJDD73mRNIxj1uRtUg2tbXgRzJhSw AQk9Bx9kzidIMSfWafZYQkGEAbOGHuPPRQyZZwnNWEYaKyupBUUkZVRPAWZVMhNgbX/hxuzS8lGq MMOJO3h6Dj17MMU7zRSvD2UbLpBijZc/qziNPOGq8QrWBgTwG33gAfC54bocCSJOPPRNb/JkjZFW aYNmOnzFgREyfIVMlkmSUWu3a4t+zh/aq1Jk7a0lBBwxpqzJk04hkvE8PMpnrquGrmp5UupJpoWl G3xGpH38ecaBTAxotv2wIVFEyyXm6hzZlt6nHqL5DFsMajxMTM24mOnpzE511uxN/pHEqsxQpsg4 HZRAcsW2sEfbwp4w/G4psRwWip6cVOAzTPHh1cCVMYIbdC2ngpuOJlXKExPTQuyzLwQVcefbRJaP CJaDrxj9N5hKYVXiWBju1sQ9jc+APs8eAy4YS7fEzjtj0I568TwqTbFAFnITtqwPPfVPNdBLU0Ik YBUHlHUaFAR9m3Ii3mzx23cWNJO3gSOfL340AmbIKUeiig5qzNmDEpqhqisMoJa4DPtP0AgG30jk Z3+duKuJURA/xo9mHvoRs2Y7vSBQQw4nikkU0Es8haE7mTcxHfS97+3hiq7JKccCMNp2cNuzrxjz FImbMYyONXJ/hCdFMN6r9VJsz5lrBDDhSPQ00DEFST3J3E66W5kt9P8AuMxc3IeWQAkYdJ99RV2i 5w4lPdpTR9vxYOo9N0Uq8p5Uy/XiMrRz06/Ln3rMgHh24K/qA3k/Jw0hWJEe3p+dBbcqzL6ytWA2 1rK41jk2PwT/ADHupOzSMzsAbsxJOnMFWEG2dCgSSeM/DHDo8qlS7zVIGkUEP9WMNv8A5If71fOX 3P3ta/8Ab/fwa/2ic9I69nRt6f3xRT/NT0dXP4V//9DXLyXd8MqYag7ZobAk638PD28wO3raDT40 Dwn1jH44deFSJ3IW2Zw6KFfJGWmzbmfCsvhxDT1RMldV2sY0W5JNye/bld37Np26SFK8J6h0Seod FUs7LUCeIqZ1yrcLwvNdHlfCAjUOBxLTrJEBbd4m1v28EO8BbuFKDYGluAI54dNCjLlFsUnsBRqh VKtoWvYC/hb28jHNJSSFbaN3blKoxpfxQmMW2gBB7zGwJ0va/YcDBWD60oSlOnHkc+lDBluaLEMl zw7Q9RC8lNGygHZclvC3MnOzVr/hVpBxST8Tx40Ktz7n9qQcBRZsAopML6kKhCrEs7SbmUbjuZSd bA3PBxkaEIeXH3Y/jAxjj6TjjQ5z1YU0DOM+6rOqeeaPAtkEQEXlLNK51NrDudfq4muyoYiiK3YS cSaBPM+Y4stYjT4lEFaWEtKUIGoK27+Hfnra50p/Xr8/0rd1Z98giabOm3VCizJm6ohgIWqppY6l qd7e8kjbLgaePFVndd4sxgRw5JoL3FkpLJBxPTR186usWE5fdSI1lMryhf3SFAOtvjw/uQSgYTRb laYVQaV1bPUBYI20jUKjx3AXW929vC9ZJPhFCplIKdu2pOA5fqcSrFSuJWKO5eoeylxft4fnxxu1 1IHQKTPLhenpoU5spZfFJDIst/LG56eEqB3t72vb6eUcSjUOilLCVE0y11Bl2FHipcOSpmjJJlls Y192+pb4cTruEJ+0SaO7PK1kyswKUOA0OJYmYY8GoFSnIHmVMke2KwNrC1rnhhauPnAU9cW9skRO NTqjJlfUzI9bMtTqQsQJVALG1724sRat6vEZNEy21aQEimDEMCxbD4jHRvBhcV3EYCbyQb/R48ee KuCoFImstQV+KVTRcc2ZZzXWvUPSZsMcxJC+coEd+5sND9XCNLKdU6zPHGjx6zZQj7KK3mrIWbdp NVjkSTK3+WjU2K3+n4881ZpSCNcDy/X4RRQ4IxSDQU1vR/FsQkSetzNHWo3uimqAGFu9gFFu45RG SNE6iokjpJPpt2dRnrmvIuCE7Ip9TprFTU6Rrh9JWFlCuyBAO9xrb28MylJAGBw6OHCmO4lYMmlN hPTipqazemGJA8xvLOhCgEfRa/t14uS6vHr48/hTblm2U7TI2UL+WumskdTHM0gj+VJUpIBaxF79 u/hflkK6NlFlzbpbSTQ8ZdwJaOmp6uZVlmD3U+LR9v3idQTxQtBCNnGk9s3JgcaUlFh4ArN9PsSZ m8st2CvqLeziJ4hKJO00flEACuLedRS00KoypITueO9wL/Txi2SnaqjS1RIw20JWB4mI2gpEj3Gk Tu9xqSSOLziMKabSZ8R20IMlVvihE48l2js21tdzWPx4pbxp4siMJpFZvwRlwxoYyY5KpSVdSL6i 5+IPPK0ERTRX4gaJr1CwWWPDhGzechQwhpNbAn+zvxOnSVSONFOagYqouVRhjRRlFjHuXBDi66Aj sByrh66JA0kpM7KRNTlda6QwTsymW0iPHa+4drAX46lIWCCcOfKit+2SgSBQQZhwXGcryBqOP/R0 ZnZKolo9rHWw73J7314Q3NsWyFfwD5nz9sY/EL0uhaQD7urnhTRhvUjGcIRXxLAkgiqCrbodQAxF jYX26WJueKDmpSsCJMT+HHDzPV00+WUfwqJMc7dtCNh3WGlYUyrUSUUxHmqz6KVvt7t37eH18cRn LRRMxPs8vj+6kq7NRBPAGhRwfqRitdCqQYhT1SG4Vn7jX6ra8OEX/AKHzpC/Yo4pINL7CcVzvUIG p/IqYr3ADD2cXFD2JBn4+lFymmRG0VJqcTznSVZlGBSmW4H6JdysB3+zr24nd7yPt56aqLdK4GrC lhQk5spkpKqFsLxIgedvXabkfuk6XHK973ifFgRT6bFSFyDI591JjMfSjE8Xw2ammiD1dIWXDq6I qystuz/HiJSZQUzE4TxFGHdJPiFNWRclZuwj/QsSiirKEtaaB1BuFNrEG3b4cJLa3dbMBRI9gjnj 7qduLVspG0UYrKvSXAKipixIu1JU0hd4qdLBIy53aBuHiG218MaSLaCB0ihubKueoKekGF1sFRQQ ukyttIZgPA8VIt3yNKTSJCWEnEQaFHKHzeI01VHi0xjxCISxRxICIxE5AIG72214aWzcnHbRPmDa RiDhVYXUagqsErc6YdhhEMsNRNh7KgABUT/Z8PDQ8I3kEzjRlZ26VhMzUfpfX1U09HSV1SyKkvzC QH7G9UKC3hfW3EKXgtQ6qESbJLbcikHmvD5sH635irpEa1WaSrKuFA/SKC3sP7v58Kn4F4qNsDDp HTt4emHTQwytKV2YCuFDhX9RsPOYKpMWp1aF/LtKoHYov1a25BG8O8aWL9xLqJR79g249fO2gZcW SZIBqXX0OSc0Ury4dIkNTKh+zYWN/ZpxJmmR2eYs95bQFbMPbiOHx9KYtHS0qF0XnEssy4VizJIg andtodRa9zoTb+nkfX1rcMNjvUQeev4YUct6FLw6aMZ6e/UfmD004nW1+AS+VT1hErxqdpDW7g6H Xg27Oe0G8y1+EGAfj+vs8qDO9m6iLsAgQRSf6wdbuoPq96l09VidWJJkUw0aTMzLGn7xOuvBpnNz e7w5gkpJKo+PHaQejq+AatrBvL7c6ttAv1e6UZo6SS4VDjTxVEGMo01HVUwsDt94qfYRfgR3n3Mu cqeCXhtG39OHVjQRcvAsEpmgR+ak23tpu3Xt/rWv9Phbhd3Tkcenh7efbVdQ6PjzPVX/0denN2HT 5axyOioqUzfMAfool731GgPMDcneVfWWtfDnp93uAmpizSySlUJodsiYFiOA0P8AOq6FqatmjLAs jKVXXS/e/It3izbW+G2zskTgOrbP7qPMty8NIw40X/ON6rGMTxOYGR5WKb+7dzci5HJNyBGllDYm Tt2YGfj503dJAJI2Utcp022ipwF99wW1vu117jga3ieR36gCYB4/v48zSW16aEhYGjhfd7xCXawv cnv4/DgQW8Avr59KNCsaQKWfT2uC0WJ0TCzMd6abdStr2uLnmTPY5cAtOIUMZn2jzx2fvo3yJ79t ExFBzXZemfOMdaIrrJMjykXFx5gJvt8SOS420lC1qMe751I93KmwKOfWZihy/liCCuLQzzqZfKA9 4pfS+vx14HsxI4cedtI7a31J2bKKR1HznSFHVS08kob3nZfZuNr27cROvNpQInxdHx5+NWeBxThF J/0iZPxjPHXinrKSQjB8LjkrcSKqCGQEEI1h2BIt7Df48O8qtkxOIEbI29M+scT76Ir94Kb0jbxq 0/q55+HSYPAfcheSaOIjt+6fD6OGhOG3Cg9Yp0KIoJ8OxFElCGoDyMweGOwuXGtzfjISdJwoTJcg CBSixTMrUtNTUdKxeqldQdqg7pGIsvu/fxq7UUtgA88/vp2zYS4sq4CnuHEJY6UxYhK0NEzJHKbP vllY/wCqe1+w4iFrtmja1dSkykSaUXy1PJU0Iq13U8BPk07WO46XO0d9OHNnapSZNOuXqjPXQ1YT i0MUKg2p4nHuQJYbY7fD+ji90pAJoqT9/TTjFj+Bh4QqGd9xVVUW0At48bS4k7BNGCmXMBMCvVRw Sr/R1FNfzFMrpILlV3EDt7eN/nATGmnxYKkEGkNXZUy1USgLhYeLWbsbjTsSD+XLJQkqB01p5pek yaSuLdN8u1SbzgyOrnYN4B766DhilCdI8OzqoM3TBnwnEUD2KdMYxWSxYZhEMdMpuoK63+kjlC10 VZpICAVHGoFT0soBH5tVTiFolN0guNb3J0Pfjq2UADUKTouFEwg1Fo8o09HvanBaNbsryC5NvaeM aU6o4U+6lwCT7Kk4tKcHwyWtipXqC36PyYl95vMG3mlwEeHE7KLHE61FJONKnDopMVwuklZGomdQ BDIDcMSARe5725d5xITjtp61ZS2Zp4WTdURxmHYovTgm+lgPo7/HiFJKj4qVOQMZ2VJrqJR5M42n ZZVAXcddfE/d25YlOyaX5a8Ek9dLjKuG+dJHI9MYpipPm6kAi6gEEnipKxAkVZ14Fc8OilU9Iz19 OFXzXjezrYDQC3FTZVFGLRC0TMCkxmykqnjkidzBtVjHPcX3EW+m1+UeYMSTSBxxMUVnOtB5OHKP MEk0ymNfNFwWv3sbcs0gI86Dt+tayeigHXBlnmkDRm7eIUkEi/jx0L1c4UTtOgCJptGXjHN5s6bG g/SRqVLajt2I4wylMGVYmlBYmSnjTVi2WP57NEvlXEgO5tlttl+JP8eaLkfbwqrtmlCemgIzZ0qx CCPaKY1ET3YOEJP2r3JJ8DroOF15ZhzDbGz92zZh7OgUyBpJouOMZbrcCxMxNRMY1LPAVWUgWH2g CTr3uOEikaJSqYO3n48mjW1c1tkGZ9PZsrJ/N8Uw945MKomjnU7jEqBiBa3hrra97cRm41kkkgjC QPLbt4de3oinGG4T4jI9goWMqdZM5UpgCYDOQhHnRxKza67bXFr34rN/coTrSSqedoMYYcDO0TTa 8raUNP6frRmcp9ZM31KRJJleomFz5gljNwAePWmb3YH2mfSPPbONNoyBoqifZRlMr5wOMtHHieUp KSF9Xqp4SLHQG1hwwVmj2GpOHUKXI3bCAVBWIoT8JwXLtZUb6PEWp5ASTASwve+lifZ7OKGHGVHk fvrSbZ1CTKRSjOTKd55Gpk8x5ANrp3APjYXvxSmyM7aK3SdJBj2U3xCDBKySkxKA0TQuqx1v7kit oDddPpHG0u92o6xHXyaLnWyYKaFSHH6rBxT0wRZqarKimmv+iO8i1ifE8MUXJSRHGiYpSsnpFKik raSGeOpO2KqRTq3vAkgi2vjw4704HZRUpIKaph9SHVOHA+umfMrQy601eRVINwAlqIY59tx7A3t7 8jzOrhwPn9MTh14ber2Y0Iska7xoEDZzz7a4ZVzLUVMtO1Og8kNvaZDdxre+nt8ONC4U4AR9o47P nQytrIaeuhmznhnz2dMAx+oj3LiODUkczsNHemZo2N76ntxclRDwPVz5UssGwltSeANAH1m+dpc3 TLQhoaKWnppqeb3gq/o7NcWJ1Px5D2+f5Ju8+39orjHDjInj09FAO6W8p4gHCgmp8azXhzK9G0m0 BrBAxBFvHXXvwM27tugRsngevhIM8TtH67ftHlSUmefKstdn7Pc0hp62B41p2BVZozvNwCNNT2Ps 4tvrZDiUsvLJjGIE7J6Z9DsB2Vtlh0AFNNVdi+a69UWVCbm20re4BufH2cKWrCySolMAjgBzyYFe W9dAmaPt6LvSh6kutuZqPFemeVJJKdDtkramOQxsoNjYn9vJk7N9yrq5f763JCek889EVG2+G9LF ukociaOt6mfw5vV0cUykM94RGMvFvl4q2mG7yXcWa4uOw4Lt9+zPMbt1CnFSE9WEH1oB5VvLaupO nbz1U0f8M8518jzv64Qbf5X/AFr27BfZ8x5Hk2v9u+tvZrzf+wWJjWY9NkT7J4dNN/2iT/R/va// 0rrMA/BQ6JH1oQY3Jl+KTIWR8uU1T/Lpo90EuI1M7qrEHuVRPz5GOT9kdhZthCft4wI2zPVSz+0F yt0oKtnSfKix/jCelDoN0kynR02QcIpMIxyVGDQ0MaI29r2G1LE+3kXdteQ5FkuTlcftieMTHDo+ VCDdbMLl26UAZTWnh1DwKqweqqaSoWxWQsASRci+p8deQlupmYvQCkxhOH7x8z51I94QWjjTlkyZ 4aNDNZ3fTc2u3Xw3H7uJ95GitwwmPTjzzjXrUQMdlCa7H5SSVT79iUYE3F7C5CkcA6Dpdjn9KXKZ IB4CpOTI3kxKVLbrxtO7SG1kjBYn26cmLsuv+6zEJSCdQPPDpHypRl7hbdGrDGhFiwl6PGKfEHUG HzI5Y1c3N7g639p5kU+shRPPsqZEIStnA40InUiresiiokiWf9GHm0LEAiwX3fC3CVZUp2Pl+tN2 zEJkcaJ1XZGTFK6eGQncC0kECO4VQG08SPDj7dk2VHUI8h6DqMYjHZ0bDRZmSiKsW9DHTVcmUWac x1VOsRxV0oKN7AMyI29jr3uT38eCC10IaIHHy9KCd+74wBQqeo0lKHCK2CymGs8kkaDZKjLc2I7H jEq2Y0ntUkuUWjBlrJJYqlCA0rLFGApNmsQD+XGkqJUY59/RQkCQEAHZQiYfl+QTVlfXVO+eqstN SiwCE/vC57t+Q5Vx4YjiaolZAEDCnmLFUq5IohSFxRfooYUOs02hB7WsOWaWdUgGlwSUJEcaVGHV VPhjpLWH5ivYtGHb7K7j71r+A4Y69KIOJq/7RZw+0VKTGZZ6t5auXy6MDyqeGI7dwHx8eeYJgqUJ NUKSmAnbxpVYFigqvmJoaQo0YaNS1iAU+jTm1OFOJEGlS7cAglVPNNWV1XKJQNkkVr6afaI8eaZC zjjhS9L6W8DShoqyoCzrIq+WCbblsSP7eLW1HZsIpLdQogg1lC1c6rYaAs8aru961u/FSUwKK3QD trGkFOY2E0AEsrlnCdxp3ueXU4dm2k6rNWjCknXxUm9VkURxzFom0JIJNgDftyjqpABqiLJYM0m6 nD4aF5KV9YzcwBRbw+HL6Qgc+yk9wFq40nlo1lMpWEGNrwhTqBbsdOaJBEfGi9hg68eFKhsMijpK eFE1XYzMe97g+3id5SVHypalKiPOmnFKV4a2L9wJe4t9rcPp4keUUyRMUnQhxRk084FgyV28VDlS hDot+xva2p413UEniaUK1pNLbC8IkgrJTEWKljUSLc7bDQDUjTi1tlOkxVm0k4k0rvLpwHRqcpJJ fcRpYsL3v+fFCT60bMuaU4GkXj9LE1LCamcVAmOxAvYILG3034+TqImi1T51Emi45nwE41FJGARF HcoVJGinvp21HFCkaYnnn1opunTQY0WWGEggQtsjYqLAn4XtcHjalpCePnQfCCFEyKm4nlERPDsV i2m/zAVU6W0JJ014mUIUdsUeWCylBMjGmqPB5aWWCJU3XYRR/aII72PGu+k4U/dW2rEUtKfK9PiO HGOsgWN59AGHhfl2wVEikybTxTtpO4v0TwrFAJvk02rZQ9gNDrpbl0W/COv2VYtCZAplpPT3gImV UpkSSQbQzKCDr4ezXlFJGIFKAxCJiaUVD6esOo5v9GZZVi9+VSBoO9uJnm0E4GlASCJIoTqPp1Q4 dDGtPEgK7QRsF/y550ycJ+NOtMxt20sYKKWmSFfkYngQe8yqNwsOUK3UnppYGUacTjWKpTBKj9M9 IKWrjB8tyNrEDv7OPt6CMUxRZchxAASrCo1NUyVEckdNMUVP0qPuuy2J0NjxU214MP3UWXQiJ214 Y1hmOyfyDHY0gnnVn8+Qja222oNgfZxOX5VpWMKLLizVGtBpzlw6SOFKKKfz2iAaGJ2LI4Qfu6G3 Hu42QfSkJWFTNJdcxSUdQIKthFURs8zOWO14lUW1v3ubHi1FzhChFFNywdGGNUVeo6epf1EdXavz m31WLqKcIWBstJChIYnvuFhoeBfPVEmBs44COqTtoW7sW37AYYYzPmaXPT2fEqCjiqpH2RxgTO0j Ag31OpNr6m9+w08OB3u3y2XEExhgRPQJAHV0deANDVkoKgNvlzNHdwyoGNYZkt5ZfOUQVVEpfWwM iSWP1nh9avAlBVxpp8BvWU1D6lYFSYrjs0HlDfQwxUm4jvsQHS9r8xJ7T86V/OF6SQE4cPP9/lUd F1WrVQTYRhGH0Nc8VVCuyTS7DxPxJ/jwiYzRLxBUo7ej2cY4x7Oil7dxKYTtNIbMOB0+H1Uk1MBJ T7jIhS50P1/t4vtczJOnUQeYjHoijK0T4YNRMsYe+O5jy5gsKB/5nV09AUJuSJJQpAsfAHgvyOz7 64QjVgTjhtmJHI4UWZ3chq3UeImt/wC9BlN0w9M/pnosar6amoHp6cVVXM6orn9ED9o86N5RZ2+X ZI3PhSkSTWFeb97dZkVqxwgTsqsL1ufix5SzPijZaytEtXS4ZMzCop7MAUJtY+025jrvx2+JYBbY T4Z29PRUhbsblCNatpqtn/hyrPHsbZ5vlWv/AMiv+D/kLXkQ/wCzzff33Ts9239eOyhz/Ypnq2TX /9Pe2fE4aVKmvRUSsnhWOpnYC+2FWKm/wvw+NtOB2CiU3GklQ2nCtLT8TLqzjGdPUTmzCsXrWqcN wBvLoYibrdrkm17eHOUH1M7x3N7n62CToSf0EezH0joqZdxLVDVtrnE1Qh18y+1fNJitNFZCCXNh 3+m59nCrsszRtqGl4k+75eeFH7uqTGyiq4VjXyUxjqG2xxkBVubG2vw9nJwziwbdRqQNJM8B0/Dz 99KrA6cduFCbhGbaerjkR5goS4ZWKgk/AGwtwE3u76knUoeyPhhOHEefmYKukKOkUrssZnjw7F1n plNSX/0YwptAYuLFbEdteHu6AdZvW1AE48IE+fl6Rt2CkS3QDqwo7WHZehxhKGqZbQgKWkTsQGBs CDr25lNBcAFSfZZl+wAMEmmnqXhcdLFNVUhCTTBPPkIFyFGmjDw4mdYbQT10IbOVtgHhQA4PFHV4 nA5is4cl/M7liRpYE/dzbKtSurn3+2kuZNw2emrAel2Y1pMApcNLgNFdyFBvdjf4cUagQUio6cBC jwrh1pn/AJnlGvmNlFKYqhLf6sgN78TrkilTGrUDRe8r1LyshNvLkdEjve3uHU9jrxttEYjjwoRN qBSBQq4lJBTJHGHMlVPeJHbQg7bWGh1see2RwmnggqBNY6WFsLjetf3JYbvGzWIOhN/j7OGCQ2BE 4iqIQSZnCoSlDLTQzTvLMB5tY+6xvJZyAPr4pbaSVYmaMkPKKT1UssLwJquaKaQECIb4kJP2Ph/H ihbIwFUF0hAnChHy5Smigal8lhVTs0vlJcnZr3uB35ZSBpg00sBS9ROFLzDKTyxFJMnkLFcIDoFJ JJJt4nl2VwIrd0oKxFTq6SngV5UhJSfcwEfgNBf3fbxp4kKkbKftLdS5TNcMLq1q6fzJIfKjQlVb /Fr8f6eOpeGnzqt1aBtcTNQqzyZZH2S2O8BWj7HTW/w413mwTVu9hPVSTrDHReY0qb2c70Dm2twQ bX+7ihD2HlScy4Y2Uj6yqjqUTzkMs323Y6GxJ0725VD4J2VtVoUccKlwNFFMSiqibFCixBJ2/HjD j8cY/HnopGEU5SKPLZopgx3KzeW3YHwNjxlxaNAUDVS8Jgio1Qoecbk3W27Ta5ufD6B9PKOqUTSd akwOun6lacMhij8yQnbGugubdyfr49qAVJpMjScDStqJEoEijkTVwRUCMgjcQO4B14qYc1elK0kl OG31rPPioJCps3ViK8UK6MLAXv8AUPZxbAgwMKshJieNBLmmWSafyp4jS0b/AKCORW3Dt8AtueJP pW/y5KZ40lZlgghmgkl8+Jk8pdpOg7aW146sBYw2UQPoGqKDxpoKeRpIozbXZuDDQLf4+PGFmiy5 TpOPxpnkzHQywt5tSFlN1W7abVNzqfieJy8kilNpM9VPdCuHzyUjKQyyMojnNjZfHiRyIHRzzso4 aVHEUuaaBUeIizx3Ma+Fze/hxXbuiYmlCWtfiG3npp+gjSYxA6qWJLCw17ePHyRsqyWimZrHisUd E0BijX3B78mpPe+n5cRXJTTlnKiae8OmSWESiMo0mh0GttRcd+VbECacfbCcJpqrMTjoZmechYx7 lh2ue1r8aUdBB4fCn2khSYG2otRmOAOsCMCY7E27W+rnheJCpApsW+kE0i8azRTTKkYgCTM7U8TI Tdtyk3H3cUF/UnEbaTi1Mkg4UnaDG5qKspXVy0ZV1qYwe6rra/t4+y7sosvmwpMGnDNcEGK4dFiO FP5FbTjzor677H3l07k/x49espUBO2iy0eKD0g1myznIvTwR1jWaitGj7ibq3tPhbiVm5KRB4U0/ aAqwiTUTMiwVewNdNrKko3C3lSOCO35378MEnp4bONBl/BRFVr+sjp5UYb1Ip8z4EPlqXHqUVsip YI0qgK7lrGxOmvAnnIlwFOKlTOzke+eg0I8kfT3cKExhz07KDXpv/N8wRnDDAaeiHmDfKC28kWIV re9a2p41baSgNqxkHZEEdJgx7pO3iJESQls6gQThR0snYPPSZYwMSHzTTVU8I/d2ptjsfy8ePWNq O4KcJFJ76+WFk9IpaYlS4ditdWS01YgqZWMLC41sAtl1PMY95cmRd3jykkSokT6QYw6fWo6vSuQe AoHccwGoo8Yanrl8lZR5glQg7t2h0uPZyPf5etoeOQR0QTx4YYH184q7T7icRgDspzw/p3DmGnnp lmYkr7r7V3A/ST+fBBkeWpuVhaVkbOCR09B+G3bspe9my0ASBUnpZ09o8ndX8lz45JspIKxa1ZJU XafLu1ibnkm7sWDLOYNKUswCY2Cffwno91Ic5uy9aK6Yq5X1k+q56D05YFkXKGLMK3MUq0NQlG3v CHZdgLX8OZFdp+8zz9gm2tjJI5/dUP5LkqO/KlxAqvL08+hH1A+pKZMQy/luqpsEJMtRitWjW8Wu L+y/e/IHyfsYzfM1AwEg4ycemNnDE+vTNHGYb9WtkrQnGjb/APDSHUr5TzfmX8r/AJJvm2/6XfJ8 3t23+7fh1/0LNeR9/wDFHp08/pWv9kHhA2frX//U3aMbxKgocFqZMZxGOhjlQokbyAMxewCgE66n g2WEgY4DZJ5+FBMvBQkY1rTfiEfh4dU5MQzR15wSmWvweqQ4nU0UVzIIQC24X7WB1HOcH1EdkeaG 7VdWyNacT6cefhUp7s7zobaCFpia1bOrecKdnxbBVBhNIWilWQDcGF1K666HkLbl7rvNqS4oQQdn 444VKVsnvW5jbRMhTx1My7O7k2kJGjX8Bb7uZDXdyUpCQmAOPMjbhhs2DZFI28BsGJ66x1tP/L6w fKzMZApDKhJ763uALa/HipgFxs6oA8pM7OqOvGJrVwiHRIxNKjKsWKVlYqRTOC1g1m29+5G0HuOJ LWV3CBAmdg6JxiOcaMmGE6CeNXA9MaymnyFhbyDbBTwtHK0xuQIowSO2p1JHMhsrUFMAgCjuxc+0 caCnOEGOY6lRLT0xSlkJigA1JW5AsLDvp24hftnHCfdFSjZBtCQJk0gaDK9XQGSpeB5qxgwphqpQ ghW0HcjjKbYtNwMFUW5ncBR6qGzppizStVw1DDzoCIwEBsdptYA24kZeUpSpBoA3CSHDjhQudQoR J08xR2kLF4QxU/FhYW1729vFbuoppRbrJjD1ovmVI5DR0dWqbRFURU1rgWQixPbwtxKlw7SIHPPy o4ZEjbQt1dOJ6ijlD+dHRsZ4t1rNLIS2gPe1+KWWsZpe67pTFSBSy4szLK3l/ISRo0clrNtNyfz4 tLOHMVUPwmAAZpwwzA6dpa+peMT1MjFEdv3E/wAIB8dLHj7CCRJp1dyRA2UJOFU8ktFHI7BGpgEG 21yPjbistEiZ2UmbXjpildh08dMZayaLdPom5RqRc2GtuNPkHhFKrdhZIGwVLTGZZIaj5iPZtZ1i TU3G4gE246AAnGlS2dLmGysM2YYaqFqdLI6D3nY3trc/R34neBIgHhSy1TCiabzis8VFPDBOgmN1 gL3269yAD/Hle8wg1Qsha5IpO1uOJTxQReYPM2gSPrb43PxPPOPpKBTSm9K4OykviuNUEk7V01VI YowiLENQNg2/TrfidRCF6waTKdIwAxpAVmdcNobNI8jSktGgcAKxJIHex0HNG8SBJ21VbTjgOyg9 xvrVQ4a80NZKGaQM9NssNqhRp8TxE47IPEmkTXhx2e+gxwz1BU1XPVUtHUSfM7lMcgmsignUspUk +A0+vjVvpcGAINWu9CYwnnqoxnTbO1bmVpUMxmkUb6mY6aHsLa8PG2Vjnn8KKFOJnZQvSVVbHV0M cTFGkYbiddqXtp2155TSi7S2xAUfEKEeHB5qiGnd6hpJACzi99Sfjx9t4D91GNuQBsrFDgtVTYg0 kxMRRTIl9QVbT6NeKkvoiNtNvIARNJHEVSpr5d6+VTL5gMZNxHcWA965J+nXitSOgUnNwdEbTSBx mlnEsX8phHkm8s6t7xZQPAc2lK5jhRTdKSoSdtBFnOGX5SU0cm+dmMrhLKI9ALW+HNBszQfuFSdm yq8er+dMw5IrKCaYtHhlU4CyK23yyz/ZuRpuGvCDNkuMyYlJ93Oyn7B9JkGhR6W9bmx6GjSOUrFE VmmLSgsYwdD46acRN3GuScPSlySQoTtNG+wbO9JWrHIkxjUXdd9reDW0734tbuPEQRM8zQhtUbKE HAcwGspZ3dGiFNKaeNl7OSu6+l/bxYjbjRi82nhGNLhTBU06s5MhSQRgHxb4Wv8AXyy0pUnxCihR KSYp7jd6aleRo9scIL2UDsRbl1sCIpglM40lcZNDW0waSTylXRSSL3Ovs5pLYAx20pLoBoKqumag kknhqBMttwQEEhD2sQOIXkQcNlLFXBUmIoNMaxueGqpAz6EEgrbYGvtuT3BN+OMN6gZptxYTMD8a ZcQx2eeKaOM7ZidoMEhF17afHw4rSlSThtoke0nE7KUmDZqkGEUVFP8A7200olUSG5UK273h4+zi lDioiNlILnSHMNlSJpY0xomkgvhteGqfKjNirNo39PGliTgKb/MeHrHTTzV1hmbDhGgkLxR0VQ97 7gjjX67a822cBz08ig5dyVEii7+qGopHwnA69pQlKxqcPmeXawWO3uW3X94k6cJr8BaQOnny5mn8 rbUcIx56KLb03mpoa+jp6abzUbywNFJC32628bDiNFoEuajGPl7MOfLZQzClHaNlHuxChXDumbY0 1SKeCip6ycfYWxEel7+w214vebDbBVgKDd/dS6RtmiJZHzHif82EnnyTNK25ZS2lyLaEe2/38xvz 1htlrWkiTxw9kz1e3pomU8lTkY++h7wfqDGKtcFzVRiqotwVKggefHu9hsT48DCrRDzAWT4lAYYS OmMMOjAdMRTyTAI04UcXAuiud6HBKfPWCYLVV2VZdrNM0RYIHGm47bD6bjipjdjNLFsXIQpbRxGH T7vPEUHLi/tVuaNQ1dFCXQdLaHHMZy5UZqomo8JqJArVLbVVX8ASOxNvHg3yaUXCC+mGztPw/Q0n vn1dyUoNG/yjkj0r1/VGtyTnyGnnGG4TTYzl6SeZNJQ7LIup1vYHmWeRt7vvuEuqkAD91RNeNXiY 0cas86b+vDoN6eMiYrk/J0FMZRG9LAkewFGIKglgDfhnnnaVlFuhLadiNke6i0br3S3CscRjTl/w 4b0P+Q+Q/mdNt/qd/Vv7cf8AyV/5n/M/O7e3iD/ZNyzbrOyfXZ0++ln9nrnZo4x6bfbX/9WbU/ix 9XOuXqM6XUdXiT4Rkn+e0NPWUaykB4mmVfeI0tyG3N/F3mZtd87jqHhGAHT5mitWTrQ0oxhFbTnr c9U3Tnp56SczV9ZisFfPjuE/I0FLG6SEtLDpprrfQclTtAze3yqxdedIhQMY7ZFKcpbcuS22hJmR wr5z2cMp43mjH8x4+IWgTFqqorREb+75kjOBoPAHnPRG+dmlzSD4SfmTOERxjbtrKTLcnUi2AO2K K7W/zGjxqXCUoWYYe0fzNUisI080lF3MFAG4rYePJXtLAu2P5lsgpO3q4Y+uzp8qB904pFxoV04V LanabEI9VaQ23oTusu4aA2I4kLiUoMYpwxB4+ojzNGIbSlQJ289dDDlSniwyZJVX3zGFYWCjdcjS 3C1zNHGQXQqSB0YcRAwg4Gdntg0tdUACOmjx9H8xS12UMdy75gaophJXUXYkyXuq+HukE3+jko9l +8yr20U2o+JP49fD4Upys6XATspdZVzjRfOtguLxrSvS2V0mHbwNtNdRyRTclKwDhUjKgNynE0P/ APIMutQK1FArYgymT5juf0o3XH08euV624TQRDjjhUo7KA+PAcQwXNNEEpRFRVDlZpG0Yjv4D28C bLDrbs8Dz10mfAONCTngp/Umrh8ZEVGRvHa2g9vfhs6iQOmnLUSMdlArlXdGkNCqBljCzWU2BJYj iTTpMGjlCAcRQjQCo8qF5Ws8TSeRER+9ewJBHs4sZJSmNpNP3CJSeinihWdKKtUsslVPKat3TS4N lAH9HFYQqAMIpMlxBWInCnXATNUzST+UfIjchmJGrjQnt4cWszGONOvkbONLBJxSGXyx+jYq5DG9 lA+jXXjxEY1Vh0KI4GuUeO0jbxcuVuwJP7+gsRz2kmjJV3pgGpy1IqPKqfMG5e6KwsdDe45VyB4j Trb+rAUn1xWjjqZpNgZyffQHvp2vxgvDorbutPGkjj+cKWnZrMIWSxAY/kANfv4mfWCYnCl1qCUa poIsXz58lUCQ1haM7hKrWsBYkeHECdkA4Vq6Vr+4UE2P9RWlhikwyoLVcfmPOCyqtjrpxQ20ogAf Oilx1LasRhQHZg6tSRhxU1NniJDiQ3Ib+74fHjStKSQVD3ezzxEdNIXb04xRZcd6gYxnTG8PwChD /O1dSKWiYAncLXIO0g2AbXXTlbfL1PKiAQInaCMOf0iiS6v9CCZwqw3o36Y48Kwmir8XvLiUqrVS pptB72vwRnQ2Iwnj59OM+ylljbuODUpUmje5VyJBlYVIp7f6SFJt7ASdSL6cecOGG2kzzSEuCNtC NAKNZIZ2IEqgKNf3tfb9HC1O2jS2uITsp2fNS08IhpgDU/5Lte3v62+/ijuBBExTraiT1U0Pm15a p2acb7pC6kgeHh344whPSJFN3QOnA0mcZzDhDxVEU8phNjvdmAuRcaW566vCAKZabP7qREGa8Pen igEvv06mPU3LAC47fHi6zdmKQZs4pOAjGmeYUWJRyTGJXlHvvp7R9HF0BWPGguu5CTBoBOq/SKg6 g5NxzAjRpLJURsaGoBG5JVB2EG3cd+JLonu/L2U9bAKJjCqacJxTMHSTOM2Vsyxz0VVhkz/N021Q JkQnYylQNynd2P8ATwJX9somQrEEcejEjGPKR07OFGFqpU6T6HHn2Uevpr1goMYWEvMzhTGYwCRt Ukac9avjUOk9H7uHHooRtuqT9xFHSwTqDgGE0MNbV1JPz1vlqZTuILG2gA9uh4bd8mRPHnnrrWl5 zBPChIwjO0VXWPTR2N086NBrsLaAm/G0XgKoJqybchAoUoMR86jETzb0kG1gpABNvjwwITEzTSly cRspDZiqJY6MrTkbk0VBqLg/QOJFOjbxp1tErHRSBDpVNI8sTxv9rax1OlzYDw5YKAMClbiykRSZ rcKgq5HpfLDvVuVJJ9g0Jv25du31etFd5cqAw4e6kZimX6qhmjjRinkv5ZI1AFibg+PFqE6QZopc zPWmDSNrq+pp6yV413mh1tuF7t4MLacYhWrGk616kg8KXeVsXrJJ46x3BWJldNpBO29mUjx780pJ 6aYewoTWRqaoo1jgsHnlq1TxCKhfaT9PKlROECg++vVxoo3XqE4vQYXg4nPzMQNbFHt3C5YKL2Fx pwivLNTyY6KNsof0mg56dZHxPDJYK0wvPucySTKoW/YaWHb6fHis2JaaE47KE719rTOyNlGix7Gl nyPiuX6hTNFLTeVTxt7wQyNtJIF9eBfezMlWeXuSdo9/x99Eimg44T+FFqwfAaCgxONgvloDbVQF DG2n2fhzFreLNA8koCtnsHVsn5YeVOrtAgSBj00ocbmw6kx/CKtwGQywtVVCAkbRKL2ABtoONbr3 QDoJUNokwenYBj7NvWDRNdXAUysdVbw3oT6g+jfqD6Z4cj4zjuDwYhV0q0eMQ4m8cblTGF0v4j6O dFbB6yu8qZaStBSEwQSBj049VY5O6kXCisGZwIqmL1F0GWMh9cMW6W4BisedsiSVC4rg1ThUiNNH B5miEg+A5jdvHl35XNfyo8bJMiOHVUl5fcKdYBVgqPfRV/W10PyPjP8Am/6gdB8drsHzzSyR4Vmz LNazJM9O6Fiyk+Cso+/kg5tbZba2/wDkxIUrak0hYacWsa8QOIquOizfj9LDmDCsSklXGIqj5CoF RKZPcViNwPx5jRvdmryHiIkccYjjsMHZ6HbhUhMNNqYBSMRWP+b4xb/elt23d3b2/R7PDgS/ti5p +4THz2bNkYRs64woh1GdnGv/1qPMCxSpwivpsWppmhrMPmjqqSRbC0kbBhqPZbnPm5zR9KwtufD8 evaNgmR1zQ8tmE7FDbVlWdernV/qv04yzJm/EJZ8tQBEEZkZkLDRbg3GtuBvtY3rzR9hvvCoNHAT 5bDt+XWKGW6mSMtnVtVRfaiGGNGQx9zYKBr/AA7W5BLK1EyDUmsPITgaIz10yiMPzBT5joYdwc+8 yC5BNtfZ4fTzJXsyzxb9sbdW0Yg8fLDmeugdvIykL7xOHT10CmEYk9biSqj7vL9+Rw9+2tvEfx5J FywptvUSEknjIxiP3bZ91B0XCirAe7n3xQ3YeKm0RZjtQDy9oO326jTtfkb5jeFzwT+Eno2wOjmD EFWOGFCpkXNcuWswRzNUGOCqU0s+oAJJAUm/BP2dZp+VvAkEhKtvRPD9/GRSmzfShYJ2UNWdIKnF qenxrBZitYhCybCLPcE627m478yWupcAM7akK2cIR4dlDvkbqNWUmXsPqq+lZpkhSjrPN+wJofdN yBqba8SulTSZAooS2NZSoxNK6TNUWPPRzrFeqDqT5d2AF7fs4x+YUo9dLnMtaCJms+c6xUwqKCa9 pmZRoO+tr2IIH18XRpBI20UIJiBQWZck8yuBF1W6ggnxB1HChZVrB6aOWPs2UJsswSvp4wQwdDIx 7AFfZrr93FDaVAycKdEhs1kp8bpJfMWAE7BaSPTUgkWGuvDZLxIpAtHdnzpS4DI0VKssrbEkMkvk qTb3mvY2+nituQoVZTiDOGNS6zF4hFLHE/6RQ0anwA+sfHmlPa0qgc/OvWx0wo0naKraaO6x+U7G zgNY6+J78UFagmtXJ1LisEmNfy2Oogaa7sWK6gX+i/ENynDzo2tk+IDgKCKpzi9LX/pp2Y7rlb+6 FPhc2ueFqV8BPvo7udKm+ignzxnxYZxLHK36XcjrcHUEa/0cbSjUcePXRUm70Iov+P5/+ajmFRKG iuWjs+oBHjrx9pIb2bePE0XXF6pxWFAnmbPc1FDKI6hUYHdEkDltLk2a5+HEK3SUiTE9GzGdpnbA wAJ6eqix+7JMEbeqgRxnHMSxmqXa0jFzcyqQNlz7xtu01Gt/y5e2aUUyJE9Z444HgI4zhtmi5dzA OHpRkPSRkvDMbz5V4rieINJV4ABUQYfMl45fNawdXDaFdv2WHjoeCRlaQgqBxIw6MZ9/DDD20Wsl Tj6AU4bZ+R/T1irvMKqKGmw+mQN7gVFDOQB7/t/t4mW2FEA0LUvltEVnxPHYUUbQHigUyXRh7wUf C2nFLqigYY4USholerpoJa7P5Orf6O8RX3AdNBYezw78L23VKxowSnSSBSRxPqzQwU4SKoVpEBWF gwBJa5J0N7C3Git0TAw6eemjBAClYmg7fqpF8w1RJUBomTe7hxrICBYC4140hSvuM0tVpI20y5s6 hwVOExytXBJpgZadDINR4XGnFinkkCcPx+FIC+EExhQbUPUN96Ty1Q8+W0coVrjbe/t8eGTClgiO FEmZXCVCTsoQaLq3TwMivUiMzMIiIWvp8Pq4YtOrjTz60FLsoUqQKGrKmZ6KswxZma4qDuQOwFlJ 0GpOvHIgRW2LkgzEVVn68cOwmHP+W8do4gHxGCooZ5INuske2QA3trYngfzJl0K1iffh19EjnpBh 3mpIWANvEUXrI1RVxmB4K3yo3UkKhVRuJ3W22ta5/bwhRrW4QpRk8ZPTGPDDHh57KfTeEKiCeY27 aOVlPG1lSklqZxIIRuQM+ml9QWJ4bsI1iQcJ4T7DRna5ktJiMaMHlzO96qSKBo1dQsSurAtfvqbf ly+PlRww6SKG3C82zQwxJNUBpZSpRi4F+/gDyzilDCtoSkyYpUNjseJGRWNiBq2lh9Jvx77zhTZJ ThFJLGKuKkeN3nKICEV1Nrta4A/t5sAgxVRdajAE1COJwmmlmaW7pd4lUgMSRYdzoOLgMKJnVq1E RXjM9eskDkl1SGGR3te4F9w+J4uUfCI40TLQCJ4SaBbH8Ono6jEamOEn5oNJINwF2SwBF/gL/VxE kLnbjVjcgQK4ZPZ2lpIpnMnv+btjbWzkgD22+nlBqTHGnn30mY4UYqPzzFQwyxn5iFZFk8y1xuh2 3P1c222ZI6qDbysYFMMWScEzTXhp4Vepp1EUTob3Cdz214hS5LhBpTapU2nZhQbZ3xmlylWQ5fhh 2zM7QhgLWW9t318rdukrCRgKPLEpKJoPsy4wMNy6JTIS9ZURxPKD7x23cC5J05EXa13i7NKU/wBL pMRtx9nGnkvoQuOqkXCiYnEtU91227EG4FrjXmMVw6U+CMR8I+X6UVZ1m4SNI404UsVJK4E1mUA7 e/YD48LFXDycU4H8aDDF4CZVsp5wfO2J5bq3jwbHpsMRl2kUk7KBb22P5cGmT715nbNJSFEpjrMf Ho8tuFEt2zbuu7KyZf6i4vheaY80Nm+WpxmF/MUzyFmYA3sTc3HwPDd3e7NH1IWDpUnHZGHTPUKM 2GbfTEYUKvUXr9nXOCzYhLO1LWGlkoIJ6farKWUgNpa1vo4e3Haep50BwSQI2+XEfhHXTTFloQYo rmWqidaR58TnerrIHaSaolYPI+5ibm4v48Ic4UX3Cr7knZtMGDwMbT0Hro+yt0JbIO0ChM/nmEW3 ed/uHm28b32/qPZwl/kF10Yz1benbsj16pxpmG+jj11//9eiuCkeTYfsITuLEdifZ9PObf5kNxJ8 ox9eGHpUjBtRUfdWyp+Hb6UsneqH0sZmwOfFd+cI4qk0EYZS0E0O5otLk23AE28OT3u32cWe8O6z omX0iU49Bw4eycKYO8TtncD0wqonqbkjMfTfOeYMiZkoWosewCqfCK2lGt3Q2DLrqraEcwfVlLtu 6pt3BSDBHEHyw9tSva5wh9oLSdtPvVf0i5qwzoJhPVbNgTD6bMZb+S4c9jKYjoHa3Ym17clzJ9zM xsbEZgR4J2Rw93TPxonuM2afWpqThVZdJkKjwioeJF95izM2ntuLan8uC+63hdWzqUAmeE/Lb+7p mn7PKUtTx52Uu46N2bbEqxLawQWta1ran2e08DV3eJU5qgQThzsHnww404tBIwpJZuqY6SkWmpiG qnYlyP3VBGug04Ld2bAlZcVEDGZED027Y6aaW2EJHTRguk2dUr6alwiubzKjDthVGKneFBPa45kf urmybpBCiNQ6xj14dNH2XXhSNB20a6my5BiODyzKmyapZpQqWK2v4WNiOCG9aQpGk7OY58q3dr/a yDspXZYyfNSSqlPGzSMwlq5m+zEkYvYW9vC5i38eFPtPqUk68eismeJUXD1ZxvKuoTsNTce3jy2U g4gRTQSAggbaDrL9KrTeYjguXCst1O23b49vDhY42kExRgxcQgDhSuRpVrT5r2KrKwkYC2oAHa3s 5dEFOPGlzrgwjGm+hQrUiWRwI5GLe6dSwNwPtDiy28CdtJbt4agIpWx4jtjihUqCbtJr7PaP7ePJ WvgRVQAZqBUYpF50Ecajc1t8hIFhqPD6OOJGFVx2dFJ3EsZkwyTdG9oQzMzIQRcHQaE8cJnZSxkg ieNIPHc0qyo6kNLdiXNr2Otu/wAOJgpaleIfvpSy/oVI2UBmO5zLzvD7sey7nbtvYHvck682G5M4 VZ67JGMmgEzJmeStmcutohe7swAAJt7fHhfdqUI0gHqkdGzh07PWia4dEYcaAjNOKmaqpI0Ywn7T sTtDWBK27HQ99SP4caQlRWAs4zswM+cYCOPE8RRfbPkAjbz7vZ+NMcGB4zjNSyQoWgm3yAyEtcsd pPf2314sQ3pUDAUtU+WwbeGEYSJBwjbSV3RxOPPrQsYF0udKZZKpFltt3EAEGx0BPieGzOXo2OGe qf0pD+W1Lww+NDt0doYsn4pXB3jpvPWCZDEVBMep12n4+PFbkITECOeflS3KoDhJxPXRvazq3hdD QXeYW91fMjIsLAajXvwncuTqGGHPPChI5bhSQqkDjPWyAU6NBWDy3DJ7zfZ3Db2vyq3NZ6aTuutg ddB5iPUOKqhkWKpDNt94hhckj2k314YNIBg/h5UUPXICsKB/Fc70SqzvNJ/MAz7lJTyfIWIm97ht +62na3x4y6psTOB8x7Nm3jRe/mRBMHAe2aCKp6mLL5cqG0UhCh3kUgM1wLhW1OmovxLqV3eowI2Y jon4Y8PZS1OZGCFSCKQ+O9T6uRY4oKr3ICqFJjcm4udAbWHbvwqaUVgajs2RAnYeH4dXGrOX7YmT tprHVyWLdEXuXsibWXQ6DxPYfR/adMqUjhpGHGQMMPLrnZ1bSH7q5CsBz8qUeFdSFFdHPLWiQRvv CuV0sN3YN7B7B7OPM3srSDESP4hh6wJ2+nTRKFKKQOPrz7zQ9YZ1zUD5eHEEVZfcBikWy7hcnQ6W HDFy/SPCo7fLnDidnTR2yjDEYii/eo/ME+bYMGp43FRLh80lXKyBWKh4fL7XuST7CO3E1+NWkBQk dJHUdkRPRVlJTtBPPPQdtF/yvj0lNJTRS33rbyN3lhid5S1g3fuSL/lwlNs0kBRAg4HEHD4gdEbe ul6XUGRxPWeeqjJZWzCad4papkdHWxiL/YAFzbUjTufZxZZW4bGKZKgNh6zHv6uMmOGw6FeETA9/ PvodMBzVQidRRTJClg7hWFtBY9730trwxWEFMJ2+dL7R5ScTQs0ueKeE0sbkyksfLVbG7WH5AcLl tiEztnp558qOA6NIihFp87x1VC8KymPzEVZAANCb+A+jipKIMnZTZeAM1lqsWixTC0vUgtGwZEDa ttHbX6fDi1ASVQOefSkTrvdmRga9EkcUYkEqxRlQsjAgkuwuNb6W4s8CZG32RRYu5UrHbXKjzTWo 9DF5WwtIEcK3hcgE6j2cUtpJRE7fZRW+oAmdlTMyYhFPCadIrGqV0LgqQo8bXPx40TBE0WphauMU isAjipKhWpKgK8d0hgTVvMj98g8ZdIMEUdtiQZG2jRYVN/NMKwiua0c2IRefKQAGZ1XYfHTtyiVa lddBm8SUEwKh5Sohg8z4jPUjcCIool1vuNjbXxtxIu2CMScTNGrCwWyIornVilrMW6g4jiVNdYkl WmSNwAFC+z6/hxm5ZVsAxowy1KA3jQPdRcQmllwrKcUod8OPzM6QEH9I/vWNragW+jkK9od4gqDc jw7cfL2/rSNb0rUoVwqMYjwuihSUhPKAWQNa3a/Ya9uQB/LVOrJOJPGRzs4ciPs3ulKdMjCkxPnV GWSKjBJUEGTsNdLi/DNjdyFArj2j9w+FFC70484UGuNSZirJ6aKjnbdUPs8sMblj7SBweZMmxaBK gCEjjx6hzFOWjLi1YDn5UMGA4NBl3BqSqx51Fft86RJXVmWwubrckXv48BO8N2u4dKWgkAnCImOs DHHrx2eop7stnSr7qhU+YsWzpj9HlvL5DS4lMtBSRJt+0TbXXtw7yTcISAYLhPs9p2D29NKA6ACo jwgVcvkP8Ez1PZp6Rt1JwOvppKjEKVsTiwdlZ5HAQsBfUAnk6XPYuphCZKiYBkRHMezooHJ3zBKu 7SIT11Vh/mC607/I/qbWef8A1l/zNeT5R3f1l8v5n5W237Xl+/a32dfjwI/2dc2YTMbeO2ft2xj8 qEv88aidJ+2dnpG33V//0KN8AraeaHZJbc2t21v+ZP185m5gytrEDHy99TBaNasfhVl/oD9Z9f6U +pDVtTiEkOVsWianracH3EcHRrX+kHkxdju/assuQgJJQeno9p9PLpNEeeZOlzxcasp9Ptd6fvWr 63qnM+d6eLEsJxNIKPDaMj3airDEhgo727C/DVjdbKs/3keuHgUyRAHSMfKcfSmb964y6xTp2fKj T/jnenXA+ivp/wAoZiyKZKfBqSqhwlMF1MUau6r7oFgBY+PJH7Y7ZrLsqR3KYTMEewe+ifdi8Wbr xHA1qA11SyyyStDskJ98m+g739vMUrgoeclUidvwjbj58mWzmJSI20yyV8wVmUbCVILaCwAPiOWZ sUFYAnHox5+XupOzmJcPRQU1E5xDFnmkkMnkEi2m0gEHuD3+rkgt27TFvsIJ6RE8ejnCKMEuBTkj CBSiwTE6rDsywVdMzqIypZ0O0NY6jWxN7cFOSpXalLiQcTOEziNkEQek8fLgluHipwBPCrb+jOIU 2Zcq4dNIgVlZ0aO5Juv1jk3Wj3fMhYxwp1Lilu0O2JVuGYFh1V5QCS1CEoVBuxOnw44VpTIij+2Y Us9VF8ziHrqWSW5b5RDPAoOhIUkaacLtBIx55FPFIGoUmsu0kVIIzCPKJHzMt9WZ5F3Em514XvJg EGnoToECplTXbm3KbM+5SxNiAPpt4c8pfg66WuECKaHrjHLDChaRWe+463FrnXiy3VhRTdKlQrJV Ywvz8CiXYY42ZQ1gZGOhtfva3LMomduOyjK3nTUCrrmZhIili4B2htFYg2Hj24oWTwxrQgGSaDfG MZqqVJFncMzW8saEDw+/TmjgYG2lSFJmQaBTHs3zq0qliYwDtsBfUnwHLsoxxwj2UnfdTQN49mid BKUFyB5AZWC7dPE6AdxxNf3MbJPtxwOGzq+BotXdFR6udlBBiWMVNZKpiRiGJWSCdlCSbSfd0bwt fUflwuZQtoELSdSh6wemP6OzZSd5xAA5iomGGepcSTU/mSLIZBvKt5YYqTYk3P0a9uO6ZT3pk47c ejo4n8PSkLhSkfd+u32UO2XaWKcRVAiUISPe/eIB/bw6syFjUQNg5/SMMabSqTBNDFTQCojjjgpd khKrEFbd3strD28MW2iJOylXeGaROasBxfADDilFeRzvSaCMXNiN2u0/C2vNXDIOAwPr8K2yrHUn ZRW88dXMTo2WGKGSGYkRSRzyIPeAF7322t34DrqyU6soBPvjAnHHDbwBHRO2l7t2UNEk4DoovuJd TM/V1VB8g0stnbZBG4Hu30a9wtrdxfw78EVnYW6W0gqkjqOGHl08cRUb3uf3UFQRAw6/nwPXh0bK fsA6g9SqZZJ8RVcPw+ISzLJVuCHZXW8d41fXW+ot9Gg4say0IKvFPRIMRh0bfXr2SaSozt1xQ1Y7 J586X2HZ3/rMK+JF8pnSWFJo2tv2oCSO1tW78Jbj8ygKmSD1KjowGz8Z47QYd6dIVwnzjGgq/m7U u2IgRvA4ckldSDe5U6kW+P180EqcbH3Hp6zxHCMeGzoPSqubhUlRJx8/x56KD3F8ckqHmleVYRVl qiNgVsbNfYAzW0B0sbcVM24VsBwGGB2TjsjYZkR0zOykr94tsAbT7fgZ9vTPTSRmz58vCksVKtU5 ZoYp5JT7oCjW8ZHjrbW3jw5RlBcUAMEnb4SPftiNnVGAigtd58UatPriOngJnjxw64moTZ6xqrqG dYo6ZE2+YUKk+8TcnViR43ub+y/Hm8lYSkAgzj0zPQAePyFJkbzOJUdgJjA4fOPd0+dLjKeZMVxS oiUh1MRaSRY2Zgbe77yHUD4sO48eEr+WobV+zSSBs29cY7Nnu2baFuUZ4+83JSBwnh6YziMeRRpc Nop3wa9UjVU4j2G58GIO0fa0vfx+riMNFadRUTxnEY4AYGTHntjbT7rqnn42QeGNBbjOXhg0wrvK aOomZiqbY0VgW94by2mhuCAe2vG7ZyMXJJ65B6sMSejhjjjhRi28pawlJw6ufjSrwSsW/n0kMzxU YDvuRZEUMPKBLK21hdrfZ+Pw5u0uSQlOPXI2DZJGHnht9lKCVIgEiT5z78aE/CsfNLQgyU+4Rk+Z 75DG9u6i5Onx4y+AG0hUgDDHVp2cIB9ThB86MWHSDt4c4/gDQn5czBTYhNTTRtskiLJHHJYWuSAQ v+trrwxaJJBVPkenp+WBx6KdW+pGHPPT0UtXzJPTNKWfzA4BTy7aBe1r2te/FCULjnnnjXtVOi43 NXNRRrVNTxOdxKOoJY9hfjiAUECnGnBMnHpoTsFxeNiIGnDN70SiRgxP3D4d7cebkKxBpi7fwOnZ SqoJ5i8k4pvOMLtGu3/WHfvw6bSFAdVBq4JxHTXGtkqIyjSpdZCzfZWwI8B9I4kfGiOFXtUjppD4 PVmmxnb5AMKyComDt4y2uzWPgOMJbJJJPO2jtAnCdlG2wWvENPgsCINiM0AAbuGKjT6+OMEAxRFf IEmDTxl3CqlcSUYj+jpad3kJ1OoYhdfAcoxbnUZnA0iubghGlO0igd6n4RHRZoNZFEZKN4mxFgv+ GM3Y6n28Ks+u/wAu2twcBS+xuClkAnE0AWXcNparEsRzDX0ySzSSSThZvdA/eFiSB2GnMJ883hdu bpepG0lWKiNmMEyPTDqG2jJxpLTU014rguDVss0lVD5jOzSBFttCk39p4GmcweKj3eA5+VBu6NtH iGJ400NlnK0aKy0widrDzFLAJYWF7acWs3t44QCrA8efKiN02Ywij4ehLoD0V6g9TcPreqGKBcEw 4xmGhUhbkvrfU3Og5K/Z0zlr6lm7UZg4RsPA7fXoqjjqu8bDEbaYfxKehvRjInV6gwbpDiVXgmWs SpXr50xXf+nkZh76b9dt76+PDTehm3sHm9DSgpQJkg05u4hT5KlKB+PxquDL+U8xZWzHh2YstYxF W1uGyrVwOrbZAyEMDqQNbeziXKN40levSQoT0YcZ2/u91DO9ysLbIAwPXW55+Eb+J5HmmjwfpD1K k+TxSCNKNqet0D2G267tDfmV24++jd8BbunEjwnH9Kx43kyh3L3u9QPCTjV1/wDsldAv6zf1i/q/ Q/8AMd/7VHl+WLfP/wBUv6q+Za3b976eHf8AYxrVsP8AdJ2dXJr389H9PDTPp+/Dpr//0aBZIK3C 1VlJRwQXWxsBp4/H4854gJcSQcY4Ywevp9wiNvCpvRbBK/DhWGux6Z6ULv2zD/kIbrjwvwyyrJ1t qS6OjDbzHGflTL6gcOE41s8f8JzPTzSdRup+P9cc1P5uG9OIWhy7QS6rJWOCrSkXP+TBsPjzIrsi 3RPfKuyMNgEn2wSY6Onp2CgLvtmqXCi3gQMT6bBWw1+K/wCnrMfqi9HOdco5SRZcx5dngzdQQhQz TpQP5zRqQLgsBb6eCDty3burzJpZPiQQqPKg5u9fpauATjw9tfPgxrBHoK+swvEKRqGuoZHpK2kq BskjkVthVgdQQwtrzAtwPNElQPTsMceM7eZqc2dLyOoig6x+kjoqOYxAF9VjTQHUnX2X4JN3O+fc ABMHh0+U9e3gNvCn0WraEngaD3B8AqSrVD0zB33EsBYjU6n3vDkhvaz0yrjESCcTt89nvplDujDh WGminjxUmOETKp2SNKLkG9rC/hwR5eHlN93GoDpBwjo9vTxnHYEb5ClYVY10IzVT4HlCmpahxDV+ fISg22AJ0sT8OSbkN13VslPt5x9caPcptQpUk40K2I4rV47XUcMUzNHJMsboDoQfeNx9XDdKVOuC f3ChuhSGmSaxZlZYo5AbsFb3kSxFipFuLnVbYPyoPJUmJPXSNpagJE/7soKowtpa3bv4duEKyQdu NGLABQBG2muvnZZY43usZYqg11v9HLLRIg8++qXK9AkbalUUUauZZhuCEKh8RfTx55oKBonS5rWS aTtdLFU1TwRENPQTANLJ3ETWJUW+HFdslSgeRRoXO7bgeyomMVYMNUWHy6wAeWEFjr2AuePLbKTt pO0dnGaBDM+Minldnl0kUqquVOhB9p78eU0RB+XMVZN0AmAcaLHnTN8MUTLHKzztujCqq2Gv1n67 cZefTAHlwwx4fMjo66StvyueFARiuc5o7u7Ga6FiisIyGDWUeFtdNPq4WFp51QOqFR1g8evZO0QI NN3KkLxmI9Z/HmaRs2P1Eq7DujSUEKl9zFAbEAgdwf3TxSxautaRJkjrMSePDjtw244zSZd00oTI w2+ft94pX4VmxK56SKKijp/lZQjvE0oZvdNwzPIwBuPZqb+HE7uouIATpO3rOGO3b7hMYGYpGEHH GZHPD8aNLlSstHFIoOwANGpvcEa3NrcEA1aQnyAwIwj59QiqMiIJwod8vtSzb5JwUUBWWMr4t3BJ F9b8eLpB6hR4w2hZkUpamGnkppJBCxSW6qGUAEWsAL8b/MDbRv3Q0njRcOpXRnAsbaOrNAhkb3kk ChW1f3hcHsba8s9bFZkKg9PPPnRK4FJEdPP7qCGp6VYPHNSA4TDCtGWjiip41CiwHvaksb/E/Rxu 4tVAju1QQMOfPrx66JEsnEHGgNz7k2PCalFlgk8mbdMEhZdSvvEjYQQDfUfnxAxeOpc0lUK44YQf KevgPLGlosW1jAAkdPzmaBelrsUwWtiqIYyrLIXCSmyFiN1rEg7bDvrxSoJKgArYYMA4yB1RPVgR 76IMwslJQQE4bek/PHo9hFJyqzDVuyrLGJJ5k8wilUaEsCU2ybdCR9H7TNnLUHFLhjHbM7cOO3bj tOFBpObO6YKY/dt44j0OHtTLjE8Q+XU0plmMhZHYEmMKewsbdx4D67c00htsEE8Ij14+nx20Xrsl 3C06j4SOmPZgQCPYOAFOE2UqkUKkxNPI1pYPMtf9421LbjY6ew+I5Ry8hzBWBA2T5DniOmcVX8gb U30AdG3bgZw+WHli4YTkGonxCCnnhkEj2ZWMZ1v7ym99ATa3cfHjv8wc0wVDbEbfPoPTsOOynEbs NOEFcERHX5+foZoymTOkVLl4pVSQJvmKz+8lwm1g1zq2pt3twqC3XXAsqmMZ6vnj1e6hDbJbbbhI 9OeA86HXCMPimMsRVkjcmpFht/d8RoPG1uGTqdWBJHThxiNpn3HDj0V424Rxpux3Caapo/LmhYGe 4VTGG0GvYnQn6RxK5bFxBIVB6xzOzDEcJM7W22yDqERzzsoI1wuShr3aCELHEvzMsjWUoqgKWBU2 Nr27eOl+FbSFz4sXB0cAejGY6p27MaPW1oKcMTs47ejjH6UqfnY8RiBrHaF4jvMYQAEh7Ncqq6aa aXPPXLq4kyD0EGCOno2nGZIOM7K1bthqY/XZht59tLDBsSw+mk+YUNvLbySRGpXU3tY207i/7eWT dEKJiIMcTgOuJEnDEbMJO0Pdysxh8+ecdlP9JiU80pLhLL7w3C4PhYgHXt+vi7aruVLAgDpwPVPH 2dHXThW2BgfT945+CroqksirEY1ZLPGVuu0WvYXOtweGpcO2fbPzimkEk47KX2A4iHnEZ9ydLM0i n42Gl+PNOKIGPs56OP76cXoI6qG3C6j5aNikgeJ1V2FrXYi1/Hvw0aCgBB/GiC7JXhxrnPiiyU7w VIt5TABTbXcNO+nfl3QONetm/F4aRfnxvWzQQ965kRtAbqdD9kcLRiCNvRR021pGPPzoymSpPmaS hl2CNIXPuG/2hp4/EX460kE0UXSTJ/Shsy9WRSxV0TqDPLu2hiNCrW0H1X4807wNJ37AkJUBQJdZ WmiypU4lAp+YgnjwgsLXCTMWN/C2mvIv7WL1xrLipCoOz24UutkpU4kGi00tdGuHfK7b3/SEAW8S B25hlfB5StAxE8B8h8IFK84UgJ24Ux1E1PMbSDYNxDHx0Px5RLTicDUf3bjS5xwpslpnljeCOVzc h/Jt7trX3Elvy4cMPIDRBJmRAjD2zh7PWg9cNq1QKN/6fao5HxHDMwRQmRdAftakG9/Hg83FAt7t D6hgrhBgY47Tj8vWaX9yQzgYV1dNKf8AEewDOPXjqL0tzDkvBKitipctGnxM0CAxwyiYbb7T47ex HJ57RrxD7qFt+IJTwxMbY6Jp/dt5ptwlYgnhwnpHntjhVab9OM0ZVqDLW17U0gf/AHnRruntBBPt vyDrnN2QO7AkxGw4RJx9xHDjHGhtmF4lsT0czRmOjfWbF+mWZ8FzHRNfFMLYGKo1D+6fGxvxHk+9 17Y3iV/wiMMZ6MMY/XDZQLzG7YvEFDgw6ati/wCHi+v/AJXkfzVPJ/lX9Ut9jf5Lzvmf+Qt+n0cy A/6GGVE4zo/o8ZiNn3R7qBn9ibf+lh8v31//0qCZMWFdBI5VRpu2mxI7DsPjznUbNaFAA7NmI5mp 4BlXEUmJsAx7GUnOB4NUYnKt0ePD4XkIvr2UN7eD3ILJx4QnaMD1DCJHzwNFuYXLbKSokAVdj+DJ +JVQ+ivPmKZE6u4PU4dkrMJaiqZ5EZWgdnJLENrzJrcG6TaJU2rZJw4mcZGyegx8KhreN5TjodTB FbzfQz1N9BOvODQYj07z/h+P4ficRWTD3nj87a6i6shPx5KLr7F2ghJCuccDjRNaPaVTiPOtK/8A HT9P+QPTt6rZ81ZIxWCLBOo1PJmXFMGpGT/Rq1XUOAPAPuubePMKN/8Aclu1zJTaP7mrHyH7/lU1 bt51+zg7eZqlPC6oZ0gNbFTH5WJrt8bL3/P2cJ2N3yw4EoAkYmDsEdG04nHYROGNCa1vkOAn2U+V yx0NE1LBCAkynb4HXTwI04ILhgMo0ohQUJkkbejo04HDp6wK8HJXJ4UGlXRpT1VNJTxku57WGnce ztxFb3JGk7UnDhGHofLb1dVWcbTEnA0L2BVmJUEcTxofMsDZWvoBf7tOCHLM8W0uHBgJ4pJMdGzD 544bKObdakKChRn+ieN1WN1tYcQiKDDomqI3uWu7XQaj2X7clPKL5t5JKTifhSp3Mi5KSaWeZa4R 4hDh0h3S16STrHfUiIgHt4cUokpOOIrVwqY6KTLTLHTyqgUHd9o9jfU3vwneB1Gdpo5YcGhNN1dJ 5/lNJY/LEsALA6i3Kl2eOyqXq0wdNNGNTSthDQ00giaR0fcO4CyBj3I8OXW4qi2zUlLkmpVEI0hN UKcWkkvM5AJ2g2vf6eONOlQmcOeZq06lHHZSKz5mKBI3QraNEZppBce9oLfVxWkgGeOFNNrIBooW d84x+VUNsVIo12mWdwpLH2Xv9R5a7cUhmePPVSFx0av0on+Zc5tN5sELnygsqFEcNbdr3ci9z2tb jChcq8KjAwjZ+g9m0eVNju0mTtkc/PHZQV1uLQzzOzRCoYgqV81UaMkkEX17EeHfhooQYGAHWJPR BjnZRXc5jOAOkeW3o9tRsKpKmrqFiNOY45dhnaBkkYjcW3m9iDceP3duaTcqZXJIwB2/OZ4njPDr oucul6grZ1R8D1entoY8j5fE8qRtTur7lRr6rqN2vewvftofhwmuytwyD1cI9eMAcZ92FGv5kECe eHPpto9+QMsbcPVnCsY1LndfXW5OpI14cMOKCBBBHy4U+FYgGhjoMLl/RQmn7bZkkewCkkWJ/v46 kKAOM888KPGHIICaUcdO5gIlUSCAspErXKlRfQC/EyVg0epJCZGNMlZDCcOcBQ052siE3sF1I+nn nlgJGz3U8kBQx2UHeKYdT1Rj8uIN5m7ziBa7dr3vobfHisPRplU0WP2wOI4UDXUfKmGVlPHPLSeU 8LeYTHbbZB+7tGl7Dx4XZg2SgqBgjHb8urk0VNL0q27aJfi+C4ZVVQjN4EmkCTyGw0dvtA+7othf hW1dOpUFSJ4AmOvYB67cTsoycZ8J2YfLaKScmU6KLEqqlSIVLQTvDA5cfpPf0YF7aW1Fvv4au5ko AgGIn8Pjs6vQUWWWVNKSFlIEjox6aWWD5ESRlpzAybyFll9wlbbtzDaTa4NrHx+/hX+beCcVYefH 2DZ1deNIbphtE6QI2xj1QOvnypWDIR3y/LQiy3gE1wFe1r2sV1Iue/38MrXvXSI2RwI28+h4dJRF KEkFR9OilpgeRaVCtSlGEBYPLvXbJYAdgQRpt8R/DhsGAriCZ6pjzHX5RjHTSgEN4Hn95PChfwrA mlhgjkgCzRgbCEUXN7nS3w14yylSW9sx5bJ6hh7/ADq5KNRA405/1fWGS8SkGRgzkaXIsdPZrx4I IQBAj8PjTdyyk0msWNVSVfy7QrP7gdywWy3OncDjD108FAJIIjpHt2dWPDhSF1ttKccKLJmnE6qg xeRZVCm/nbE3bA20A3IYe0AXH36cJ0Pl4kagI6xHSD6R0efE0utktd3z6frj6CsceKI4lminAjKt sVmYdjYljqR39lv4caNw4W4KwSroGMiDjGG0e6SZ2qGnApPix2c9Hz+NPeCkTJaGONkO6MKsiXDN pci5JFhpf9luOXSHXHEhE7J2jEwcIjEYY+zCaVOOAbZ9hoVcNpErlWnKxoZ0EQExCsPC12vf42+s cetkidWHijaBGn4+XVFFrhxGPs5EetPWG4fiVDM8MhFQATGkyMpuPD3gNNP1t3WOW7y+Mjr6fL5z PvqzjyRh08+tLnBqiaKdpDECbe6l1DMVv7CPbfi61cdWVEiEzhJB58veZpEt9IEJocsJrZfIWNkC FvKQlwLgWvfU/Vw0Q7AgnDzpEoip7zQ+eEKq+5mVlBAvfQXtrry76ift/CvIVpjnk0hvnIaPEqhz HtSj96nOjEncPj4eHEUEeEcefP30aMuL6cKNH0nM1ThabyGmkmLkEGwCqDbufbx62mdsUgvHgDIx EUJEtVU4bVThFFopTInbUM38LcbVqB8qMLRYU2IoeKH075z6/wDRXqvjfTbBWxvGMlU9FjuK0NMD 7sBeRXIuPtEKbfRwHdo+RXNzlCltbUkbOgbY59lBi8zdq1vEpWcKq5fA6qjobVSeXIxKyITbawuC LH6fZzBd/Mg46UgRB/f+6jDN9SxqBwpI1MIR9kdrlrACxHcG+nDJL2rE8/p0VH9y2QZpTYZRGU00 UalnlcF5PdN7nwuBxh1xBVAw/DZ0fE08yyQnEUcFZkwPL0MVLTKklPFZ2cdn23OvJJsGloQAEgYY 4/Po+U0cIQIgGtnD8Gv03dPer3RZ+oPUWgjx3EJojh0MFQqsqrK73OoPgNOZjdnuWW6snDikBSl4 TtqKry6U9erbOAT+NF6/EN/AlmxLGcb6n+n9wsFSZMQq8qEExktdjsP7pPs5j72m9mt7bPLftUak YzAExxH60OsvzNpbWlxVa5Nb6Q+qlFng9OqvLc+F5pSRqdMPrkZGdgbWDFdR7Lcx7sM1vHHk2+nx nYNnVOyPiacctWSkqCsKG3/hrr1bX8r+oUlvL83d5i7fJt5vmdu3h9PBb/ZDNZjuDOqPWJn2YczT HetR/dBsn0r/06DsHwKpr6giJNgJVFZr2u3iLXuPjzAY6dOoqEhQ49PHymMfhU/PDSqOFXI/hX5m 6a9E+rWNy9asBpsYy3mCmSnpZK1FcRy77MRuvqRyTeyrPmm3XG3UhSSZ6p2fLqigHvtbuLCVAeEV sBetv0jfhy539NebOpTVmC4LXVGHS4rgdbhj0qVUdU0JdAPLIbcDyfL9GX27BuEKgnZj7qinu0vq SRgr2VpYZH6/9TfTnjEuKZAz7XUTUsrpSzU1UyAxhyqkrp3GvAY9nveJCjx6DiPZw54Yiw5O2gRh qoD/AFCep3qF11x9s0dT82TZixBIvl4nrJS9lGpUX3WJ04UXWUode1IxPqSZ64OyB1A8TsowtXCE RIw55+FKjp9mmGl6f4bHh6FZ3UvKWI3a319p+88Jl2RBXiDt2kH1Pxx8qFVpeAN6Yxp5w6tlxBWn nYye8VjbTU/Rrrp24Dcyc1LUoqmBGEA+cYzjtww6po/tFkoHCuctI02K0OxB5cjpE/cWDP8A6vhp xTlzaEN6QQFKw2iZx4Db67OmcaXrbVpB4UP0uCiingfaBBKo3R+N+2hJ4zcgSAtQEbIwM+8/v8jS tOKcImhT6ROKLFcfpxFsjNMJgbe815bWGvJE3RcQEqTGIA9uPH0/WvI+8UtcUpopMWXEnsKqCmZI vN7jzO4AHfUcFrSvCY591GagCOFIdZ5JIKlSt23qSO57i59vCuJJ6fOl7R0xFRKwvtEquRGf0Uws feJ0v7uvKlsSRGynHFJIM0zTzGdo4CuhG0K1tfe17ft54JnYdlEYJST11nxCaSnpBThjG7BmMdtG tqAdAPDx49brheJwpWyvAnDCi857xxlp6inK7kCh3k3dyq2N7ad9eLbl1KEalDAc88aROOKOI20R XP8AmGWsqpkIY0lLtYINUO462t30HYH7uInNKwFlwAdW3oPDhExHDCQaZSrT4iRJnq/djyaLLjeL +ZNKx/yoRmSM3N0De79sn2HuD8eCHK7FAMEpgbDh7DG2RGM/Gg5meZNszBGPX7dmzomKVOQcrVOY GeSRGSnvYywbri5NgCbnUHW4t+fGM3zNbJGmCevYMMCMcOHpxpBbokTpA6p8jwgezZRrco9KKaGZ HZT5MsVrvYH7W4Xue3EyLdSjBiNsjDGccDOBOwjokUqUyt0SqB5c7aGrBMh0GGSr8tCEjc7QRGup KbbWt4W4ot7NtJnaTzMxzJw4UsU0cI4UOWXMJkoah0aUrCIWkCW0OlvDx4rQyhIKZin2lKwPpQl0 Er1JSn2K/loCHvtftprryobWJ5+FDDLm0HGlPVYekVDGssY8mWIzbxa4NwfHw8eIHGNKgaNW1Agi RQZ4kKanSoDAhJVAW+t9fZrrxWGh0VdJUDhSDqSKSleVV3xM2wqb6W11uPZxxRgwIJ/Hnppi4Ood FAXnTFlraOogDFY4QfcJRgwQ3IG/9fZxHdluNKlCTw2T8MYmPb5FFskhwARPr8uemijVdDM1bUF2 3LI5kZoQWLXsqgAODf6/q14QpAXpUjAH3DhwjH1noozU4kJkbR04c+z1wp9o8rV/8xgjTVnlaSRx ExMRJLbW93R7D26e2/D+4sFNpHiB9cJ6dg2dWzyoqZcS4iegRt9+3Z8eFCTS0Ap6uNjCxk2tAXbe FFlvezWsPDQduFKGHYiQUiZMjCdnAYcSRBiaS3SCpJGGEc/vNKfDsOnKsocI0pd1BQkA6rpvHiCb Hw8OCWyZ8IA8JIHn0e708tlFa2/EcPfzztoTcs4MlJA7Vn+kSsNivIe4GguPjxcdWI4e751tDZVj S7oqKmgn8wrsWQF1jUXIuBrYEcYLIAE40qCCkRTTi5hhNQ86sEiH6G4te1reHx5VwwACPX9eYqrv vpH12GfNCad28sqgQOoDKrPcg2bv24wG0hHX58+n4UVP/dsoo3UrLc8U1fXy1T1LyMxK0+wMgsRr oToCANeE7SGm3YkScDiOJ58h51tD4B+0ADp54nbQMPW12AzzULN5OxWDpuCqEKhrEe9bv2AvxW5Y h4SlWMRGPmY6ejq2Txq9vfJWmVEYGlrlvHIpJotsvlSw+5tREBuDuJNrDU/lxNeJRGmcOgHhz0be M7KNHlJU2SDM8ZoQMNzA1XTxSzyyzbJFcGze9Zj2BOn7eFAW4kiTq4TIPV1jq6PWkT4U0rSAJ6Z+ PwoRUxuOo2+U7Uh22VWLgptVe5c637nX4cOmLxsEqMDDDy2DHhPskzspKy4QozB9lLbKU8tXiMXm z/NtBuQs2h9428f4jh1YPNqTIWCrEET7yMIrT6hEgCOeYoyWGtBJTOXcB0G8qtz7oB104pe0pNJz iOqk/X4rDSV0cCsWdpRTO5vcq4FyDz3egfbzz515horI2Gm7Mca0sqKziUShArR2Nyff17/x46Aj VO0edGbaCOEGjQdK6+Onw3D5j9iScLJHGO4dgoIHs7cbZCSZBmkF2jxGomZc6hMWrljqCHhqXp5q c6kgNt0B4mW8dWzjS2ycbS1Jits/8Onoxm7oh+HV1m6m4pgSUGeuqmGYtmelpsbXYaTB6LD3WnaU HX3huk2/63BjnFqtnJlITAUEkn1/SoP3gzQXGZSnxCQPQVptY5Xz4ki12/zPm91XIBoCZDvJt9fO V6dPfKJHiO3zx6ORUo34cDeGykG1O9Qxk232mxIBva9tfHhwFAJwoIJSpZoV8g0C1eM0ECqHEbCQ rYX93X2fXxdlTKHLtIScJnb0c8dnSaXsNQggjEc8++jA5wkipMCrJJDYCJxu+Ow272tyXrK3DyiC No6eTTpAgRwq+38Ab1WUOKZYxzo/V1YiqcOZTCsjAGxc7SL/AHcyb7Mc0bVbi22pIkecVEmeWq2r wrH8VbT9JmSk+Vb+YyRmAAtLLUFVQfSWtyU7mwJExhXm78DA1W56xp/ShlyKmzvjkmEwZww+Zayl racw+ahQ6m4seQ9vNulkjLn5hSUpdSJEEYnyo3Yc78FKZiiSf8OJdIfI2/zqm3fJfyLduS/l/M79 /wB2nEv+yRbbcPtj12dHvp3+QOdeyPSv/9SorEs84ARHSU+FRUa0n6KH5dALkeNx8OYwXO6LLpCS gAJ2YH44VJi80gyDj51BxHqNVR08cdBP5VgCJVuCosSNf6eHmW7qtsaUpGzz4fGNmNFVzm6lg6jh QFdSvUJnibDTgFdm6rqsMhfyo8OeeVor2IttBIA18Tbhutop1NgpJHnt4ydgHnPGaKk26SqUp20V nHsazFipRJKWRaWYsxnl90bV0to1wLG4I47cpS2JdKZGEYmPPEbDsJnb1CljTCF4HGeeeFJlMOgn eGH5hZaysO2UAML7VJtZiDex8fb24SvXikoKEo0pjDEz+EdX6UaOZMhs6+JjZHv24UYDLVLiOCLR U0sW2nWJWpvM1BFidL2GnCC2uA5qXgT0YxwxEwJB2gT1ilqbQoUMdtD7l6nWoFJAqXIvJdV1udTw kUU6yCBq4bQJ48MT08CJoV2SIxml38jDLi9DDTQkjzF3ki1iD4d+P2yEhY8Ax4+33YUufEtxRhzh VPNSwmtURolrltPs9xc6eHjx59ptS4iRz503pARFNOUc14PV9RsVy9hDK64ZhYmmkQqVLmoAt7vs 4O92GEkL0gDAeXH8KTW91+100ImISJFJ51RIQx8yNpF7Ak7rePBEyuAQcaO16iJH20HIqjFU1dMr ghyuxjpuRh7TwtcHiwEAUb2TYKZqDPM/yxAururWJNjoO/0c88RT1w0nbWKkAjSilaTdYqGYEe2x 0vzzaJOGz1oguNpipuZJW8iWUC10aOygXuTbse1+XKQcYG2tW6cdNFWzzh9XLSS1fm2R2csi23MG sARY/DueN3iFd1KYHnPp0ceOyNtWuWSdhom2esGMiSRhSiysPMEjAG4G4ElvZYd/v8OJLRaW04JS I6CSfd59G0nCIovREGTRY8XwoPiJmiR6imR9DUCMe6rKRojkDQi/hwSWr6G0EYaiOEnhs2YnicYj hRHf5VrWFKiRHT+OPE47aMTkSsoKRFSdjE7FWqFKEFybW7bu1yLfs7FD9yFugqgoE4Y4fpsPl0ml VvZjpnnnnaYVsfpqenjahlP6IRgQqSLAG5Gh7HW3FozNtCAUjDyM+nOEYTSxCdOB/GlRQdSsOmqK enmkUzsE3JGvtJtfdax0+vm/zDSljUoSfMfHj7Ts6a0GxpJGyaGrBMfoZ2mlaoC7lL7BYG/j2Nhw wSpJwG0c8BS9puINLjB8001LFey1JN0kk8Gu2njx9DlGrLo2aorLXZklr3jjSdVSEMHUEEnb29vs 4jWYVM0cNFIBM0kZ8aSQ2DhmALlpFUjXQ/Dig4IxirJ0qxoNsTxDFKqAxUQAViSGI1NiddLX+/m8 SkbB7cOfZ8KS3CRrxx55/Cg0xnAqiSnm3jc5RvNZRp4NcdyDpp+XGBl7WuSkFXXP49FIFuQqeefd QXRZPjp6+Op+XV4haVBDuN/ssLk2U6fdzSbJKYSQlShiSQePlJ68fZONVU5LZknb+PrS+psKlhqZ 5KeBpah2MkkarpqNvZb9tO3Fb7WsgJA8M4bPL3/pSRCdKBGAjn1qNWUcsshjRhSyqLBGW2wn3bm4 N7cYbskJUkacPMx09Xp1Cm3RO3Gs2FmeglQSSebJACSWNh7RoTc2vbihMIUQlICQAOPp04efGeit LbSqhKwbFzO4jjYbidrK9ve/e8fYePMupUkGOPXVEs6ZnE0JOF0lM0pqK2cKUYsgYAC50te/PJX6 nk06YNRMxCiDqxkD6iTYO3ujQaf082hpKlSBVFFIFJCuZJ/JRySiH7QOrOG3ADv7eeUykKgfP91E tyQCSKB7POGU9dDLTRfo56ncgcqu0KRc3uD9X6nhdeMg/wAImcTw6BPl+uETSHuxiTzjRO+o+XBS U7V0MMsRZjJJIA6KwkJ+yGJ0902Pw5q2dcUlIIjDZBPvnjh5iYiKYdcCWiCcQIHHhx49HRQcZVxd KYMZRJKqFpP0li9wCRt3WHca6cW3lohIjSJOz7towOAnZ8NuyaVZZfd6nSTiMJ/GNvnQqYZjlRNL HHAvmoVDMgUN9ki+qNfW5B/W4XCYWSQATjxxPDyx68ffQicaGmSR8/LHooQsAxKqMigjyoRKCxlB 0C3IBNjpcni0hKVJkTjtExiCY/fM+6kN4wmMDKjz08ihvyvXRU07MYGSdB5Kq9gpO24Flv7OG1gy kKW5GJ27QPPHHn1osCCo4mjD5VladJvP3M7AEEaAAo2mnxHF4gjH8fwpxRhMCmmthb5qllufMjYx pC58A2nsPKrbTtIHvqjK4OOynLFoWqcNpN8e+SCogDHXRVO83t4WPKASMNmHPOFL3T45GFDvkGS0 NPppKSsR+0LqAATa9u/FTDQBJmi59yJjGo/Q3NWVsF9RuDy4rghzxU1OO+Rh+DVi7qb5l5iiAoTZ iCNL/dwL5jnbjLiQymVaojHbt8hQYzZ5SmDJhIrer9U/ULEelH4bfVLMGc8KkwbEa7JNZgdLSUiB kglxCn+WgjbZ9i/mezkgb8Zg5b5G46v79OIHTFRXkiNd2kEGFHCtAqqVo6aGniuAqrEF13aC3hzm Gi3UXekkxHX0fIemyp1zFR+2okcXlaN9gHRFNtp01Nr/AEceWpJkTj0YjZx/T3iilDGk8JpWdPcd jpM64dQK6qaokTE97AfT46cGW49uQ8DpHikTjhAnynCnnUANk0KfXfFYMLyvJH5io9UxhVRckm1v 3SeSI6ktaSiAVEeonH3elMMCQTQW+iX1YYr6aM/tmfCHdJnQ0tUA1gzB9w0v4a8FtvnlxbPNONq0 6ekEEHDDGZ85wxwiILxk6LgEKqzvrz+M16gOo9JTYNk7FJMAwyBPLqZoGPmSkkX7HQacEm83ajdu NErWRhsTI9uE401lm5Dc4p9tVwZu629XOqVTLVZkzdWYrLUktU/MzysNupOhNvr5CWbb0u3RKUKC QNpJJPHjHVw40NrfIGLdMxSD87MF9v8AMJb7vlPtv3tv9vs4Df507/xwxqjarZ0/d0/hPCq903P2 8fl5V//V1vv85UlZVsafD96sCVDkk6m4Nyv3cgs7xNtmQkHqnH57ejDh50fLIGBnDnprLPieZsYg VYyMPgdivuqwJB+kfHXhNmW+pZaOkwfLqkwdmyOMnh01tltKlkThV8P4Ln4Z3R71Y5gzRm3rPXpX UGWXVKDBa5gscjLqzMCde/bgm7NbFvM2nHNewxxn2cOeuk+8C1MuIAOHH8KbPxkfST0P9OvV7Dcu dM44IMLr6R2mpaIrZHjRDYbb993bkV9qQVledoSytRSUmepU4T17fdQw3Uc7+2OuMONa37ZUkgzG 08BYUqSAR+YWXaHa4tpf22AHfS/BfZ5yl6xAJSCEwek4RHGTj64AYUvfbKeO3y59vsoc860+ODG8 kYDgED1tbXiCihoobtJI8jWCAWub/Twxsd3CpttCU4xhgZJO0YRA4nH1M0Q3j4DhUtUAddGVy5hG I4RUNRYpRNQ4lETTVVLMjb4nUFSpBse/I5umlsXakOgIM9B6xABk4+uzDDZIOWgLZBSZ2UMdFQRQ vRBIbTBhMSO4J18NOK7JtHhIEbTsI/d5GPKlz2op2zSc6x9QqfAMEmwiGq8rEKpQC8RF0Ht92+vH HHyhUJ2kj4/Hh7/MvcgoxNBF6Yq4jqLj1bPMZnqcMK2IO4lakNcnw/jwcbnOIGtKkgE44dGO3y9t UsrZGrUD76NzjuNfMO9NKhWKojkR5WZ/dJ0+748E61ISZnDyoTNsymKS1HJHKRvdt4QU5J3EtsO0 H7uIrpuVAn0pVZhQEVHxaqKyA94lQo19LeGvs0406D6xRq6iETxp0wkRTrTQMwBk2ybCbGwO69iO bQZMfjQUuRBJqVmiBYYS7G0K27G59g0vzR8KyDxpxgcaLrmOMSwaP5sMqlwre7tKmwsBb8+Pr6RM dXPxGFKwmdlFxzbhf8+llmkpgjqGjKR7lRnC23bSO5tb2XPEqSt5RUI0+vlI/dGBmOLItQjr/D50 BecMlnDaBYo4CbsZpFFvdaQKQbj3vD482GXmnfGSD8fjsHQATtwFElyAtyZ+M0Dr4xXYUqiKNkEf vTCTzNxEalluxJsLg9m04tuGEvKIOJnbGH78cDx6BVmYSqVHqBwgdPnh60+UHUypWImqkkaFWCuz eZvub2K2VgQLW7fXyrGROTthUYEA+uJ2EHjPTgKT3N/bpw1BMTw+POym6l6nU8dZBIJnglpWM4aI X/SqTJcXBsdNT8PhzasldRik+LpxHUBtGzhhs9DVRe26ohwGeno93T7aNTkLqphmJhTHiAZ5Sy1X mXY9733Mbd768dUpTKwHMFHGcThj0ExjMdFLmXxA0KkcIPyowNJmOmYwhZNsJCs3lm206Em/t4YN OpJwjz9KWtqkgHbSohxeC1RtfcDrv3XFyPHmnEoUCZ5+dGaHoETspsmxmgjn2CbewsWKnQ30v954 z3rRAgyZ6/dSxu48BVTXV4zhVDC03nreENIELe81ve8ePd823OMnq56KslRUqANtB9UZ7w7ES01G wllYa0w3ks1+w7Am1yRfjP55ASTjHOyYnZ+FKXssUmATHs9/GmCizJBOqwM6pJMzxCPbpG3crbQj vy7N8gt4rAPCQRgNmH64xhxhHc5WUzBmBWefMuGQ1LQGTzZANsTQm19dSRcnT8+OKzVGgaSFESQO mOvH9TVGsuWtEkwBTPSY7TYlVjyFeJgWJUHcjD7Qse9/6fhwubuQTISrxecT0dAnZOA6cK1d2Xdp xINKyiwfdGs9QVjFQGlARxcllsDoSQNLduKxY6kd4raR0+WE4THlGPtJk3JC8KdUmgooFNNtWTu7 sQSutvadOGDK20IABn2884V7arbU2DNLtLFFPVedcB9hDf4ra2/byjbgVjtnqPrjVwnSkwfhTZi+ d4llVYCGeJ2SdZFPuqoJIGlrWB41cZikbPnt59tFrygRiaZnzhGVSdgrI6+cgFyymxsQuhvxoZql cnoHOGBJ9I6+ktcAmNXlz+tJLEMxCqkRSAZ398M1tFsTfv8AAdxwvN6YGA1Rtg+yMNu3HYJIqxaG kkq/GgoznHR4hQzXQVlQoZJHUSjaNLkXLLoPYL8RLBShImPbj0CMMZ5gYpWWTqxwB59caLbheFSj FmpRuiCkyzoFG5kGoAFyL/r4W4J7hTK2AocOiR8fxgyeNJLXL3W3FQsRztjhOMknjEUKOXqCojml Sji2Fo2jSMRAm4UEWW1gba3Iv8faH7hGqVKxUTI2x1SSJ6hBx6IoRuICUiTsPTwx9aEzA66KnOH0 tZF5U8zAWnS5Ml7BWPvAaG/fhcWkFc6oxnGYjZh6iMMPOquWOtSiDMdFDbgho4mpkkhH6RikV72v c2PYafEHgpsChACMMSeMz8PXD20X92QZnGheynWlZqlVUOzsIwN3ugXIvYfDhilkKkExMc41peKP KnrEYA0qSEe6JDcWBuTY31vrpxpxQRh6c7acQNWIpzxgBMENQBukQlmBJHha3bmmzGwjDn2Upbb1 LxNCPkCpNFTAmTy1WAVLL7NvvaaDueOXLoaQpU4AUXOojjhWDorFg+VuuGQc+YtMIqXBsepscrWl B0Bqd5v29viOY2r3ye/mSFaSEpVjgZ6gYOHs49M0GM5umXbZaAcSOmtwz8VT1X9Ncx/hjYzFlrNd FjGMdRmy5lODDIJlaZY5KuKSZglyfdRCSeT12v70sq3acLKgVOCInZOB9kzQK3OsXFXKOGn5Vpp1 pik3uJBYAbTrbT6r855DUHDGO2pretQoyqkvLWoolkDkgMVBUnsp1tYacOGrVShOn4/H2e6io25L hE4U3dP8Oqjm2kx55NkYlsN24lUv30GoH18G2XZkyytpuMAcTifcOcKW3FmO7NLDrHUVGYgw80tS wMyo8YYDQd9f28U2+ftu32k+MSUjAiffjw6uOFF7lsQ3RW8tYVM2J1B2bVjJVUJY7wG1NxrftyQM 7uUpticI24z1bOnnGdr2SWxUvHGh+wfCRWTJAg+XLv8Appm3EAHUkhRf6rHkN39/LmmdIVtJJ2bT gPhj60OC2GxO3ChAStw3AIUEEiz1i3ImQOChF7aG318KWL1RuUrQqQOOIIH7uiZ40gNqpzbspP8A 83fd2k/ynn/bH+V2fa+zwT/kmojSft6cNUzOz9Zpj+Vddf/W1t6zDY6eUu67WBBVrG9u9vjzCBnM nHm5UtRwjmTzFHFw2Eq2D2Up8GdzAkKEK1iCsljoSR4378Jrl5YUVBRj8cNmz9fKlLCwSAdtHa9M nq16i+m2prHyRi0lFTVgLVMakqhYrqdCNeGO7G8Vzlyld2swo8MAOYgcJo2ubBN2gJOBFAv6juuf Un1AZ0fNOcMTmxOolLCMzl2Coe4Fr+zi6+cFw8XHFKKj0+fpPXs6KNsnsfy7ekCi+V+EUs0+GU8M QFZUOo3JcXJfU3b6+XyBi6W+BBKCcOj27fKj3MtBZEYGnXKWYqnJ3qD6cZwxSJKvDci4pR44IZnV jIKYOABa3idb97cnjKrj8ncJdIJAgYxs2bR17BgfWo+vmg6hTc4n8ev5e+jz9SeqOVeq3WTFs24J FHSQ47uxCSgjsEWew3WAv8eA7fDMW7u97xBwVMjrjo9uFDDdta22g2RiK55gmjwjBavEztjeCPcu /d7zW09vAy5g2VExHPDroVuuEQIxokONynE8ZXEsQi+cja4ZX965bXTcbcDOTXvdO+IkzjBxnr47 No+E0zd2KlAUKvQOlhpc81vlRmFKmhlshHe0oa2niL8kLcjNC9dOIkjCcfMwfYeTT9vYhsE8zRns 0UyrQJVxkiUv5bA9yBcckB9GmaPMuWSYpLUs0aQwzbwGvsVlNrsp1Bt+3iacIkmnHW4cwrLjMqNR QBB5s8+kuupI0JNz+XG3FwYx5586NW29XHCueXZ/9LRvtIpVEBPhfWwXj+rAHjRBmDGkwTjSrxpU r6eZma8RuDt7gLrprxOpUnjSVskHrovWbqhKdWw6GHcrqTIe1lU3tp7b+PG3ivTpxI59/VNHNpbA 4nbQZrhsUs7VTPtO0GNU0Cmw8Ld9LE8MmNSZUQYwgdUbImOr501ctLIxx6aRGZssRVFODOgeOMb5 VubknXdYX7HlHbdGgASI4dHE8PdxnrJoqXbCIG0UClVkunq4paPy/KDuzzJHpfvYF/tWHx0vrbhU 7aPpVEH2AYAbT1cYnHrg0RJ/uwkY88+6aR2I9LsNeOJnppPIU/Lou5ywS5Yi5LE+AB0H5cMMtuHQ skE44mNk8naPbFLn7VtYxAmZ2Dn8KQsnQ6mxadlw2ieNAzRqpEoYFTYglio9ne/DbL81f1qQCrqw jZ8dvxIgUjd3eY7sJIiceGPWds8+VMmOdDc9ZQmirsOjlmhoyah5YRJcKoNrlLAEaXsNeHH8zUoL DqDjtIg8ZiIx9sDq20h/sxpA7pR1c+nONMtN1K6hZfrY8NqqmRmYrHFTPdy5uoOo3X7m/j7eUs8n tnkqUhRxno2dOI4enRFFys5u7VcPIx6eEdPD2fKhZy/1ezNjtfhtDhNa0lRURfpizXHmIrEr31Wy 2799T34HswsVW8qJXIOGzZhjwnz66OLTedDjaiUjiPXnHZXWZc85ky9JLPiDVIjIEbvSKdTtHvME Y3/brpfjFsw3cggKIVJHDh5efV7wKXOb4W7bXiTs54xHw6OinnPuI5nyrX4dhWJ1iyVNRQwYyflJ TIiRVaK6odVAYfva681c5YC8QskxBPTOM+Wzh5nqM7HedpaAsbD6H54ViGXc/UeD0Oa2y3PPg1a/ mRV1OGZHupK3UW7+Fxy7aFJHinSNkxj1nA++fZiFg3qt3V6dcEckzTOuM4tTlp/IdBSp59a53gK8 iMqAkkdypOo8OabsSQVQYEzsjhxJ2eWJ4U85nTemAZnZ7dvHh6UiEzjVPWxzibyXewR97AAEbv3t umvj/RwxFotbXHSOBnhgeJ9MDPGZpM7naG0hCjt2cZ8un3fGoa9SqmjnZ2mEMkaNEYoy9tg0JLKS R30ufHlf5URqUNUEcY4jZiBjgBPRSK43ltgdAWIkeflGET5bad8O6wVyhFFWEdUC2ZCDtUG4Frd7 e0c8nKXg4kgKI4bI+Hy6xFU/nls7hqnnDb0bNlK/DOsWJSwxu9Qrxzr7rEOD7xta7CxuCfbxGWHE Kw1kA8Jj47OnZ7K2t62VMH3gj3df76lr1SFbUARypAGCoEYlSSOxvc3PieUW45IOIG3DpOGwzh+N MvMaW9swceeFQK3OwepZzOwp2IcJIxQsAoaw3BtbE/Vxly2dUgABWonEjp4xs54UWKGkQTPv2+Xt ppkzxOzy1NVVKqxhkji3e6m621gupNr+z6Ty4tlKxSD5wBPVgAJxx4HhspJ+z1Qn06+dnypPf5xY DWE11YfKkWNUleXeNACTZyCRrfXX8rLmcucOKdXHhJHHacOr1HmX1OthOoKAEno9xnbUGfPUEzbo ZPNEn6HZvdCAXAuulu2pt/bzX8vcKJGoGegHowMCMeAI6MeFVZzNgtkTIHGPiNv40pMkYA+L4sas TLPBNcWpw7pcjdqXAJsO+nH7lewYkyMQMDE8OPGejr20pZXrOpQx9mHDD9duzooxOH5eioJ4nqIj UU1lZvlmKuVQ2tb3rkjxIPC5nKlIc8RVEg7BPuHDgNowiKotxXl51JxChpVFK0FVEWZxURr5U4kV XFrEkKpNh3P1co8whloYmNkaYMD020qtwpJIjh1dPPzp/wABrZikySxKGhtKkrNoQe224H9PF9hd uBvxaiJO306SRx6fScKTXRCFGBj5ULeT6JaOBJdbubhmubsW3E3t7Tw5twsNJiSOv24xWnp0A8aU saTvI4uJUDNLqbXYdr97jTlHBIw4x1Ve2gQTT1WSI+HiJCu5gvmC+vgdB2+7nmkFSuedtKnF6fI0 4T4ymX8MqMRqDspZFFKsagliXYRgXHxYcRZ80o260jEqHPXzwoP3awUKikbjeaaKopqk4Ujv5KK0 hikJZCrC9yun3E8gvePdQsNqUhcJTB2yQQZ6hPrIPDHAIWlglS/FMmuR6pZlxbAabBsWxGorcMoW 8yio6ueR4kYDQhW0BHa9uBXMs6dctwyszO0gCTxxkcNh4+yhJk+Xs2qpSmkVU41i1QXTzTHA7Fdq XB0t7LjS/AcjL2EkaU4n2UdPvOLG2mzA6fEzjMCSVMjRTOFlEzke6T31PfXhpfln8uQE+JIwwxnD 2cPx2U1aWx70eLDjRncIjoomhpKNt8sXumSIhhtt8L6n28j63tVQpSiQuceiPTHHh0UJbpBUIGzo pu6iwHCsBnnch45FLNLTkPsb2ttJK+zW3DLdLdu7cfS7BUjaSggx5xiOuYxB20gzINttYmJHRzPp QH9P6KSoZ5WG8SGwUXW24G/8f7eD7ea6DCdOokdGz4dHUInYa9kKZTqJFDHPMMKT5dEtUsN0kjgg Ae0HS/8ADkSrUp5zWfTp586EDbOtZPCkuKxpKhWaQqv6T9Kg367SBf3vHtrw4y5KWlaiSkAHEAdB gepw6hS8sJ0xFQ9ze2T7e7sO39PF3f8AntnhzPu+Na7vr4V//9fXsxGk8wRzX3q928Dode/18wAt lqQACnD4+nD3dYG2hlmFp4zTbSI8VT5UJNkBcsPEG9/D4+3im5OpuAk7OgfhMUWtthKuY59tKiEf MeXTpf5iVtga5Gl+4I9nCLSAlRInyH4GNnVQvy1sqI66MbhnTagmwaIyoGmmRHuxse1vHkSXu9Lo uDGyhr+WARQTYz07fBK1sZ3WTDg9WACRqBYeGnJr7PN4DcPpBTOnE7B7Osnq6BtNEWZkaNJoqsMl XjmZsVmin/TOzTOrSGwuxBAACkD6fq5NOeu901qUk4++TOGzZ1evTQXsGgXo2xz5fhQ05DpqnDsw YVOJAzLIEdbrfaxC+NtCTyOvzyu8B4CJ2bNhiZmZ24e+hRapSk9FGd6sZkjw7LtPQVLgTVbr7qkW IGtyb2HhwSZlbko7oJJKuqdk7fl8dtLxcgKk0VyqxalmiacyAi+ttva9hqbX+ngSbyVweKDjwgYH DDHbHn8cTVN6g4dVCb0ixSnhzXRSRv8A70QTQIAwtuIuB+XBpuKn8vmGMjwkdI2/v4/Knw53rYgc aMlmysdMOpo5Lq9y3me25N9DbkxLbSqZFP24IMikthgFRS1Ba6mMh43XW5NzYajueIENpLmNKn1E ACKyYrFOsKMt1dBZGkFtRqe9xy91beLZE0vsXpTTTgNfVQYskUqqFvdduh947Rc/0csq1kQBjTGZ KSUddC3XFoaAs3ipLup9vxHGTaqAIiie3QVOYUC+NRQ1Zmjli2svvO7WPu3v4DihtmQJ+A/Gjy3W UzSAxEJDC7UyKSdse+z+Ita1r/eOLVMlEDGn3IEzSJnqWklMUm0hAx97v9xty3dKBxTGG3roldWC qTspJVtMZZGkWFUYXYi1xu7C1lv48Qv2Ti28U+IdEe08fZ6TRapoBZPPsmllguWoauroBWqPlpff ggW4JYBib+A4rs7ZaUgKxAA2wccflht9el9LWoUYbLHSnBKl0ro6ZYWawSnjAsF73sBrrprwwTao BmBh5cil7q0pbCSMaWmOdOqKrgkpfllFg0jdrsO+tx4Djim0kbcKSsnxYiiR9VPTCcXmqJ6KlSLz h81IYwwd2JBAun9HEX5ZSFFSTj5ceHED2zS5zL23UlJAIiig4V0ezdkLNaVeHRvUU+EzbqyOo8wr ta5IuQ3gTp93s5ZbyLiQ4g6hxgcPccOuaBuZ7qaUJLZge/47PT1oWMz1eXcTjpoaxUgnqWjR42uu 27i97a8Jl5S4ohwJUk8SI2Hz+fvmgqvL32SfAY91Scy5BpMQUTrKNR5QdnYrsttGo10078Lcys3G X0gGQekdfCB5bafsbjSAIwmrD+itPhldkDCMEnWKpw+GOIPTvtbZKihL+9e2g4c2rUpSeBHH50SX qj3hgY0w9U+h2RcSwrHcS+TgpKmnpppXqk2RgHy91ye3hw0uLNstnUMemBgfxFJmr90KABI6sflV feD9H8AeaKaSTdHGqPC5bcWNhctrbv7fC2vEKLRS24EgQCNk+88PSJ209d363EkYjyMc84UA/WzJ 2GZbimmoJ7POy0lMyt2JW5tuA+yAfbbjuRtrbeUlM4CeHH24ezpnpYQSAZBnDj18zRaJKiZCF3hJ 9pYLuJ0ZdtzZba27HTgwNqVLCtHuTB8zPv8AgMabfShAkSB5ziMdnDqxmRt4VLpWqXjcRy7pBeMe XMWCot73Xa1iLezmnLApROkjolKR7dszzNN29ysKETjx/Db7cNnRtbYMTxWKeaClrQ8sRHmMHKRq SNPFgfhr7O9uOIy5MJ8OJH976ycMIj9KUNXz0kHWYEDb5Ywfb1THGn+X+slYx+R86KORPMo4Z5nk IjFvcuybSRYnQdz2HE13YWyCNKcCcdkYeRnnrml7V5fOKnEdYx6uGziOn3muFDhuYWZYpZLGULD5 jSqjKFkFhd9hCmw7EDja2WVSQjCcMBzs91Krq2vhAXPx+HH5+/uPLdVUTRIKiNhIWAKMxJ1ZdbgD Ui9rXP38atLxIRgg+kfj17ZwHoadGSO6AkYah0wBhtGOo9fWZ6qErCspVkzQQtseeYEByCdzKb3B IAFwugt4feSXd4gYpEY4YADZskT5zj76PbfLkIAKyTGHl5QfKjhdLsuLhFJRxSypJuJd2FypIXUG 4QA3Ps4XNWanlhegwJ2gdYk9Pwx9h61bpJ1Y8+uz1oXcSoaRlinRVjZf33AJUXGvs9vFLjfeqIA1 egP76XGyTHRQc4rUSR1rxmQyo92QrtYm1j9PbiW7be1kpHiwiQOGOBwx2+4gA40l7oQTsj3889T9 S0vmSQOLrFUNtZD/AKo7G4FtDwwtLUnECBhgRHy4cmilahqxE0KkAq4cLlhV9iNZIBu73BJa4+Pj wwKSMCatgoTSswbYlK53lpFX3pDci4tfuPbzSreDGznn0p9ThKRqqFimIpSnzGZd0yhIwBrcC3jf x48BtAGNI3VayeNJfNgo63L1Dh9WsklXXVKVNI0LKqqIVBPmB1N1s2lra28NOADfTNUWzELBKjsg 4dcmdkTHuovfYUtQAwHGpUmFwRRjaioHSNgyXAJCixOo1t8OQnvjmDtwZKRECPdHX5YDoilFlboQ jp6abTALqCfc03XI7k/D4cAqEFUDEk84T+6rOKSJIruGjdwiqV3E6lvAeBt7eNBzSZB8tn6xzjWm 1qKYin2iwuoaalhhiE1ZUukMQQXLOWsNTfxPGUuOOrASJ1eRx9cPSlzelCSVGKFzFsrZu6Z43S4T mujOGV9TTU+OR09QbeZSVKlo3VmAuD8OCfebc67trUIjE4nqxnacJ8uun8ozFq4UTtgxQNdT8Zkx KanpDL+gdrMF0JHYdrnl+zndt1oqcWnACPdt4x7p4mnt6LhOgAbaVWR6WjwvBoKyW+1zuR413PY6 E2O2/ja9uFW9qWhdpbTOkHokxx2kTh5ecVTJUrU3HzqJitask7MkodW9+z7QSCTaw1t4X78Dptm0 gacev2xh8RjjxNC9pOgAHbTdStXyyxUNNJt+ZstVGHWzKrh136gAAgGx9nDJba7doKmAsDDCDjOM kjDr4ikV5foakngf0pZ/1eFr+f8A7lstvX/K3tf6Pjwq/I3n9AzMcNvRt6OPvoOf2kRMdfu21//Q 1w4cyvhySw4sh8mE7VnII0BsDdv7OYJu5Sp9I7vz5+FSc5a6XYUD7KUtDPBW7ail0BuWGt7XJGg0 4TuJdYPdknEcKL7i1Tr8Ip4w+up4sTpfMkAljKLtYAWKnsbW4les3dKk6YVERsnp93l7aNsteQFD HAUbTBszx1KRusnl0iAe8vYLYDXtyM8q3Fcv7vu0DCduOyenn0oVXGYJQ3Kuigr6w9TMHo8r10EN g014GmawAvpbwvbmV+6W47OWWpCE+IiMeJ6cNvp7aj/Mc271ZjEDnZQF+m7ornjq5mg4L0/y7V5i zDj8pFLR0EbGyknVmBsqi/cniHey8cfIbQNWmJw6+nHbwxnrkRSuwuW2xrWPLr+dbF3TT8CTqdh/ SrF+rXV3Mf8AV+qwSkbG4MKpgTHGYk3hXd9W7W4a7u9nl04hLrqSlKRMnDZ0DafXaKLr3PAlUiMT WvF6h8cYY9i9NBWB4cHqHwmCSLVXWKQxlgAbG9uFmTqRcXa1kAhOG2CQCcYxmPZskCn7zNVuJSE8 efSjX/ha+hmq9cHWaPIeM49/KMDpYDXV0ilEaQOWsqi9tLEfH6eSVuhkdpmdw6lYTgAQBx6PUYzs FEeZ54tlICDE+vPPCjJfiK+hzA/Qd13yXlXJ2YTjGH4modo5XEjxuAC5BHhY8K988gby2/ZDcYkG MY6Ph6ChTuhnC1ghZkDjQDyGmr6BUncTSbvLZTe53ai17HXguIhM8YqTLYDURhSEnaanqVp1/RRy AjQC47jiUIOmYnppVdJgbalVVSzUqhGIZLgtfwt8OXUUlMgR86dsSEnzpPUruK1FAu28eY79iAe3 e/jwwbeBAIEc89Qrd6wdooePnIUpIxJaQT2QhyDa/C+5ViJpDZIPedFBfjeG1BerkFrILgqD71hf w5UugdFGPdgYg0gK6oWDD8SjFIBU1qwU6TMFPkLHKJWKA3sW2hb6aE+3ipJUlMRtj0HX11u4RJSS dkyOnDD8aCWtmkpo0IfzZ9Uk8sD97+H381crUE/swPfj8MejH0pEWfFs21xwdakyxvKA7u7xeWPe N7fSOO2jhSQFGQThO2PfSC6ZSVYUNeWcGknFLVyEt5Z2xI17C52ki3FSTB1E0YWaZIHlRqss0vy8 IiKWKLuDeJtc9+1teecfBETxoxNrr8RpdQUlFUuKioYL5yhI1OhIJ9nNNkHZSV+1KJwrrFcuU0Iu sAftcAe0fTpxUpWpeNbtXRMGguzB0hwusopjBToJK1xUu8g90tbX6Sb8q6nVhRqhScaLfm70x4ZU 7ZRQrMU1Z0jRmLH3Rrbst9ByptdQHgBHPGrMpaWClXzpI1vp0r6yn+VWmmaKL3nqQzKQ4uQLgg88 5ZAnFA4c+R5xpNcbr2qjzzz0VlyV0/ztkeoq8PwLHKhY6xg+3EPfRW+BJv8ADjSG0yUcRh+tEl9u CgjWBHPRSa6o5E6v5hy1XYXJnCSFsQcpLFDE0aGIpaxYMbkk66duG35VpLZSrH2+8c+uygYjcZ9x fhIEfGi0Zf6SdaaFWw+lzcs0NOguHhYsFDDw9lvjxMptkggHThwJ29MThPr6UrO47i8SMennn4Uw Zt6KdS8Zp4abEMbp8SEcvzEPzVLTzBNx7Dz0cAaXNhf6eO2t5+WXLcEnpJ9u3nDAitP9nSHD4pAA 4Dn20FSelbMRCfMyCSBnYgU6jvuI7aHbbt+ziu7zh0EltPiHX+v4Seqm/wDY/tSZUVTM+Xlht8ya f6P00VcVM0sbv+gsvy7sxbeLW1LdvaOVYcLhGsTA6J9OGzDGfnJg3ulYMqIKJmNvPO3qpe4R6bov k5HnTy3ka6jywChvr3J05S2f0AhWBBw2k+38dlKBljDcd22B6enRS4qOkeG4caSmgpUaUL8vJJGC dylST2Px4xerUtSdsevt6f1xmk6bfTJOIpIVnS2COqDy0qgIpXdEq7iPM90WuRdRfvwuC3VJTAgg zj+kGPUHowmrKcRp0xIPTPRjQf1GTKemxSWljjMR3qaMOoIO032htwIHibffwqcfUZMAbMOmQRwA 2no4ddWYtmkpkJHp+72DhQl5cyysU8KyIJ2jZl3WZhuNr23XvroO37eJ7JpJ1QnHgIEYDZh6EScY Oyi1xQKgQOefOjB4RgscEEWyJB4sdovfuTp434foSSnYAYj0+Q9gmju1ZKE7fwqFmPdTwqkN2RrJ LddQDoe540Z1Y7OOyPPGcOnpwp14gIOGPPRSGxCeiNVTWYrMpKlCLM2ngASbW8eVUpK3AqNhI6Oj Hq6P0NF5ClAwMOmlPAImhiSBfLZyDT7u4LGw+Op4udc7sSkRj5Yn090dNEyUheqRspdbpVpKOJyX KuGcgHabjb9H69+LGynR4jjzz8aeCJJpV0NIHkIjk2qq+WVBHcWv424wpUqJ204p3SmCDQe45ULP WPTifckDqqPfdfZa5GvjbidTrbbgkdXPONJpE4GmzGK1qvF6Ki2qIsKhEciL/jlAkt377bcgTtQz Fxd3pOwDDjtnn0p23JJIPCl/WinbD8JjpQd8kBWd1ud0qi+0WsLKO41Px4HM6ZDlrbhMklJ1HadW 2MBw4jaABtik4XClE7KD8uyvZz5lvC5Gun66cBiGwRMfp8ao+tCzFGV9KHSfHutfXDp309wvAZMe OYq+KmOGxgWZPtMWP+EW1+HBNuhk6L7MG2wkKxEiffs93qZoPZre/lmlL2Ac4VtUZ3/AAjx/E4c2 4DiMOWsUpqWiFFgeF2FNHVQ2Lu5Y+8xPMhV9j1ubzvAkJTtwwjyAw9tBhW8b4Z2Hy6qI763fwqvU 7Nl3GuquORR11N0mwpMBhpaND5lTh9IDM0mncgE9/DiHfTdi7abJclaBEEcB7R5GjDdreFIVER01 rcx5OxjEc3JSVu5kjZnMwAMape4t9XIdezy3s2gQSAdggEcTxx6I6D5VIz7SrnEbKf8AHMbjwzzK GjfZBQXpYSL7dPHS1zfgascmduypawQScOAg9GwcBwnCCIo1t3EMoAFNWWzU5idjJCwjRgfPXRdo Oul9eVvmWbMqQ4jxK2EdHHr+HX1eu850jbFDLhdHHh9NUtDtQqjU80u0B2Ut2Nj4ga8JmXXA45ol IIgjiRiPYeMGNgmgXmN9rHiNO38zp/J8vYn+R+S37Re3n+bf/iXh9Hjxd+Xe7uO6H2RsGzX8evb1 zjQd1GdvPTX/0df9csLmvLG1Kb5irnW0cUagt5h96wsNec9TnH5a8SmcOP4+/wCXnkO5aodbnYaC KJ8WyQ9VhWKU7QvThlZaiylQL2BuDYePJHVkrN8dYMK6PnH6/OgHfrLCtFRsLxiXE5zLEG3ITaRl Guvex1+m/EuZWaGklJMjYMB7efbQb8YXPP4c+dDzl3GKx6f5JpGV5VIFiLk2AN79uR1egWy9bRgj bh7fThzgKbS71JhVBn1kpoqfLVDRPUhJqqQMFdgLC+hAN+58Pz5PO5ubasvaJw44Y7MNnDp6jjFF t5bht3w41s7f8Jo8MyCvVrMuHYxhNPXYpBhsIpqqdI2MbMpIAuO+nJH7LGGLly4hsFQ4kcRjOznb Qf3qdLXdEmAati/4UA+trF+g/RDDejmQZPlMb6nCTDa2opyEaGl2e+VsfZp9fFHalnBtkJa1BIjU evgBwn0MwMKI7QB9WGIFfP06jYg8lbTRSS2eoc+ax2+8WubdiT8eQpuqy5pUsnbjs9duEjHEjGYw oRhswRGzHjyKOl6VvULnr0wY7Q52yJiT0GICMRVAViA6gHvt18eEFtvI7bZkXG1lM7SJjiZ44eWF GP8ALkvoCSAeemovqW9U/Uf1NdRqXOebsVaqqaJDDTszXEKsbtYm412jXgwzZ+4v3tXeFSumDw8w dpjqHGhPk9gi1BMClPgGNRYnhmHYrBMrQyCNrxtdWeP3dPA2I5LFs2tTSTMGOIoX29whYkYiusVr 1aq3MS0jAytsIAUX7/RxhDRSJnGjcupUmuFHVQzSOjSaOAikEat3+vmiEkFPCm2nNCxUmOCNA5Hu OWUqQFJNj9ff6eUTAxHvo2eUVJjn50usJrlqYoKWoUXN/e92/u3+rw5VTYJiiIL0qmmvGlqIADcS RSB0bt30sdLHw4kQBqxo7YKFIOmg3rPLc1BmCkgeYrP4WHt/p4aKPdowOzn30jLxUrGgqxN6WaVx sDNqIJL2G6+p92/s8eJ2g2Vknb5cefjTT5UcBsqJkZpa3F6qlii86KjYtJJuUjdIPsgW9nH7JxLm vGETEY8fP93phRW8hQcAmjh5cws00ECCC8bD3QliA17m9x8eGCEhUkcKP7IAbdvPOFDTh1Cs1NuQ 7XFo3Um3w+HCpbeqYo3AiMKVlFhQvRpI+4QqyIg13/Tfi9tiIiiy6eM4GpdasqOtnsd4ungO3ieW 06lbdlaawEqrkK2nZjTtYqi2YnaBoPC/FQdEnVVWkECRTcuOUFEkzSwrPtG+OJyCQR2tccsL4il7 VmtcU3S4nhkMAlqj5Jmk8ydSABaxtf6OKfzAIAnClfeJSodVMVdiuUqyW14vLABRgF3FrdtQeeTc NKVjE0qKHYBFY6yly3UwxqrRySSWdfMKnwv48dD7asBRcvvUyQIpEU+XcBw6nrp3RGWpYxK42k7S TYa/Txw2LZE0y5drURjSSxfLOAMqIsmqi6yKFB18O1h9fE/5NgEhWFKe+UcQKbpsMy9HAkYhQsqa uyxlixNrAc0pCJosWXQukqMu4QIWZU3sXvsPxPw48HSk4CBTLok1ExajgpWmdI7sCEMdhfcbG507 cTLeCTtnn9aQqgoAmKDjHVEVT5iQgAbN222n0aezicAzt6eukDqzEGkbiUAn8smIKEDG9gASfZ35 5oFJhRqiGwBM0GGJYHTVlUryx7Z4txWVlQlb9yCBqfAcZfs0KwIM4CY8zMxHHjApG+paFEdPnTtg 8KwyoqkSG/lPv2k9/o/XvxDap/ZgInA9A9R5xtxPDE0xaNeLChYp54aeFTUq3lkEKIdurW7+8NPj xeVJETx9Oeqj1La9OFIjG62PGIaf5aV2+UT5dZJ4oYiEViSPcGpuT3OvEt1KkpIEEYdccQDGHCqu WpEhXzPPpSNiw+JZBNEpkmjTYui9mFxe1xcePGGEocWCnxJE4EbemNmA48T1mklykpQR1zz1UpqP 3pqYuwIEiTFdNt+9rD7uGxJkCcRjx6enGOMD0BG2ihlJJJ555NCXU1kckkCRIvkoSWay9zqO/sHx 5oo2zxp1KfbUnFMZhwjAqmuQr5sqmKBtNZJALaD2DXjN2rQ3qGMc/vpFcOYwaCKlrJK6vjhZfNMj HdJGqhQqoWJ0sP7+MX+YMMMqUtemBMno+HlMfigQSTIOPRSYo/5tT1tZU1dO4lrJZJpB7thvYgar bsBzHjMrqzuypxSwSfP9OnypM9eqQuQcOfOhdwWHFq3DovlYnjEUnmoXCn7Sbbm/tv4jgXfzhli2 0hZlCp2AbRHXt65povFwj9eFLjLGSTUAtXgNIhue1rfVbka5zvEZ8Gw0rZSFmK2YP+E9/p8wvHeu mcurOIUEclJ05w75TBzMqljWVL6svb7KgcyV+mnI+/cdvlbQNIngTt4YyAKA++KyXEMk4DxHr6K3 EoseQNIrrs2nuwsO/wAfZzMlVrIkUERdwTNVzet71ONh/px6x0HT3LNTn7NeJLiuSMLwjCITNdo4 RA0jbQQF3Fhf4cj/AHzzaLFSWBqUcD0DpJ8uilGXXbZuNKumvn1iTHsCrcWyvnDLNVlvNEryQImI 05iYO5Nh76jS9hpzFS+y1hxSC6kzhJAmcADww64wwkGZNTBa3pQjSk0HVd0KzzgcVFi2cMFqMNw/ FfMmw+euTYJgWBLJobj48Jc9zR2yCY2D7SOHWNvtPtFGeXPJWNXGnbDqOnw2njpqSFYhuAuQFNwf hr35Fy9TrvSSR5xs6engBRbdv4kmpdVO0IkjMu0SlfNChVDAG9iO9uHZcS2VJSs6YE4DHacenEcZ 27TQZfxqD89Reb393z/lL3Xv5N933+PFvep6tn97t/GMOjqpiBP7+dv76//SqG6HHDsLbCK2rKSx 4YWxCVZdQREtwLX9o5zJu7oozRDixgDPScAeAI9n61kQWiGyBQD9Zqunz1nbGMXp4VpIqt2PlxAg EaoBtHb6Lcly13mUtBIwmejEYRtJjhgKj/MssLj4M7ONIjKmXqGjneULdyCGW3vEj6bacJM2zRxw GTh0fPDDD8cKWNWTaBESeeeFCRhlNT/zOGIKAJnWMDTsTbX48Cy0OXBCAcVbOkyY9vPXT/dIQSqg f6410+K5swbLlHPGuFYVIKuWOJVV5JSApLspDMFH2QdBftc8yPYcTl+Xi3IACUjEASZwx4+WzCdt BxMO3AImSeeHPTVlv4Xnq5k9JvXrDsy1spjwHFFXDq82ICbS206k+3irsv3rGXXil7Uq4HoxmMev ZRrvTkQu7YHiPjhQ9/iq+r6i9WPVLA8aoKo1eGZdhlhp3Q7o13iMDxtptPAr2072pzDM0qakJAj0 9o586DuQ5H3KcR11QRmqolxTPlJRRMWiicFjGAw03XIAPwH39uK91lJby9RP3HZEbfUx1+WEHg9d CFYbcMJM+vVt4H3UKmNZpwDKWEQzZixJaaNQDHTggyuTpYKGufz4Ft390ru7vZDZCCcTh+Ps68Nt LWb9DKNRGIooWffUdHXzPQ4JRxUODVCmAbS5kmCuylrhwfDvfmTtrukzblIQjEbZGPViTtk9Z6ei ie4zFxeo4n1gdPAeWOyjx+lrN4zF0gokpCzTYNLUYZLJM2+7Bi66k3+ywtx/NEFKpiMOj4Y+mE8Q KHW6913rRgzjz60N/wA0a5ffkAmsFJ3EX1Ava4BOnCxxuBgOemhihzDyrErNA8arLfa27vpu+m47 n28LHkHV1c9dGJ0lEp288zSkWd0kW/uqx33Hf3hf268o6Y2UaBJW2Kf8Jq/LqBf3ZTcDdoSbXuAb cqlRnn8aJnmhrI4UpZJqeQbWbcpUNsP0a/aPx4leSoKwiR04fCjG2VCTQcY/FTq8qKQsdh3B7EfC 3Hk64x+XPO2ky1gLGFBZiFMYoGnYExKGOitot/tdzxllJBxEiOA/DbTb6grYKEjp3g0crUjRUhCy jzHlUWLM2mvtPD5RKkiNlILdsh2aNdTwR00MRRf8iL2A0JtbuPj7OI9ZGJo+ag8ONKzDJTNFI7IU tpaxvcaG/s4w5J+HONG6ICYpTUlR78azIUSO7BxYC40+scUBR0wRz7aQP2+nEfjUPFaymjlYQsA8 wBjXvt9twDyoUdRjZTIC1JxpIzVcUla36YKGjZTbW1msPH48oHQFeVKUJ0o2UxVOJ0/mupkBWm9+ QsfAEe0682CqJNPtuaR10DGfMw4lPLSywSbKMsfLT2+Fz24rSkpIxpSVBIE4889dImDHkpoy88hR aQDfM7a73O/aLnXtxpA8ZMc+2vOXpECk3jmfqqpDrT1qUNNTsYoJVurhQAx7NbW3PfmVpXB2c9Jp QzcoSmVYzSYrupOM1vkwYZiAfyisbsHLA+0EFgBe1r34v/MqKEkGZw8vWaJ0lIcJIgc7Onpp+oM0 YtNHJUzVJkCHyyADYHsdCT99+Jw4rCTz7auq6BwFKnCsZgaGKWoJbe7XaQbSD7Ws1/HisL1K2Yc9 fOFIVrOOOPnXDEMYpgTJTT+8fsSamwB9n08dFwozhE0XbCQTWZcQNRFLKZxK4UDUHXQG3c2OnExH PJpKqkljX6S0kFnY/wCUZTpYakaN480mAmBz8KTKROFMS0pMIZ7eYUMgHgtze2h483OE7ecasEQf Kk5UYTE6VM1QNzAEox9rAjx54LhMGqXbOpOzEUiadvkqnywV2Rx7meQglLaE3PC15C0pCW049fCc MRqxPlA+NFlo0CuQMfjSvGKRmJA5GwEeWZDY223P9nKF9KzJwHOyD7qESUwJNJKsxeOpmibD3Apo 3ZJza4fcLHW+m0i3ErT6Q5tj0EHo9eHD1pyUkEKGMVkbEKf5elSKUGZ2KFWQXRRqpvfW/wBA+vho zmDaVJCvDtGPOPu9lEDg8RTGFO2HLCjw+cVWWx8wICASdPiLC3t4664UkmcDz089HGkjkTgZFKeG qp5GmKrfY2zQX3E63Av8OOJcKwQQZHHnoqqARgKQ+f8AG43xHDMGSQGOlR6hhGblpHA7gNfQD8+I LpZCwAY+OOGBnr91IH9JMDbz1UsMi4BHBRtXVB3zSfo95vbXuAGNgOQh2v7yOIaRZNzqVioQNnDA E88aTBtWjCl9SZU/nMloVURX1ZrAWsb67hbmOhzpxoRO32evCixnJVrXiaX2HQ4PlyE0shWacXDE ncLgkaEEi3CO8Ut9ycdvV19B/f00IGLRm3THGuMWbf0kkdMI6fZutpcn7+NmxiCRPw9myrNuhWAw qx30D+uqT0vYjmSlxCrqaShxuNvOegnaM6i9rA6n2X5kl2S7+Lyhtxlf2jpOn0GM4cJiNnCgNvTl qX1JUJmjD5k/F+69Yjnz+S5OzlUvlbHKiKhppsS9+SFJmCE3FrWB4MR2wXrtwptC1AK2bMJ9hwpG 1uwwlkqO0Ctof0MZGqqbo3Q45jWZqbOZzVG2JTx4hEj2lnPmPvYEnUnXmTG7lqkZYgateoSThtjZ QAZCi+pUAQefKqIfx3YMg5KwzC6afo1/VrOMlTHimBZywqNTTVCJKhPvxgG1+4bkJb/NptAsC30S JBBkH4beNDbJHO+WJUdXQa1+uq3XrNvWChylHjxSnpsq0JwzDqOlGxQpYMSbHU6ezmM2+28Tl+6h KcEo6ANo6MfkDwjGhq04GEGBtoEIauR7ylksuu8i2gHsBHAwm+S3sAKuHl7Rj0T7dlImUd4rxHCu E1VFUzhCq7Y1ZmluRcEHtY/RpxVbPomHBAM4zt24jzMQNnXBpHeCZCeFJLZH38z/AHTzL7fq+/wt w6gf0fejn9OE0l7vrOyeNf/ToOw/Gq6GJ4aWQwkgxyDetyCAD49vb25zwzXJ2kO6tnV0Ye3H9Kn1 m7LgA21DqEjjaJ5ffkJ3bAQV7dtNp/PiuySygAkBXrh5ESMfWPOim7SRM+2m+mqUSSWUhaddSiBb L7oC6AfAePNXUPGSAkbMPTYBx/ecaKnVEKwx559KdMLrHjlevcbfkUadbEeAt2FvZwy3Xs0m+SdW CcTwjr8pOyceg7KrcFXdGTiRRbcOxaXHs74ni81QJVkLQo0q9yGBspt+2x5KW8pCLeJ1lUE+8weP xjZhSfL0nXBER5+VGSwSghipVnJ2yEB45FIuDe/fXkJXOZLauBowIw5+GBwjChwhwJRBNTJZjJTz sCZTtJFzutxlLDj7wO0nrkyfLE48PwNEb7idBKYomWec9YT09xKuxSllixPMVZG8I3uPLpgCWUAE XLHxseZk7qbnoFogkiCdnWRh1njjwmKji8uld4oJGP47Pf8AvomGbM6Y5m/E5K7EpXqHYjdPMwAU 7iBYW93QW1J4OrOyt20gCAoCOOPXM7cZ2e2i5WsEnYdh8uIAk+4+UTimWkDx0UjhNzJKEjRwVAXc CTqfe08Prty62QFEbSY24enlzjSlltShESPKQf0PV7aue9E+XYIfToMX91Z6vGq2eQDQhFYU3vHx uV79uBXOnAHQDinb7hh6GpO3JZSbYqA2k8/h1ULksUtBiNQgCvBNeRApH12v7OeYRrbxOyhIvUhc isTVExp5SVCFTdXfUkA9uMXTSUJ2iefWlrKypWylfhmyoSnlks11C7Dts1mOuvEr6UlMfjR7YuGN JqYZTTy+d/ucJ2rc2Hb2C/18LW3sY48+zkVa5sTGofCnGTEEECTeYtphopI730Gnjx51pCoUdvrR WytURSexFGqiwBAka0hJJOlrezjiQAjZjVu88VJuqw2ol+VgDbY2A3SoTqpawHGV2wU5IOHOynku 49JoxuRcE+TokdqYs4Il9+2ne3fitThQnDbSVLSlHqoWlSJooXmjsZmUEC17XN9Bb2ePGyqQAdtH LTZAgcKd1qoIKh1VbR6KEOl/et8OIO+HEUYlnYeFTZKlVJ3xttCkhYyO3sYa+PFIXAx2e6qvKAM4 UHNbivlzVtVI4EcQaOlhX/Fa39nKtRM1VYMQKQkuNVE1Qiyv5MTnaxU6hdtzfTja0gL2YcK0lBCY NIzFcYYVbRLKRASbyEjQ38fv4obtwU/d6etUWvQiThSUxzEYGiu0oJiugEhGgUaEWNuLNAVBmI40 k/O9eM0D2NV88ckVRKoaM/6TIrtZdoPbU9+XTCTPz922kzl1qVAj2UGmI1zTUkrhl82oZ5Il3kAu y+JA7Aa+PCVRbfjVGkE9OMdABnrwnyE08q5KD0x1c/KoeFzpTVPylI0YphIii3cuW2mwAufeB+q/ D06jISsFRjriBj0YdfCdlJ3FqWnWrEnn4fKhOwbHqeOCGmkIjAlNMqELZtxJJ7m/bU89avtrSCkd W33fpReoqCjjSsdlkvtlQwyEx7IjqbGw8P48XpZTMzyeds1pV0sQOFYzWrSTCmp497e8584g+9qL Wtxlt3o2dFeTESTjUyDFVaNlaS27TbGFtc+y1vZxpHixHnTThw6aywOlQYYZ12MxLEmx3+PgPhx1 TUDq9aTJeJJBM1zaiVapFT3gy6mO2uviOeTCjGFPoJJmm/HqMQRFSxCyjefK0KkHTxHKaOFec2Rx pCRYbFBOqSuCrbi7gBn9/UmxIv39vGlsgwBHv2+c88KSW7afuqFjUFNUUaRBQWBK1JbdewsNh7qR 9QPEdzbtlGOEHaZ559pk30UH/wAnLB5xjk2eY4jWcsvvsm217LrqPbwqZsC14gZ2QJJGPVEnhs24 Unu1gGAPjxn5VIoqalkMFT5gvKDtndybA9j8LHhlcNoCAVKBMkzgfYZ4GOEDz2lzi16ik8nn0par SiniDdpXBcufG1hfW3e/DZtkaCREjnZPTRW4NJNOlFJS01JVVNS/6ONWn90jQd7nvzbLaI1cAef3 VeVhMk0DGERS47mSbEJnYK07uryEWCsyoLWvYW4W3DKG9Tq1ABOJMmYM4bYHRPTs2YoHnyZ6wOce eujHUSzkxUNM4MSdkiuAbW1BF+Yjby5j+evVvFMycBJM8APM9GGNED+ZLSogGhKoK8YdQxUkShpt TK6e23buP4cAOYW7akEYAk9J/HZt2/gaMsvu1TjUOrKzSuuoNg20AGx+v6eFoZKefl++j9y4QUQR TPJSyqzlbqzm24XF7d76cMmkygT7P15FElwkTUUxSptZl83zDtJ01t4ncRxUw+gExht4/DHnrovc InGldhUpp5IKtfdlh2yxC/a2oII79uLktOtnWTwBAxG3ZjxHSOPXV0vpgpBmrlPR/wDiwdUugcVD lnGaxsVy3FtplikYlokBsQL+FuZG7i9qasvSGlEFPtHnPDZ1dFR3mO7wU4XEHbUj8R38RXLnqxyT h+BskcmLianpqCBAD5VPHIJX7AkbrcE+/wBv7a32VktwVn5nqx2Y4Uc5BlC0XABxqlPEAEUxx7QS LDb2te3jzDN5DSVaRtnbtEfH3DDhQ6vWyTgKZXkeNGSNdR4fG9/gOaSlOryorUs/aKk0NPsp6iRj eZgba6+99NvDXjqXQkggge3COeumbe2KvuqD8n71tLeZ5d/d7bd3NSY2j284Us/LV//U10co4x/M EIRQ7AmzbSoOvYBjzB3fS3DYSJ88Nnlh0ddTBk1wFJmhH8hyI2ZQ7SAv2Uj6db8ATV8EdEjyw9CC PdRo/b66aZMKbzFZVG523Bgig62NtOOJvwrbzz6Uw5l4HvqFmephy5lHF6iVyjVaGnjLdgCNfG/J F3Lb7zWs7TswEdfI4HrEkGcp0pA2GgU6eZTmqcPFZR1brUyMaiN3jVSHJ7nUg6cOt4s7bacx+5Ij CIH7vSnsutS6JOB54HooSabG6/C52w/EGKxwr5ayEDaQL97Hw4BHMvTdELRiaecUtvwr2TSL60Z/ qMnZL/0Bm/mOY1aOmZCo8uEWDMSXW1+w5LXZPuYp178w6P2ewTGOzCDM7NnETQbzW5c7spScdpMc B1Do21WHi+L1tfWNJVVHnh23MJlBayEtYlCRck6dvqBPMlO/ToCBsBiI2fD2idnVFBEsaQZjHjGz 02eWzqpm33kK7h78wUyeWtl9hY7hp9R4nWlJTsAPD9wH7jwFOi3UQT8uHGps8Ip6lI4Kl5EiMkKz ps1ZTtLXuRYWBGvKtqRpMjSR548f34cJETNVAbOAxJMRE+2cNnMSav19F+BQ/wCyfhNPGyySVb4j MZGW1icSmksL29vfgUzi57xWOPDCpn3SQtNvJEcY86ca8hKnZIpkmp7xxFfhpqfhbiW1UABwFCRw 4cKTWKSCVmWIkgC8qaAe+PC5+HFNwpKx1U6xA20osNq2eClD3VoVAXeF97aD3sT7eMFsxgPZSu2I 7yJwpVGfzqeSDbvcXLDUWBHhr9/CdAOolO2eZoSqB04bKT3npFPHh8xKbrvCSbj2ez48VNK2pO0U Gb5spOpIwqeUaFryWcsNxVxe4I8PhxO8gJGFMtEER006YDSvU1KzNFeGIbok2qDuH1/G545GIx4c 7KX6QkYYmjG5XMr0jBkMkjr5jFVAHumw9nhzxdkmtgQdlOwlDTFnuDEpT3rbdf6P282VkUtQqE1w q5mSKN4lUyht+5/eAGoNtbcQuqDahRk06DtpLZizBUw0aJDPtmkDopFri4OvK3CVYQeefWqBSdc0 Hr4xKuHeXJJuliRiCw3B5Drc68s1immLhQJJFB3iGZpcOpJJ5mLzR3URGx1dCR4+HFaGkhQJIHz5 9aRrvxiIFBrVZpkqImaslWFVbfJsKkm30H4crc3bbYBKhp6T0cefWqd/rHXSdxrONGlJ5RQyrOBF Cb2tuNtQNfHi5OYII8MEc7DsPHZjRetg6+ug2zDjVTHSSDD5ozMBHTSLPYhfMIuBqBex4mefTqIC jsgAfI/rNVbLcmfdQcnMtQKuriZlVKYsw3IjF3ltHZdjHUA37j46cLUrw07VnCJMdUDAxHsmcaYU 7gMdvn54zTNRYrUUVSjmpMc1VFekkS7eUQVu2wHxAOltPy4ptVNpmQmQImR5kSYJkbBJ48JNVdcS YA/f6/DHGlfhOYih+WqEeOmhsBVKAdzgksFDEeH06/dyzLykBKdQCSMcIO3DHDp49dLEtCNUyedv P40+vnuKCBoaeRypDETVAJG9juAFibafHTj6sybZKQVCSPXzxn9+wUWXragrH3c/vp/wDOsdaRMK oNNIrOEYqTce7Y2ci5t7fu46L0g6RAnpHtmIn1ivJhEp/H8KW+GV71YEkTXRitwAbAG3sY8V2x14 g4dXr76QPPpHGl9tbzYIIwXdtqHYLnUahbX8SNOKlPbBxr1s4ADjStw2i8mNJ2Y+8Nibxrrp+uvN tqGBNGgIknnnypOYtFNMWDODta42gA2te4ufy5tBAM1S4WJJpIT0IjU1DsWaMlFS1iCTfwtyrhGg mfOkVuabWSIRo0g2tc7pLX1Ht1F+/C564QYmBPGl5UAcR7qDrMs8EMpCANvKC+gAJF+4/p4m70Bw nEkDoHX6mBswjbjNMXAEY7ab8OCxeVG6mNpWMYRWuNp1BsWP3cU21wktBJVEzGwEYYHaccJx4GMK J1rBOPDnn40rknepmgieYkOHiC6Nbb8A2nx4sbvBqKdUGfw9uPvwpACdWoc+6secqpaLC6ChjfdP iMkcUixnZ+hHvsWse2mnLXIbSlIJEnp+fRXnlHTWfLWDLEVnjTa1SWlREF2O6xv39vx5C3advOA2 LZKhB+6BBjaJn57J4UHLu8ATHpzzNDbgNJ8jEZWQtWyrtDPYbVAudT4n4HkHtXUBQbGJ8vt/Hrwp Jb24JlVZoZWLkEeWSb7rWvrex8fq4GHFnaowTPPl7tvEUeIZSFY7KVWW4oJ8RWOqIjVwTG5A7307 8UZTatveBWB4H8eZOzZRk63KNQFLCrwShDsJhvK6pYW8fpHD6+y1tlcOYJOyAB8x5EYYUXFvUMNt c6LLWB4tLFRCYRVDH9GrXPf/AIkbcN8lsLB/whXi2jEwNvTsx9fSie8bWiDHPnSoTo1UYft8n9Ks hO3yxcG5+ng1Z3JbaOqNSefnjxoNrvxqBqHV9M8coDNVRUDPEvvEohP18THdd9mVJxkjh7x5cOFK G7wKTiYoC8z4TUUmNRVRgkienus+8dvHwI/Xx4DM1euWyW9H2k7fbPr+kmhdlDzQRjtNZXAaQuwP lgBi1gCdPgeR08vHAyqej4RPPTRm6jaTjNQhGFBYm7ObBQOwGo0PHEug4bMOdlFrKQCSBUsQs0S2 JFyd62NgAL+PKB3u56SMeefdWw0rWBTPYbrbjbz7Xt/qX9vH9GHp86Mu4/Cv/9XXwOTKjKNDFUxs QgAd27nXUk/Xznu7vR/MHCkknnn41NlhapZSKXGFMldT07EhwNdFFtLjx4GL0KZWUmj5lKVbOHPp T6MKepkiSNCWcgEaG5Jt4E8Q2j61LCU7SY854Vu8CY6qAv1AKqPhWWqKVZ5JCFmS43BiQTp4key/ 08ycyPK28sZQBiQCTMecHo4e6o2vroPOdQp2ynhFVg+EUa1AZJ41uxlG1rn4ae3kRbyX5dulYR0Y /j7aFlo0hq3CUilBVYPTY6rQ1ACsysRLcAiwNz93EOSs3C7pDKNqiOefSnXFtFslVVr9Y81V2P43 W08MknyGFOcKoopL7QkTCIELYd7XOhvfxHM/d37Jy1y9tJSNWnHHoxHl1jDymoZvn2y4oHicOdnt IwotRWrlqyT7wC+dvkFmNm+0e9jb8vbxXcPSPFInoPTwI89mNJgGtUJOmD0mcNg2cD1dcxUWqV7C GOUM0jBQrPuWzLYaHW3wIsPhxpxH8Ues4kjGI8+r0papxtKjMkfPogYewjhUtYHnijCR7oxd0WTY Ce+4kOWA10v7O3GLi5G3WTPDZh8T5Hyp620gRxjhjHDo6ht9Y2jYZ9DlQ9b6esn4au0b45xMqg2s 1Q4DE7ibnub8BGdqJuemen4eypo3WbCLdO3Z67PKnbONChrsShiAM0MzJdvBlNjppxm1cUUkz1cP jRwpEYHCaD6pheSoiD+8wTaXjHgovb8uLVrO1Xxrwg+EVzpaieBmAj/RwvsVn8Ra/hfja3hsG2lD TUzBpfUk0zSRpKAokUyXW/gO9+JHGkBfRNCG3cCk0147TeXS/MRAtWxt5iOPta9u9zxK8lIPrSO4 R3gIOysdBiC4pFHJYGXeIp1uSVdbd78MUw4gEUHFwgxQl4E601TfYCrfomK2sFvc9+JO8VJgYUY2 o1c/hQ+4JIoozMF27ux07DW4HGtYVtpcloa5FJ6aaZqiYj3I2JJQdwBr8RfjesYjbSxnHE1gxOuM NEq2DNLthRidAdTrY8TuEYTt6qVJMDA0CeO1skUwuWdp2MpbcQFBuPH2c8AJEbOutFwelJqaqq51 Wm3Dy9xZ0kNlINhf28VtIIJkHnn0pJd3DZBgxGygtzDX1KVgAi30jK5LE2NvLKrbS/e3Cy9u16tI B2eXCNvDpnhwovUBHXQG5ixDFKaiQKu+RlZZL22mxF9SO2vGHUvdwFLEYxtx8j0+sTGylbQaUScc Pb7KB/F8RxGsi8+KoZoi5aJGNrqXuq2BBsB39vFDC1JgmdkYRtO08eE7ceM1v8wlKoI5A5ikycx1 0beRMG81iiqikJdjdRoTppra9vp4pYZU4mQRPmMPXzj5YUj71DmI2fLn1rBT1x3VNXLGyiL/AEmw AupAFve8TpYDT6OadQsgaRgcJIGJnCMPn19Mp7pkAQDJPns8qx0uM19Ti0VeSIpYD+hp6hboVfaL EAeF76rb4cVoZOgEkyNuzaMeO0dI8oNI/BpiCR0jn51nTFJ4ElcTlwzhhGCGNyxuEZraGw7cRusK EE6jBOzZ67fjhhNGKFJMJGEc7OfKnDFMarK6nhoXqZWo4mLR0++6LK8YjLWDkbiBa9vr4+bdzQBt IM7cTs0xOEc4xgk7ttC+vp6Y9OfSKf8ALDfKV9L5slvNIgngP+5xsBclmYHcT7D/AEcblgLmQE8R 17DIiPLHCKZdIWhUDAY/p5ennRjMps4kESRyIP8AKt5o1AJva1hbT2jTh7YnSjAKA4THuA2cNmHH pkmKdR2zQw4ZTtVVEbW3hLI5AABNz4/lx94nicKXWVsJ66E2Km/RtJJL5cZTyY1XwB1v35VWoJ20 ZKtx5UkscRAtPS01gyXaRwo11078dQRhHP4UWOoBUZpkrgrUskIO8G+tiQTr4H9nGLwKCeI9lONo CROFB7iEUzRGMTArCN3mIQB72vio+jXhc8P2cajPpx6+fbjSgQfI0GVbh0gKTs+9ZPeUto27TW4I v9F/DiC3KiSpIkDZjjjGzhIOBxmi69AAMnno2e+saI9N+l915do2AC4Gtzf7Xf6+LnNaUhRGMz7s Nn44GIwolU+hZ0ilRl9KmpnWUt5ZhJQt3B3sOxt34Z5etTqdREESKulsCZrM4ix/HZRU3ekopY6S mNl2FV0JPaxLey/GLp51DS1toJUkGPSeE9cfuopv3EpOonhQr4FRRUTrUBASnurG4Gunst/RzC/P M2U6pSpBUfdJ+XnEbOmidLetzURgKfTJMalnU28wbdg0Nib9jf2cDDL6hsnHA4fhRv3YmDjFPFNR qaYVDX2voPaTYnx1+/hS66Ss6jJ+NL22tdJjHMZfB6ulnSTYQwjRRbufgPp4JshtCspKTBJ6vTpw 9PWjpxltDIk7aUWG9U8OkYJWz7WjW3mqp23Glu1uHN1l6lKkgpIx2bT0eXmDRQpTSNm2ujnLDHq4 56TE41As6qGJN7/lbx4VJyq5t1YKwTsE44bBhx+GBpO4A4NlDrknrn8k1NT4hKtRCjG9ip0Nh7b8 kHK+0F5hYS6hUcYHvPGPT0oN3O7BXJFGzy71cyhW0ykpHLFUpaxA0uCPv5LeWb2sKSlYEg0GrnKF owjGgg6y1GSf5HitTBSRGuqxemmjA3K50tf9deEO9+d2SLdRIgqwmOnr9/p00Y5NaOB4TMUS1qmn iG12vGNtpE97Ujtb2/TzHXObE6gpAJnj8Nn61JZaSpIkYVkhgNXLH5dzEDdSB3P0cIlOqSnTx59t MptEhzA4VPronjW6H3BfU2GoPG2HAsiefdVG7YFyBspm/lL23bPD5y1m7X2bfp8bcN/zJ6eOnYOZ 6tlG3cJ69lf/1qYcyxxT4RNSTRfbG3sLDsDzlXlK1NvhYOypxS7Ag0AsGLTYC3yohMiFyIttrg3+ j2cllWXovUp0jHAefrHDZ+lUtbwNyFGONC1lvqLguCQz1uJMq1ckbJTwsFLagAfXwW9nm55aui6v EgYCDx44Yc7aLt4M2HdhINXF/hMfg95m9YuaU9Q3WDDZcP6ZO7VWWqOoUq1WCdJDuF9unujx5kPk eQfmFa3EjmCBj/FzhsqM7q6UU+BRA59lAb+Ld0IyX6c/VDiXTHJVPHT4fhdBHVyRwqAo86Q7Bp4g LzHPtVtmGs8dDaYSAPU4dHvoc7tPqdthqOImaqbzaMRwbpvnjNVMnlxYNSijpZjoPmat/IjAt4+8 dOO9mO7K7zMUrIwT6SZjb1emMYVfOb7u2SnpqpLHZiGcrFefc0Ty+6+puDf3lPfxIv7DzNN5YXig YHqI2eeyeA27eNRzb2ywr7jGnhjJ2TsOHRHnhwQhRhJVLIgcWYJ5jIFZd4a5LXF+JStR2HAiTE8Q ZMR59fsram0hQ8RnhE+QH4+U+cRVjdI2iLLK22QottxtuGhI1t7b9uVQlQUMARx4ieE7cT0e+KUP azq0q28NnXHX1xGyhCyllM4pVUTVdMyhyfL2RqA5LEbdrdiSNR4/TwrzLMtLZSMYGGHvwHR1+sUJ shyhb5K1HwgzxIkRj5bCZxPHpq9T0hSLg+SsBwORfl3ENTBMA113NM5BuCQTf48Ay3g4oKwxHzqY cjbCQoTMbPZzwoSs94SlLiVXUmIotW+0GSxD6AljqNbjjDLhQoiKW3qRIM0F8l6NmbylKs12ZtWt 4EHT2cMluqUiDh6UmDZ6SagSReb5klMAyVL71LEaHxH5cq6sgSkbaWsDpONKZJd1KrMm0pshRmPY gewD28Zdd1mEjZ1c8ml9k2nViam1nkGFWnX3ylnvr7w0U8rBTgDShQTJI2UF1NXw4PixkQjyKtgJ YlCkA37+3jrNwEQlRgnkbKIcxYJM8BQ44FiKeU0hYbmICNGAQQb3HKXLZx2U3ZvhJxof8MxOnanW NJN4jj99dBYW4gUNMg8aNrVkzNJ3Eqks8S0NPcPuA2gm4+IPLNJJEJw55FLpKZk1AxOMS0CK6/6S dkDCNRfU9ra27cslrWsTt6ac1wOqmfE8nRSU0UrMxEsZt5gXTS+u728fVbgbKu2oRQZYhluZI7Mh dgwZSAPsgjuRzSpSQFY0lW0So9dIyqyxV1S1MUMXnyuDK6m1wiC1tT3vyyWyR4RJppy22TSFxLpn mCRBDSQRzy1yFqlpm91SLnYNDfuf7uFy8pdCAkq/xv02xyaTG2RMk0GVT0UzJHI0a4S6o25l8gBF C6ghrkHU81b5VceEKg7cfPyHJE9VXeti4AZpF1HQDMNKfnFomPkKGjVybEyNpYewXGp4vt8vdhWA 8Udfu89uOPTSR9pwKIOyoc3SXMYhqaUYU87y+YgqU2BCBqNCL2ufYPv54ZU93hMge0jgMBjj+uyq BpSuMe3mYpxw3pNnPDqSGOjp456ZWWXy3iRtYz7rEyAG2p01H08MhYPiNJAI4xtOME+kTEDqpErL NSiTPXt/X5UzY50hz/idZSw1mFRhndfMraf5eCJS76FxGsd1UMdSNNe3ETlvdSCNMnjs9dmPvPUK Vs2oZSYmOjH9caZ5+k2L4XUrQz3k/SGnjqEWKSMvGmz3dF79/sm/jxq6aeB1QD7eB69s8MJicTtq nGdh2xiNuJn99O2D5FxpJqKE0h8je8UhlAIRb63237/Xft8eVatC4nrPVgIjaT1bNvswplwkhRBM 88++jYZDy1BSTUa18clXSErHPHCypIYkABCM6OASO2htw9tIQIOJ+XoNn7tlNN2K1oMGD8/bQoLg 8dHAJaeOzro25QCf1+njVy/iIo7t7MpHiONZVq2NMIXi9+O+7aLdzfxv2481CsDjFJ7iMQDhTCY5 DNIdnmNUEGO6hiL+6SL80lSwdvP7qIHBJAJpM4syxxRIu10UFWO3aNTft+fHFJJn99WhQGBMUGVV XIA8KxgqxJU9gQD294W0+PC59GERPr+nRw6qacQsDbSGxGf/AEDZIVSOnb5iWSS/uhgNL9tbcZRr QoAxp6DqJx2HhjwwxoquLsBUE0iaXFaivr1VCFirD5tNAFEto193Ugjbc668ZW845KVpnVsHrxO2 RHE+kbHGLJBBkkkeny56KHLC6U0WFmtEW0VF4otu0FlNge1tNTw7tkEEqOKvw6vj+gpNePBCYmiw 9cM+0+VcXy9ljDMT/llVTtFmDEZIAX81y5EcLBdQL6knTgis2UrckiU+uPn6ddAbObsqHdhR1GOH Cen8KOlk7HoM05bwrG4JRN80gkBTadpVQrC6m3MIu2Hdw5ZnLiQcFGR0elGeQuF23CuIpbrSyzRC QJs2WFza9jb48ihIPi6ueeZPk2oWBJNZ6qqqooRAEOyIe8dot7eGFrkzz0qUIAPRGPsFCCwZShqT QTY7h+MYnIKiSFWiU7VBVWZV3WvYnXv7RwV5cpNuNP6kc++ivMEOujw7OFJc4fV0Dp50IQMTZrbQ Bf4ji5m6Q8U6VARx+ZjnhRA6l1s+KuoWi8tHanHmMzqZGcDb2H2eGls2+ghWmRjE4/qCPbTQvYBx xqLK3kFgCYzHquxhqDppr+vs4xchSsFJSPT8Pf6bKUozKE4E1kizxmbAiwoZpHhv9ksdDqf3r/x4 uRlbTjekoIjjG33eu3zq9nchwwcZpb4Tm3NOaLSV1S0kKBVVGJIIve+uhPCTPG20IjarrJJ9+w8J w4iBNPvt6TtgCldhcCz04SqrFSaQg06nuLNa1rD2+B4nGW+CSsAnYMdQ2ThEDDbiJxxJp7Lb9K0l J20raCKppppfNj2wRmyyhDY2NjYkngYzjd11lJJOycY2+WHlyaOUqxrFiTGapoaaMXQvuK2HY6Hg ctVFCFavfW0NkqxpVeStrbB9jZ38N1/b2/Xvwu0L6eE7eHPvw24Uv0idp6PdX//XprxiahnQy7lM QBdAddPgT35yqs2XkEeE9GysibhsDyoK6zDMLgkqMUxlxDCquYPMXxsSve38OZF7h5EpTBU6I8x+ P6jpE1Ht+8EOTMjooJOgtNh2d/Ul00wnN6GryTVZlwqgx1WTYgoXqhFKva3bvf46cmzdtSQ4jvNm GOE7OAA2YbBh7aD2dNrXbKUkGYP419bnpZlrIvSXpXkvKuQsOgwvLOFYdTtQQUSIkYgFOHDe6Ldu Te1ZoQkwISKBRuAGxHGtFT1wdN81erf16dY85i8GQ8KxA5afGiCQxoFVmRL97mQi405jXl/Ztc7x Zm7cKGloqMHpAMYceHV5caGuX501Y2o4q6KrU/E5wDK/SboLljpplGCJavHMTpqjF6gANLMlFGzb mAIAUORfwvyf8r3Qs8q0toSAOJw4D1+G2gu9nC7tyVSR1c8ia108QRZlLvdC7PA0TX2x7BqPctYd tbn8uGV2842uG0zh0Y9eHT0ClLAASNMztIjHzM+0enCkylNIHcox27UjkVEsCxF+w1A00/h48Ln7 txaiUjE8JmPjzjXrZLYgGQNuIBPp09J2dFepsPaonWHcixg/b8u7bwStrDQEeBI+r2JXbjQgYYjr 6Og7fPjRoLLU7KSonr4dJ2xA5IGNG2yngUeG1OFOkYlFFEjMI4k2sNrTkk+9fufZyOszzZbjisIJ 2g7B1bBBn28KlLKrUotjpOzznb18OZq0bo2lPT1FHHHZKZE81Fit7rAbgLqPb35W6SlqQnYNnto+ yF3wxO2jF57ikxDAaaf5fWGQzkuNdr6G9vjbiO2dWFz+HPuoSXVlqRINFzqoylR5U5LxsStyCNTf 2+PF65RjwPlyeukQUo4camxxROkQhRZKZbFtLXF/G1uUXcKVgBjSi2QZOONPUtIqQMEA2MDKrIBp 7D/dx22XBg7aXGQNuFJzFKlxCtOpDzGzFwdbaePgOOPEnEDZwp5C4AE0k6mljqPNkMF20RhZbblN /H48acuJAlIj0/DhSS4bnYTNPeUsZkiqPkaxArEj5dR2Kr7Tb2cbYzL9oWztAnZw64wkefwonurc NwZNGMweriRGTzSFn23Xt7p73v21078tdtiNlHOXulSZnAU/LV0sTQrCb+6UZj2W5uB2HieMsGEk cKUqbB6YFdJVEu8i05kB097QC2tyP235sKJIFKUkRGyKECnwqHF6eLcQvkpsUG4AYkfDw5eShVOI xqBXZUjkWJo47+SNpKAWNtfG35cVFwLFPKtlpmONNWEZJp6aoqaiSnVmmBkW4IBIU2Gt/u55AUjE CkywThUmjynHTtHViPcbsStgQoJsAPDw480rCDxphVrqPVT3LliIbW+U959bzAbNL6Hw4qSRSvTp A6BQbYtQUHnypLR3ij2R7dps203YD7xxQlRmYwHOFMupxkGkFjOH00oqJ8PiMLIp2Ruva4AGmv8A Die7eCsBxrTYSkU5YTSR1GHpCtCF2KIZWYaEKNW+zrqOVDq1ADHClTSWwCTsqXTR4FHLIKpVDQDY 8UgDAm5HLuXKQT0CrLtxgQKjY1lTLdZLSVSwxAyDfGwUfaJBHf2/HjKVp1QKL7m2So4jEUjhlPDo 5KryaMRtuKANqLHUEXA9vt482To2fCkIbSkzTxguWjBJJLNHaaMe4tyNtiNbC414yAUyFbaUtW5U J4U44pEEdaeSNbTDZCrDS236DqeeCp2jnnprbkoThSFbf5z0hiKqxJaVNSLm3c8q1q1Azhz+6ie6 WTiTTPigEaRCABZFJB2aBu9wLe2/FAdOrAYCi1YEnbQUZgxqRgwWFlaNWu+8BdwNv8P7eJbl5YbK gkbJx4c+fVSQvECCT7KQArqORiHkWB42LJHHtJ3a2Jvobnx/t4yh1LgGEGeqcMMNvDo4TBovfuTj Mkc/CgezpmJ6948u4bEHgimRMTkRQL/vbSX0I11tp+Y4muMwXrKYkdXu6viOMbKra2ZX+0J4Ycef XH0pQ5KwaF61I5aSCWZwIo2RG9+43EkhiCVAPsHFuUpLk7ePHhI2+07emNlLbp5aEiFH5884UOGP Tw4PSz1s7eTh2EU8lXNYAIFiXeSSR48O8ADA2e+gzmDpCoOz4VURnLNcucc5YnjlfB50+LTefFT2 aTYD7qhBZCQtrDS38OHmW3jiQIEDj1/Gdn6ACo9vmkrWSmSY6Ij2YnrE4EVZf6Us0LiuWKvBHREa A74ojHt2qSGNt3bUnt4DkPfUbkhfy1q7QnxCNUwr3nZsGwniNlP7rKUzcqZVIBxB6Z9aNnNWwIRC rlSjbhtUWfbYgH79OYYZZbFTgwJnq/Xp6p+FS6GojHCnRalHEMVkAI3Se6DZdDqLeHBFmGdNoQUJ MSBsHlBIwx9fXEyqfTpThzzyKaa2am3uBZmYM4It7b+GnAqm8fUdRPHnn8aRhwadtIOtmilIhnju h0G4AkAn4Dh4wpafEnnn091Ft0oBUK40gcXwZoi8lLZ0CkjaAG11PhwUWOaqdEOR7h76Kb6wA8SR SaniSKJWkYKVJLEm4FreIt34auXCl6UiSOer3UV21of4iZ566ww0c2If6RGvmQg7kA017dyLffzT z6ECOJPI289NHLDaGCMdlDBlaClp4o4ahvKZ1YqoS92totl8T2H8eBG4IedhRw8pJ4x0yTh+lWuH FASTJrNDSTTVTNECjI11sBa41vra+vEtzcd1hsj2+6iVk61+E0INNiFRUU38smqt8i3Kudh3C/xI vw7tl3FzbDViJO2D0+se4dOIob5c4lRg7am4NFvleeoXzpIiwR3t3Gnf+3keZi6GxoAx4/pRkLdQ Bj3VP89r22C3m7b7fhf2976X4k78dHXt59tFcLnYdtf/0KScZoqTKuGCuxOYzwUy3liZjYMdAO/w 8eYhZR2ZhKw49jBMj8OR+Eo5lvEkykGKKxjNfi3UzHRSUcpTBoiS7xE7drfE2Bv49/p4K89zlqxa CjAOyBp2bdns6vSiawtXLpzw7OnH2j29I9aML0c6aVdZnLL+HZZw+SrrRWUTVBoUuywiddzEqPds L68LtwkX2YXkglQ29MJ2+kxH7qFOeW7NvZkEjZFb6GMev1KPpTlTp30+wCRsbpsJo8tYnmPGn3qo ipVikMar4kiwJPM2jlC3GwSYSRWNjt8hKdCdoqqfNNfTUOHYtXRqqiWWfEMQmsFDySsZJG0GpJ4v y3Km7VlLaEgJFadvlrOJrUz/ABGessfVLqvjVPR1ZXAMqI+EYelI1w8wN3ZlDC1yQL629nClxlTy y5q0AGOekzwoztni0Y1xrHR1jj17IwO044VVJiKhFlEMW4xsSs0pJFi1rKNQdf8AER8fbwOXTDxX AMnZE/GNn6GDto+Zue6glScRsE4GQer5mmcU6OjPJCFmlsyxXJvZj2Kg6WF9BxE53k4K8MdMx0g4 jGen1FPou1tgyRHTHu2njHGemIilnk2koamWb9F5gVleQI2/apPiDdRt0INr8CGdurCSkqEnHaAO uTGPHZQ+3WZUsFZUABwMxxjjhjt4dAo4GU6CnraaWOIBhTWPnbgFG0HwI10FhrbgHu2HFKKwTKRM D27Z6NmHHZQzNz3SR17RR5+i0cMuGQgMGq1MjRknX3EBtce23Ft04dAx94Jw923o9lG+QEJVjhFH dw+loscwWGlnk3NOiwuA207lN7/eOUbIMYxQqccIBA2UVvFcPhosVqqetfaYpmhiLMQSAxW49h4q BOwn5GipWpBwFYKuNKY7KVLxuoZASLWvb+3my2STB/H4++l2oHxD3VNpZopaaoicFy94dh+H36cb Kl6o+H417XjBoPaicRVbpKLzR3BLi5Cg6aEafdx/vguZ5nn0qjbhGFNvz0TsxhVWUnaxJt9WgABP HJJEGn1jHHCotYkkslPPTxeVLDacgE6tb4fA24l7palpWDBT+EcI9pB+NNuIChFDNl2ujrIY3mlI kQBZFP7t/jxe4A4mZmdnM0hs1d2rTS8ppYaiMBX2ujGMF9TYC/jxKU6QKOApSZJFLiip2p6JZZNs ihWaY+y57XPGy3pAKcTTaFFyZ2UJGFJFHTxNHq6q24gnW/G1qJM0ZtK0jbSghnohF7kaszHaENzY kXJHe/38cQSqcYp15xXTUgxUshX9LtBPvRoAbgDuLHhg21gTSUu41Cq3iVhHCSLasO9rH6BpyiEB QilCHtGNN1fmKKOmipZF3yb9kQQi4LA97dh48eQ2ADViSozMCgyxXF8NixCvScrKrRoadZQPccNY 3vy2tQpgAEgzSc/lFPiFa0yOFR0MhiSx3G1haw44kSdtNqdjHiTTFj3l4QIqfCnZpdqpUg9ht72H 0nmlEDAceernjXgpZwOykc8lbTy+XUUwkmqfdV0HZbX+1YHQ8ZSHCRIFPLutWBOyuxiVSTNF5bmK IgRM+g3bewNuOKKjwpGXkgxxpaZeoZ6wRSVERihUiYlwL7ewHe/FDCFaYjjSN25TOBpd1VNR0atK sgDBQW3+BOoHh34jfC9nPrSxi84CkBX1LSlxv3IPcjBbUkH6eXYClDnnn2JLs8U0iMSljp4d+73Y FDG5tZma57cdaOrjRRfLCcRxoOcQrVNLLNI20LcAs17ffb28TqTxnjt5/CkLr3h6TQNY1W79wYj7 J190i1/9bvyrz2nHYTtPR1Y7ZPVO2iJ57TOPPpQJ4/j9PDVPRUreXXVHuzykX8tS9ja4sW+GnEty pHdykSoHFWoAzwGBnzwjhhTTbS3IKj4Rw5PvpI4TQAVUiSKXjmbzJVkdnublr6qt9fp4mtW1uqTq MkThw93z9lCZPg+2AR1Rtw6T8qNh0/wKLD8NjrZI98pUimEnvHaQO2gJPBDZtBlvoJOzD28McY+U 0Q3l1qX0UAnqyz02X8sU+WaBtmK5lZ4qsRsA3ykYBYDuTdiL6dh8eL22FKIw8Ix2jgcMD50Dc4vd KSAYJwH6c7arWp6mnFRJ5wMvlgIiSyyFV2ybtw22Htt9Phw8s0qAOA6MIB92337KB790ScVT6EYe 7aPPbh01Yh6G5o81daciZWrXGGQZ3xmmyzV4hLINsQrplhU97Cwa4B+OvDC93etswy1dqTCeA9Ns k7D0gmiU3zlvcJcSQI9888fXGKvQ9d3p96Z+nLqzR9OckZlXMcmFUaVeYK2ORHC1cgBWMEEjQa6c wi32yuzyi5LdsrFIMkYmRGAnEcSPLrwnHde4dumtbnmKJLNNEgDo9ww26tpooHjfXkOXKUvKkcOk mT18edgGAo0vbuBBpjq6yAge8S8oKeYGHc8dRbEAAc8+nuokccBnGIpMVM6hlVyrbbsHBsQO/gRw 4t2jpkYR7aRvv9dd0c1PNG0UoMskp2H43t7b8bWyrWDiaW2ToI0kzFB7i+Ey1Ne1GGK0pOig2sCd bi/1cFdrdIbZ1zKsPbTDtqUkxtPVSvp4KPDaVaeBd1vdJa5uO9ze+vs4QPPuPLJJMHHb8emqIt9E qJxpo/mbJVoB7u2/uk2tYD/DxUm1UEHGKJswudaiVHHnpqTimd6LLGD1mLYmyxPKNsKRhVvJpoqq Bc/AcfYyF7MboJAnjhAA8wIAHs869aHQgnj7aC7JfVypzJmCkoy6QR0r+bO6Se8Yyd2utr2B5NFv uUy00lHACZnGNp44fGOvbRN8tDuBxBxpZ4L19poMZroa1wtJNKyUcZFwVEhQa/HvyON4uytTjYWh Uq4ydk48x0eVCvL95B3ikq4fCKFT/Ojgdt/mrbyf5lfaP8hfZfv2vyNf7I3GzHbp9dvt6qFf5xvp 6+evmK//0dcLB8tda+tuO0GG4Ng09dR108dS1lsCgb3d7EaL7Qe/IrtxdupLbHiXtkDAYdIgGhaE NtQp0xP641aH0q9AOP4TDQVGYa6ChpUdKjEKKBfedQQSpN9LgniNjsIzC6vEv3TojaQOv5eXtpY7 v3asNFDKTPTVnXTLoflLp+sZypl6no3mXfWYm6jcSuurWvpftzJ/d/dSyy1qGkxhjUS5rvI/enxn CjJx08UlD5VGFJR/KVk8WC2JNj7TwSLAKcNlBuIVPGii+qHqIuTOjua8UkBp0wmjq6lahV26wxsA TqAR49+Ic3dCGSThhTrYJUK0s86Y3iOOy1GKVDD+Y4m81bUSIl1WWaSRgdz639t/DgeZeJQmYKYw OrDZjh09U7ZxwMiO3tEgEjp6Inh1HDp+VA/VefNGUSo0eziFdtjuex3C4AIuf6OEF8sD7knTwg8P Pzx4TRrYO8TgYxw6D0dHH41BVJJJ5JI1ZguqoIlRlUPfT6LcorWlI6eJnq4+/jVrdYMRpjhOI4+v l7JjCnvL9TLQ10dKP0cVeyUu4+WugB3eA9nfQngaz23dUgQYKcY1EjHrjD5baGG7t93NynAQrbA9 nX5D40d/Kc0lFRu0yMTiSLGsg27V3EkFCAO/hrqPo5HQUrxNkwg9cYgSfftggk7RjhItzpUQExz0 8/Gjq9HFp6aOI1FSS0zs6MgHdht0H0cTttJDUonSdmM/HpHDroS5StOEDDZRp8tVVQtSE+Y8uB7K sot7my/92nETSFFQxoWoSmAIpI9T8DSSjpsYpGJlpTJNMwtY3a5004tEpgzJ55+NbzBiRIFB/hkr 1VBTyEgNUJtcCxCi9rX+PFqXyMQNvXz8sKKGXBJTxrgoam+ZiRxIsjCVANb+0DxNjxK+7Lnrz+Fb cRAFNOLYekj088J2vKjby50DD2a+zTjyGVnVpPPXShu4BSDgaRlQsYlJgLOiAb9qgAEnU6C9+L0N qQnD3nnHnjV1BJAwp5oUE7rMWDIQojW1r7fbxt4K2gg+tMJWNQBFLKKOajmSeMj5ZwLbdDa1tLco hStcGk1wkySBspf0ddGaFUgcbpTuZhox1GgOvK3CSCNOFLbV+dtCDR18NTRJSFjGt0jksbXsb/s5 ZTSyZA2evtqyEDUcKWtNjNRSt5TRj5fVmN7ez2j2cT3KYjGlrDg0xXIYwjuzwvd19yFbWAB7Hjba FAynbSpaYGPGpdBiFT5gkl3KsNy7m1mPcaeHDFC1RJpIUAqPGp1XURO3mOxVpP0YKkM1z8e/H0rw qoUNlJito2okeZiZAl5IZQNd17639l+OrUJgGlKntWHTQU1eIYdVvVUvzI+dsImkZTuYsRr27D4c 8l0aorxaVAIGFcsK8yN7Q1KzPGN8UjWVRs01+HPCZwNMFASaz1EMHksatkkLmysTtN73044pIAxp xJCqblwWd6hPPqAsAkEcjEXKLfX434yppwjbNM3JETGNL2kylhVdCIYJvMenYlQm29gL39nFPe4A HbRM8VzMU7fJVODUNSZYzUy6qFsNN2g+7l1lSEx01dttKtvCgfinxWvxGoae6U5JSCEn3QqjvqD9 /EiW18TNKBCB5VwxtJMNmjKyrIwJRmhNwCDYgg21HNqKgY4GkT9wFDDzoOsbqn2zp5glglsfMGgB U9tNR7OOtskYkzzztooubkRsoKsTxYMtTE1lijATYttdSP4ccYQF4iNsYHjRVdXYHRz+tFpzrnCW mM+GYVM0mIy+685Gixiy7RuH2iPC3EF2pVtIQoAmMeAww6er99MWdr35KlpATz0UGlIjvNHNKWku siGRu7+/uBJSzEHv9fCMJccTG0jDrHnwHnw49FCFllKEwNvl1ddDfk3LYq8QpJ54TANqPtUXBuA1 iddw8bajXS3BNYZcswtWHHhj68iKL76+SkaU4889fTRjp4HpfLoUYGOERMlhcMZBcm9rfDvxY+Tq PACiTDHmKq99VGYf5p1WkpoKhxFgMCUCrD9nzP8ALOSRYqTvt349lDRUlSp2mMMTHwGwz1UCN4VJ DkGCcPieR8DwLEklOJd9QqzmI75JFcwsRtsEuwt9B/j24e27T6R4cAOB4Tx6J9MccOkPOXelIAAw PDbht6ePDbx8h56MYtNgWO4TitPVS0uIUE8GJUjkxoQ0EilSjAg3FvD+HBLkySUEFWJ4z0joPE4j D3UH8zd/ZlQCYEzgNpO3jPGTwjprYo6v9JM41+CYD1TgkqMy0maqGkxmunkJnlj8ynViSSSSOYi9 sfY/mLF65dtStpXu8urq5Eg7p72tG3DZOlQopMsjkskr7DYqBKbajw8dbcxuYtFKGEY/LnZhNDB+ 5WodVNTpB5l55FVNJHDWsNT7OGKmHUIiIHn7/Xh60VlIJOIrmKbDS6yLVxlCWDBmBsfbqeKGA7qA MAT0+/DZ7eGPA0280FAERS+y9k+nxWBKlaiLbolxYMSLm2gJt9HDBmwuXCNK0hROwnxCJ6sDHRSq zCVDZgKYs4ZOraWVEoqfzQtt81MyNYX1uvunx8eL7fdq/JUCmU7cFA+0GD8AOujdy7bSmFcaDTF8 PxKjaCQxvELiEybSAr7bfvXAv3vxcjd66QgOBMjqOw/Lq5gM3N+CopEUG9TPImKRJVvNRy7yiFoW dGINrbhbx8L6cFFluxpty5cHSmDwJ6uBwxwmiYqCnAAJoI+o+LRY5j1Ng+IS1lNhNBEz1ktBTSMp l3WW7nQC9h7Ne/BzuJu62w33rpwXjEjAe/8ATzwpRmGZBB0BEx0zHuMxO3DrqLkLp/mDz4K7D8Xp q4YlfDniapEEoR7Kf8qrKGUtrrp4e3gxf7ssBa1JSno1D1xmPjSc3MrKYlQ2YYfu9vWKN7hfRXKs +6vxYR03ySimFIYzIU2jaQJIwA/b963wvwD7372WhBbZcCQMNWJjDCIw2jifbRvleXqSNbg4zHnt oQP83OWd2z+ZUm2/8pvsH+Q2+Ze272/X48j/APkl1MfnkbZ4bYnZ8vWjb+YNf8b/AHV//9Jc5O6Z ZC6XYdFhOWMAgw6GiVUq5I4rv9beJ15LLGT2tukIaQBQRuc4ceVJMxS9krJY1hpfL8t6wl6TzVAL qw2qbezQm/HUtnVHRzFF/wCYlOPGlXDIa3AaenhqmpTGrQSrDoWdFuxOnhf7+OuN6jtpnVHGnKjx OLDcPgwunkZqirnangdNSC32rsfYL8ULOGnhTKAoHr40Qb1xT11b0Z6j5foFHmUOEYhPTIqFgpaK 40YG+tzrwmzZUNmdg+W2l9kZWJwE1p3VVRTzrFvnWmiEQDGVHdQVBtpGpBt/xHW9uEP5potgTqgC DiBPkcY9IMY4UfssOrlQPu9gwBk9IBgRM8KQlTTmlFSqzJVoCVWdA3lyKTp/lrafTwgunVEwo+E8 cSejaR0xgdg24SaMmrOSJkGD8fKNk4TsxqHB5vn7fdeKxaRU0JBa494JcW3WP56co0/gfFBAHT18 Or0A91MlKVKwJnEDj8sQff61xkapY/oXkWQbGt5ZYBTfU3UdrjUW42p3wp1RjxB4dU/h6baXsMgO 6gkwkHEcOGyD7fTro2WQsyxYrhOE0ss3+QLGpmIIKWYr724+J7a/DkV5wxC4C8IwJ8thAmdu0RPG pjyC575jUPuiCOv2VYR0tqY2wDL1exsDJNRuFAFm3q63B8No8OI0o1tATJA6Ts56eFCqyIQYAxmj PmQUwo6mFSPmXPlsR7u12B0IPw9vCZSdCp40NLVSCkHopf1mD09fg7x+UrrOXIVybBnUW7+y3HWi VKk7fhSl58K+6it4pSy4Hi5p0kPy9S++I9gHuboL+AtwxSoE4c/hQeumi2oqHwqcximgCqzMY3LI V7Npr205bSonDn51Z24K0xUFHC0T08psWJlUkA2Fr2Fr8pbvEKIBwHvrYI0yDSQrqJgrMqhYrgna LXPh7Txa8AMScOeinUKnCaiQy/Lv+hUxqu1feBFxf2e3iXvcMeHDjVXCUmllR17vTvBLJ5hPuoB4 XB7/ANPHkJBMzs86SFwpV1Vgp8UrMOkjSR7orFARoCp7d+3w4raWhaMdvRz++k7itBw2UJeC5npj tiadUWB455ATqdL2BHNuNlIgUaMvJIxO2ltiWOTVqXicJCEMqul7lDY/VwuuGyozGFGVq5pgDbTb hmaY4X3KVao3BCHFyBYH46cvHRT7plRnCp+M55MCUsKS7HqC3nbQdANQRa/f2cu2pRMUha1SaT8n U+leiniMzLWIw2u/u7WBt4cvcPAJjjFbgFzaKYq3qrPUfLYI9UJlkVy8yhtdutiTrrf2c0y5pQCT jW1PpKvCK5UWMUdcslIlKGmIG6VTbaCRr4kfRxUyQViYxpa4vSkY0ssTegw3C0WWaL5ijWy06m0u 2wa5J078NXVoCCZkUWouFasKSFRmSiqENTHNeoISJYx+6y2J7ADhe4+kxV0lQ41znzEqwwCZy1Qw IRYTYgE6kjvyyPFiDSZN4oDppYYJm+iwWKpbeZZpUI86xsrE699dPbzThCQCTGytKVrjGKky55jn pT5NQspYF5S3+K17AHlUeI4HCkzl2kAhVB9WZteBQI5AoQMfMjIDXaxBB8LcstSwdvpzs9lVafSU ERQYYnmkPXpSyVLsv+Ue5JJAtc7j4+PNoaKhKvbs9tFrrmE8KZcSxmCOjsZPNaRWqjGgayWfaAxY am2ot4fHiso0mdXPnRFeXo6KLnnXO2+oqcHwlC9WbNVyw3IiQ21BVhdrajXhdmF0lEtpIBwxPnsE Y+Z4fBFa2xd8Z+38ORwoLYsNmjieqqZWWTaolvYk2J+1YXuNuo7/AA4UJVCComCTEGf6PTjjhgNk 9RoRspRBATyeOPn+tO2VcPirZ4Z6mIikjZzKtlB2L22kggA3Hh34ZMtBRxExgdvXwienrq94rSgx tPn6+vONGVyDhMktB5yjyl2fL7lXaCtrEhWFxr24Ii6hCPDiPb58+2g3dK8ZMc+dK3HcRpsOpa+r nYJS0SGeefs3uqCLk34UXt7pSScAOgY+X7qtbp1nAGapWz1jr5mzhmDG9oqDUVU06CBWN4ydsZvG t72HcX/jwR2LAQyhKzgR0R17Oj2edRRnP7S4WdWB49Xs6OZpETlfOdglzcNsZNhUEEk911ubjt9H DNLiQAScY4bfXp6NlIlsuIRJxnqkfDChY6fTxpi9ItS7sjzqrM1lABQubhe9wO+vBTkz6dQnBWzj tww6PcOGyiXNm1LQop+1I9w2nh1HhONbsPpgxDDc6+nDpnBiH6aOXB4KNjMnZ44/LOhHJBubVp5v QqDIoD2b60KJIgg0Uvrt6M5KvGJseyXJsSr/AEtdhaaLa5LNH7DY9uYsb4dhDIcLtonSVbfn5TUp ZdvktSQlR2VVP1FylnPIuO1+GZhwurwoRO0dLJVRsqsgYge92NxyB883bes3e7cbKBOHDifb09Ij 2mP58rTKVTONJfCXrqqIoZnEa++krBrWJ1Hbv9PCF95tKCAcY/HHACOvGDxqqFuLxJMeXM0Z7I2b ZcPw6niqJpJUCrdRJdWA8NrKRf2cCSt5nWX9Kipfi4KOzqB6P0odZLbAtzswpGZ96mlWrmooxLGv uzDZ5jHx1It307DgkyzPLh5KghICVR92Ptw566fzJKB5iir5szji1XhbYnT1krmX9G8JElg1iBuE pW5Xt/A8GuRt91cEKc1TBJxIPu+XtoO3DRWJAqJ0uwuvbDcTx/GMXbdUBloMOLlS0jDapIa49063 te2nHt581CYZT9gwVGzq2CABAJ8uuaUW9tKSuIjZs+PPrSvoemuHYsRLUmaZHLiWJWk8r3m3kgE6 XOvApme/Vw2IQYjz47MOHtpIhAAOBkxwFGK6V9LBXYrQ4Hl7AVasqCTExUXO0knvc3PI/u81vMze ShK5WeHA0aZaEtEmI6zTrm6gxPL1dimDYjA1FiGH1ElJVUJRgUaM63NhwtbtFoKm1yFJP244czgf lRhfFwoJGKTxoOvnn9rfat9X38WdwOj3caDneq56PZX/0zD4VKjNVVWIC4j3OtIRdQWayX+LWv7e TSsJjr55+NRsFGQKbc4ianxinnCpJVI0ckiysWMdorqoCfw5RtHix/WauTh108U1JUN8uscwWQTS Sz2NljXy9xOoF9RYcd09BrxVAw91cVr4w8E6x75oZPl2Ydh9qz69vtX5eAKZ1TNBx1Vyph+ZcvYv RVoFVRVsU1BiT2s7JIGTUjwuSuvs4w8yhST0Rsp1tSpGMGtJvrXkquyF1Fzhk2rpjRrgGI1dHS0u 07RD5jiJx2BHlkWv2Pa/I/JKXCFQpQOyPZyMTjwoWhRIBJgk9ezqgYbPn00CNTby03bh7rSxu7Oj sWa+0iw1JPf8iOIXvCYKQZEbCY6NnCeA2bdm1c0XDiQfZx6eY9tQYg8cYjVARIdrSK1yoMm3aQAL EE9zfv4cYcQnSpB06oOAmAY4Hnzp1C194CNon8Zw4dHzFYCzwkrsJVG3FQ8ioVYEqCoNze+h/hxI GVGAFBI6OJ4zs4DbjPThTimnFEqER754Y7B08NkbaXGSsyJgWIU6zRxmnq5BHLvcgxr7yggMxOjH sB9HwIM8y4ONAezCfTh6yOucKFm7eart3YIISrA8eueuZ6zxq0To/ikBy5VYXBKGrYJkxGls+4HQ 3Pdr9tbcBlnoUkjCTwkz6/CcMalZC1hWrhz5UcDLWK1mJYOAjRSxt/pEsLDcInXuVvqL/DhbdsJS sTFDSyeC0g7DsoRcKxqOOGGnkvKSdiLGbXAF9TroPp4jYUOBmjB8FSZxFJjPeX4sVw6jhokXdJK2 IxSRqA2/7BXf3sNdOGocx0pInppO+0FpJMzFAbQSvDVS4fWsvmUsrQyAC92BIPxP08U97qKgSCU+ lESlKGBqQyq9Q1K8ilYbyMWuAQNf8Pcg8RA+Iydn4e2nO8ImBTHVVbR1O5kSeJpAirc7fAfu2PHC /pSAI288+da0qT01hqhC8jjatlTzFv2uDqb+PKqJUsycI6x++lJWYFTqOpPlRRuEMXmbwqAB/eG0 3Yjd4DTtxpt4qhIggxh04cxjSdxkBcg41ExtkklOw7NgKG9zcDUfZ7WtzyoChpPx/SrqblGyk/T4 p8jMnmSHdcGVTcjbbQk8Elq8hTenAnqoq1rbVQl4bmqnjpJvOdbxxXj8wk38AABxG/byJGw0b22Y EkDn9aR1fnCio641Uj3aTYypGGIL3AH2b8SMqSlMGAPOjFa1GdNYKjO0eKtZVMYjJVpNzd9ToNb/ AFcbFw2QY4R75j4c40mVcEA440icaxEVk0U0M5giiN2lZgFO72j2a8cee71SYIHVjxHp7aRtpWE4 cfxpjqMwVlA1PPU1Hm7mkSEMyk7bC5A0GoHh8OafQe8+6IBGH4EQOnaNg21pTuk8eefjSrw3PLYJ h7YlCPmJako5IbwYgBrn4EG1uWt3UpSEqUJG3p6Zjo65ilrFyXF7aYcVzpVy01TV11YWnkLvFA7u oY2BsNp1Fj3B+7mg6e7KZAUTgDMc9E4TtiqquiVbcPb7qkZfz3T0tHNE7q8lWyVDG25tyMyrqSAA d2ov3t3txR+ySk4zEY9fnj+vCkT1wZBnZ88ef1qTTZ2eKoL1VdCkSMJGFwCO5ta9tPG3EyLzxHUp OB+WM/LyM0wV6pioOJdWKSCeZxInkuGihvJazpYkAXubg/X4c8b0qTIxBHHDH9+Hn7k776gmJMjq pLN1ZWo8vy5/LDkrKlOXAB8dSpJuL+zihm6JUNJEHAjGZ6sPYDBpOFr/AH8/jWfCeodPVCollkZB YmJp2AW6sFDHubDW/ax44rMGyk4EbccfI7MPf0YzsSuXDiJ4jnkVHjzV/M69Qibo0a29WLAvrYa2 8Ne2nDBhorTMpMgbJkgj2fEH0pp64OiZ6aTGe87pCseA4YoarnUw1s6E2iAaxF+9++o7cSZlenBC VgE7cfdEbejGk9vbm4VOwDnmaRuW4YMOpZ5JIt1TXnejzEl9VI90yr7tyT46/wACxm0STqMAT1Tx 6McPPhsmja4StUJTsHPA89XHCK2Sio8QpGqGp6OvXyKmDZuaYoxKIL7WAvp9Q0PFNoUoBSVYxw4g xjKhMHZ8AacUjvSFR4h6RO0nn2Utso4WjuUpYZDHuLbZe20CxBNrEm57C5tw3bZIICRpSfkfUY9E D3ikd2tZAGzn3UYvDpIqLDykUXlqhvuJ8CO/58MLnTMzPTRO6CkwTQK9cMyHCskVdIJxFU4qrFyw JOxULXtrrfS9uBLNilxxLcSkkTjB2/pSpsBKFK4JE87KqYhOI4dU0eIQq8NRIzyRyOL3S5R2Ae5O viL8kDugEYkRw93pz0VDynLjhIA44gGOg9GHJpuqKueapkmqoI2nqJd8jGJIo94JBFokVR2Gij6t ePNoBICSIjnZ68Jqin1JSMcdnl6H3etCflK8dVh5YKVLtus8rsVbaTYe8Rbbqba9+CTISAoTE8Jj ykTgY4R7aI85aPdEFJwHRA49Wz4Vudfh8PHXelvI6PZ0pIDHGGF38u9lub8lgsHQkk7ajdpWlR59 2Hyo3FREIITPJaSenLeXAx7g3728OJ3mjETNKmlwdlB31J6Z5X6kYIy4zluHFcJmjAnZ4Qzhj3a/ fThVmeS2121ocQDPPRS9N8pMwYquLqZ6GkjoTiHS+YsqORLguIMVG4DXyyNQbHt25jtvp2FpeHeW x09R+WwjGOrqoY5XvEkJ0qx6+NV29T6DM/SynajxzCKigrU/QQ0flybpGOnuX+0b9gO/MbHuzO5R elDqNJPUYnqw6tmNSdlmcoDW3Dp/GgPyl1EppMHzFV4tSqkhc0k8UotIrLqbqbkEeIPbkjNZQjLW lI8KtUAcMYPT19Jn20XLvg86Dt55jDH3095XyqubKWoxSCn8nAFctWPKQLkgsLW01t7ORpnuai1c lZxOyMDt8viPWjdpAWDJkTj1c9VSp+n6VGIwV1JM8NBRkFKVHNyRe9wBY/dwjtd6m0IKVjUVbT+v O2mLtlZR4T4aEignnjhSOlmEaxJcBjYnaw0GgsfEDhHd5cwuccYJ24nq8+I2+2i1V+8eoVd7+CZ0 YoOt/rDwClzTh/8AM8AwKgqcYxWFkBS9gqFrAAa/Dktdh2TNu5utxcK0JMjrOzYOrnCg9vNeO/l0 omNSgPTjQs/jj+jmn6E+oOHqblDAgnTXqjTrNJPSoPl6bFYf0bR3UWBdVv8AVwO9tG5irXN+9bSQ lwTgDt5O3hQy3ZvgpjQTMVQT/I6a9/IO3zt/2pPZa338irvXdmnjGw+z2etHX8uR8+HPyr//1Dlw 5LqaenrJ6pgjQxPKtPGVLREDQn2m3bk4rYIEjhUZh3EGg1EcVB/NlqozNW13kVcc/dlFrm39Px4m RgcBT4AOM4U7Y5Vx09HDMkZiiAWqlUEe8q2Gw62JJNjxwzjhhSdKhqx20HMtfWSVpw9YzPQRslVH UxW2Sjed4J+nTllpkYjAV5aoBrCs8r0uKUMsyoleI6CSZ9VA8wyAWF/esB+p5VxY4TFWSlVa6n4t fRKpwXPGD9WcHoGbDMYhGC5jqKdEb/SILKsrgaKCNL6/XwFbwNd2rVPhJH4fuoS5bdamtBI8jiOe vomqVJfLp4VBcjcC0isVuPeF1KghgbEnhE6NeJTBiIw8pmOkY7fhRqSglMfanjB2bek4E7DgcKhU 9GGkiAkEMchEL1cqHYpZ9SxRbmwsfE27Dw4m74Bc8Tx4bJ4gn9BjjSsSfGvYPaeIwBBg9QqPNEjv LAjOhSUpsC+6T37AXPt0HfiZDKQYSmQeO2enaMJPrVlPp0klQBgwIPl0+uIiJkVlmLp5byO0VtUR yL6MToCbge720t8OOPNkeGMZ/oz57MCdvn0U/buGNQWCeqZHRjx+FHF9OPUU0/kUMlVetgcI/meX d4nfaTYEAkBrHvyOc0sfyz+sIOnECDs9DhgY44YwBNSru/nCrpCUq2iefd1Cascyxjz4PiSUYkDY fWha2kYldpDgF1FyDoe/Cu6akxG3nn40PbC40KE0MtDLTCrRNgNNEpC7SLbm1F+/hwpDPTgaFTVx qG2hBmKzU0aUwEoZbKqBbLfQ21015tpmF4cKr3mNAH1Ny7X4TJh2YI6CSKWsd3q1kjIvGBt36+Fx a444+S26FpBx2+UbcQeMdfwpE8ylSVQdnRQWPiIqKc1YcpOdrSAW7DUc002O8KwMTHv9OufnwBQH SBG2POoc2IxPF298HzjIgFvD4G3LkQkyMCfT4es1ouEgRz76hSVaxvTvILCoVjZ9ne5/PlC34xhg fdPps47No4RShDwMTjTjR10NMqMQxufO2uRqOwHPBKULk7dvD24x8OqnjcahhUWpxTZUSmoqP0dR YRubmwsT2Hhxa4EpgkwPQfpz102y5r8PRSLxAyTrLIJBvJ/Rs4uAu/XQWPbhLZXRQvXOM9IjaZ6T BHAD1NWeaCU7MBNMcuOsqx00krIqgKJHK7GXcQO4+Hs4IkXaFpGJTM8Z2dOE8PcZJonWtaBhzs58 qY8YzLMxIRjIVDR70Ed0IYdz73hp3+rjl0whLskTzBMESJ6sOvGnGrkqTidvSeeePGkYM111PLDA lQQtJctHIylAXB0sT3v3/s4XsFSgBpnSdmHXjsEDaPTEClIdRBI2nz4c+ftrlT5lqJp5kknvE93a QbEAaxPg17WHfidbBZACQo9Y2HpER7DOzYNtKGroJTKuR8K5Y7m2nxCgwqGNlSdpmpnZ1jUuqqSO +trkG39/Hbi6W7CQMAOmYjpMc8MaYVhPEDHj+PPuqBQY/LNTkSSq0cQRksYgHABCq1j2UgaDXiRS EBvwmQZnYR6AAeg6PfVD/dfcfj7R50GWYs41tcYwZHEUDe6wsCp8Rc39ns+7hiq1CYUSTAPD0GEA R04cds41V7MwknTEnDnGk/BmSqnaNkrC0G9St9gkDE3B2kLcHw8fDjhs0AJBSfbht2Axw9x4nGkA zOCUiNUcKz4jmirRtsWIFi/vPFMYyy2JA3AkdrduNM2wWgq09WIEbZnZ6yPxrbeaIIiPZ088wKgy YzN8uGardy13k95OzgIW7W10ue3t5a1bQpQVp2GcEj1pC9miAoDDmMNs+XurnRYsIZIIDMxEV5jc x6gtf3t/awPx7j4cUKQQ5qIE7Ok7Y4jHHGPXhj5V+kpJETH78OY6qUNBjDyxrHH7saJJcMQx+0oB sLjs2lrg/VzRLcSUhSfIHE8Rj1Hbw2UmTca8Z2kdXT048KU0+a6fLmHRUGHS3xWoAalkLAJDv3Kz FWv71j2J0vfXhg3fd0yIEyMDwAOw4J4THxqrVuq4XMYDbtx6p6KSuFRVrqkk9QJ6mV3eaZHRwWck ksE3dvHW49nCgrKRJ+3yEHqxHs/dAoSUowjCOvmaECpkchKgTmHWMSAsoXdYiwPjf4eHHH3ErnAl ER14+nV+vGkGrGAJB56xUuhonqnBmUtTglI3sCiOGtuIJYXPYnTl7VoLB8RgAEYiJEROHDDZ+FOO OhCACYV0dI5x4+yhnwGGLDqSFY2tLMFuWVTtFtbWFhob6cEyDpSZJJJ6p+H60Hl3MnHh5/E0vYsR p3uhlDRgC/a5st/AfA8K3HfGZjHhHw2z6V5DneHZsoo3WTFo8SpGLb3kBlp4YaSwcwgItt2psSSS fZ24HbJy3W93hBOn2SNh4ROIjb57KUvOq7taZgHz24/u86IjX1z1iwUdbXN8pSJMacJ5coHmsWbs wNzp3+vkoMupcbEg4H0B9myeTUMPKKlYGJ4wcenCTzPXLT/LEV4ZI6grTuTMkU6jcfdLe8ptoLWN hyzL/eJ0pA1DynqgjbPXsw2Cm1noxIPCcenj7PxoTsmpQriNGtZK6+XIrPS0qqp2qVIOttR7LW09 vBZYoSNJAI4ifKCJjZ6Y7IE0R39x3iFJEaT0Y+4Hz2ceqtxf0BMkPQfLdHRExRRUqTlWNyVD3Ba3 c25KqsUJJ6KjpK5dJGFHDxOs+bJjguk1Vq4tZr7SCCTe3E6k6leGlSSEAg7aUGT8XuVw/aBAI2gd Hs53A9gDxhXT0VrvAB0UzZywSjxKo8ugaTDa+mBZzS2SOTQHUDx5ZYB27aukkJmaAvOvS7JPUXL8 mVeqOWocwYdXBoKatqIkLoX93cGAvfiG/wAltbsQtAnp40qbzF9sgBUVWH1l/Cx34qMX6cZinko3 eMyYDWkMxRFsDvIvoBYX5FO93Zo8pKl2ivHw1Y8OB2ieiYwobZLvOkqSl2IE8Pf5+zaaDrPPSDEO kWTsJyzJhz0tQ7tPiLsvusVFh7wAB7315grvbkWY2bpFygggkzw2wPOMdvvqT0XrC2/2RwoAI6qS BvKjB8sHc4IS58NWNzb4cCfdJKRq937vx8qL3LopMJNLPDMHpsajWSCER1MakeUpGuvh3vwtulqa IgEpOzZt6Ov3YUuaYS6NURFbeP8AwnX6THLeUusfVnE8MaGuxF4sAwevljt+jRbnaSOxJJ5ml9P2 TlOWuPKT4lkYmNnEDDZOPrUX71uzmSEzISkn1P6Vcv69/Sng3rN9NGcOm4p4qfN8SJi2V8VeMNLF V0ziZSCR2NrH4cFXapukMyy9YSJUkSPmKMMkzBbS8K0kP+G5fUV8/wDy3+o9V8z/AF8/zI7fJe3z X8s/m3zF/wDlH8rXd7dO/MPf7HOTtPs/ij7fKOHujGpK/nqY9Pnz1V//1Tw0uNeXUzxUtqueVxT1 m8ERdiWN28ATbUa8n9lGobMKiaCk7RQe45QQz1ldiEDtUUTSpRutIBtIjkFyX8NSL24XBOJHClpX ER0UiqibD/l3hnp5ZBQySwrtDbQs3axNwbceQcDApsTMzSdkr5sBwbEZYZAsVQkS0/nbTfftJUey 26xPt5paNAAqoUeqKRkeYIxUy1MwVIqOoeWpCXtI+waC/axNjxhJx6Yp7UCobKL36i+mND1x6eZ7 yViFAal8WpPnKWqUAGGWKEPGEJ7WYXJH7QOIcxtC42YMKml9ldFDmqeefOtQvqBkzMORMdxnKGY8 N+WxbBp5KWpWoSxezghveAsovcacAVywdSiVEKnZw2nH1HAGPgRza3alAK1DYeMmOvb6+dI+ie0J DU6OWKyp5hU3W5Fz7htYNb9vKPMEOQJiMcD8eI8sBFWU/gogpMcMPbiffUIMI1eYRK4Y/oLhQWux YEgL4cRqYVAhUAnYOrHoGB6zPQelQ0+sKKpTxk4bdmBn8YnZ0dvIWFOyoqe6SS90Nv3mViTa3jy7 4SqQCY8hht923hhjtrTbiiBBTh18R1GPceHVSwyJmJcuYumOGkWp8gN5MUUyxESm6o27aSVRiG22 s1racL3LBK0lMqM7do90xsA4gg+Yo0t82cZ0lJAEdOMTsGzr29EidtWkdOczUmecnUeJ4fLvxLCy K2ESEXEgbbJEbdr/AB4BriyUkCegxPrjsHtjGpcy69S60kyI6qMNlzG4sSpqRpJFjkf9NdG22YD2 WGvhwluGREpx49P7qGmW3xKY4c8xQs4djshf9GoMlO6OsYJ3La9u3ttxJEnZHXz7aNW0pSduNKPF 8UxDMeFw0mL1klXRUyjDqKmlc2hiMnmmO51ChiSB2HH2luLhKlbKTrt0IJKRicT+NE1zlhs+Wcak iDk007mSKoYX9xm0ANjY/DjLpOoJJIx6CecdnwokdQUg0lP5lHHUuqgNFIoZI2FiGvbQA6XPFZeI BHSMMI9en2xiaSLJBFJ3F8QSop32yiMqTPGytooGtwT8R2Hx4j1LMlKiSB5dPXPtw6KuH1JVhs56 /fXLCsUeojWOQmZIgVMi3F9C2n2rnwPNgKJIgyANgw49E4R0iTOHCnA+Btgc+lPHzlLLA0bfpLAq o0/dbsAb8eQ+IA1Srq/DgcYOwzhTpbAXqEU0YjeWOjDBoUmIJCLqAxtr4jv/AH8SXloAUEGI6AMf n1g9A4naYW76QgxiRSRxiBfkpaaG5MTsA62B0J96wFtPoPYco+sFKQNInHz27I29MTImDjtTvLCl jVHPDnroI62pnpH8yNPNjILI9yQDax8PdIJvqeGjTy14FR1iR7eOPn0gg0X3NspWH4cmaDqXFquG qqCzOGF9wdgbh1I3XYdzbwN/bfilm3bAVjiege7CcOrEdfSgeKijxRHSMBhwwP6eVR6fNlbhyrPS zGmqoQzQz052sgZdhbzBGABY2P0nij8sohOgkEnb14CI2+8AY0nu7nSglRBTx2YxjAE7eim0ZkJa Mye7TnzJBHE0ZclQQARYLqSLEnjL1gQuUkhQO3HD93Hb6mkas7kcNUe729FMozC/mSvEQ5uXbY5L qwY2tq3iR4fTw0tcsKkGAQCevEcek8Dh7Oimnc2StSfEOiOPAbOG3nZTRUYgQoEwR5BuDByzMvve 7YMh0sbHvbnm8vKm5BKSnYII48DMTMQRjhsonu85UlRT4QI6uOEnq6en31AixmIRsVEdiohADXGh 0uLE66/Ak9zxQuw8QVqVCdvnh0wI2dYxOApE5mT4SkHSBPRs9hw68dmFdrisPlyNLTyO06NFRrG6 RxrP7u1nBj98HaboCD4gi3H220hISoz0RMnE44Hnypl28eViXBjiZkgDjM47OI8qZzWsVR6xY2ia zSI7eYzXYWFive5ue+mvKptwZhR/XbxJ4dPGB1U0m8WhckiNmEbMYjYeokYedKSByZGCU6PF7olM SqCu5TprtGu3QacadBSpPAeZxjZwkbemJJkdKi0eWCYWkYcYO3gccPd0407UNZPUxH5aLyZAXhCJ tDMTYfuKfEHxvwlu3VI0hRVs4jgdp2z6H30MrJhUSogAmZ9OOO3ypQUGHSrIkpTzKp1UM91sw+yW N1GupHEaiskAzpx4EdZ6uv8AfQgtw2EYdfO2hQwZqenmpkaC0LFmkRRGQ9n1AVUUEeBtpxm2WkAL UTBjCdknr9ej40w+o6CZE9P7yY58641k0z4hFBTQh411lkN7bSt7bQpNla9vZpxai1CzAV0n3nDq 9QBGzA1Vh2GySRz68fPGhOytSRPTiWoiaORGYBZDv3XYnUuuummnDSwbVpxk9ePR0CAAekz0Y0Q5 hdn7QRHUIg+3nChBrZ4YJTTUz/M/MMPKdIwugXX3RuAte3h9XL3K1IMbZ9vHYDE7Bs6aKmVKUf1p KZrzfRYLgy0NJGajGmPy8bO5YR3uSxVB4A21B4H32m3D3adSikGScOuNmI2giPaaPGbUpGrUAKKl mjNNXX0tRRVFLHToqmGGWJI7hrncSXU2W1vHQG/0LUMpKgZ0g7YBHwOJmeCfLGaQP2zqNSkrAJ69 nXiR1etFmrvl53Z0K2Y+WdFuCexO0EhSF+jg4baUlMHHaR59MYzgai19cE7Jnbs4cBO0+tR6WpYl Gh/QmM+55jKbt4khVUW+kWsLX4uYQMZHhGHWPbMee2eB2Uwt5WiCBOHl8eHRtoTMnxPiGK4ZSilQ m6I7+7umJbVvfBFxbwtf+IvyVpffJhR9nDojgOEidoxiiHM7rQydcH1HR1HaNsdQ2ba3EPRJI2Gd IMEiIUJPRRmmQEX2b2vySXTCADUbDFwxEE0bGsgIpahopVEqxh6abtYWuT+ziUN6afJB6zU/JgeX GKYrKiCdd88v7zv8fZe3NBBUSabcUTQhYj53nSS3MokYPSrKACEvrobHU82oQBVgcOqmSuo3GHRS JTp8xu3mGT7OztpoNba83pKQCNtVUs8RhXhCrK8kKGlBjLvNKVIZlIFvaPo5dIAJmqIdOMUDWO5a wzMZno854FFidLUeYEEqBrLY9iR3+vgczDdyyvUFLyAoUZWucvMnwqiifdSPQnlnGxLiHTzEThNU 4+ZGF1ZJh1BO1bduY7b3/Tww6srs1lB6OFDSx3xUqQsSaL1019K3Vl+qGVshx5ZmmxDMNZHhtJNA A0LgsbncLC1r9+Y33vY9m7V6llxoiTIUCSPgMf1oaI3jt025cCtnD9K+gj6eOkOWvT30B6edP8Jw ZMAraamo5c1QgorfNyRBNznTvfTmcm7WVC1t0NJ+1KY9ePvqLFXWolavvJkz17KMTgtZ/LatZNu5 mJR42B+yBa+oGnDK7ZSsRxo0t7ggzTt/JMked83/ACGn875r+tu7y0/3u8j5LzPp8vS/Ah/ZtjVO gTr1esRPso+/PjZz0xX/1jkYZDXSVK180SYdRq2xo5gzSSAncTbQkkHmQCoSTGFRMoxgoUy1iyVN RVYLh6vGMXWSqoElO2LcupJ2/UbW4nLZ1ThNXS5wFBx/Maapp8XwatBpKyIGnappwzBZFCwgbj9Z J42g6pSOmnkq40na6NYofk1iaohhieni84C4jXajaeFzqPHjl0wYgimlEasKY6/DaKbz0RFp6Wpp zLIVW5kO7aRe+gd2+m2vhzVwhJwBptgkKEimatj+WZJHe9RSP8pPEjENILe7b4GwH0X42ogkHbT2 uqdPxM/S6udcvt1ayDhCzZpwNXOaKKlhBeaCH/KXAUruQ3PY9iB7eBTPrdShqQMfh19PsoSZXftt oPlzhhPONa8sMdVDKFeQBnO28iOxXy2X3SF95dTcC4/ZwIOLYKzBMETgTxnGZOzEE47PWhYstpBw w6uPx9ej2021iVlO1QmiRJJ9sEn3txNwFJB/bxgvt64OJJAnbMeuOw4/Hi6Egggg4bZMDhhw8xw4 VMSeujpyQNswu5WJZFNlZgTtt7PEm/flXLK3KoCMeGHv27J6McI44badQEg4xsxOEnHHEn3VkpJH kWJjtRN15pFIS/vEHxNuw0+/x5pktgQEgk7NuGGyAds7ZjyPFskETEjZMjh1cer2UOvRfqhiWRcy QRzyhaCqeKGoDW0G5bmwI7DTvwszC1S7jtPR7pxHA7B0GOFCrI81DKggqlO3bhJ92Jny4YVY5Fii UE8OIUrGTDsQJqEaEnatxe/u30N+Aa4sQlJUcCNvM7alW3vQVAjZzyaGLLmYRK7TR+956rGza6sD YfHUnxHCtbOoYYee39KGdneJUBBoQpcSqhR1NOos27zBvIuNw1119nEakEGI2czR00htwzSEzDRU mYqMQ1Q8x6e0i3BOoFlOl+K1BCxpIFFtwyMaKjmmKtwmoqaaZrlHCwSHQaXNveGh9mvfiC/U2UiR ABw48OAPqNu3EA0Gri0Tq8QMc8f0FIePGnPlsZgJyl7ybSCL9luLAkAd+JbZ1I1AkiAMYM+kx0Rt jo6DRVskcMOdsVJGNtHMBEywIFdSkhKr5oJ7AeHbThpcllwAwQYjbOJg4CcMejbwpm0QnE7SD6xX ChzHVnzDURnePe3w7yFYi7aAa6eBJ14kDbZdg4STMqjb5frtEzFK1ltUaD7ePPwpzGZ6p4YiNjvH vfeEa2rEWI11AB7cVvqCinD9oJ+Qx6/Q9VPt6QI6esUw4hPJK3zkctnnQuquHC/Z3WAb6bX5p0JT okyRjjjsOJEHHyJxw2EGrocGw8P3fKkTVVMiy+QWLmYKIjEq+8wYC19gHdtP6eOtd26VQBpT17fU bfP3nGtvITM8Btx556qD3Ho556iVliSFRu8/zxoSpBF1NyCPDW30catGGlqAAMQOPDHhgI47NvrW nbdBSIJJ6vx/QddI+WjnUyhxv80iOnmhUHTwGoPbwueLm1tpbSSBhhGMHr449cdI4UH7mxSprAY9 HV8un30nXo62ljhenEZ8szCRm7uzFTc7za4AJsB7e+g4dN3LKx4hxHnHpOBOzr4nCiJeTBCwUp/T yx/HpimCFsRikMce1VG+4ZXuWvYt4XG34fd34/pZJIPtx2DZxw27Znrxgh91haTKUkk8Onht2z1T sjDZTfL/ADKaaMsogBtUMwG0k2troCfbr/DutafYgknEnCJMbOenrpOuxfiAJTj17Nm2ePl76jJB XTSQqiqkqOFbcgGxCbBtB4/8SseKW9IbgTx9mOE7RHtEzNJjYuJjiAPf69H+LwHrKp6bEGq5mDqI nUwuWDHUDXQi/hrr9duF5U13YSdvXtM/h044Uqtsu8B0zIGB2ezHaORsqSMCrGRn8kSRK1wJADvP 2ftMLED6rcTLvmkHXM4RGMYdE7OvieiKOkZKoJ0nEngDs9NnqMD50paDDqhniacb2ssbblkI0RUA uARYbRbT6LcSLvWzgPuPXsjp9Ogj2zB3bZO0hE6I6JPlwnnyGKzwOkq4YZKgRrCm7y3lksy6AH94 d7f08D76wE7MZ68TwBEiQZnr6KOyy2sAHExs2dXT+vClDQSOHMjoN7gAFlLMHIuBdtSBfQeI4+HU 6YJnZJxnywMgRHUDGOJFLShCUgDYJ9nTTy+LYtiFRBUYlM9X5CfJwNUlpFVVuERSblVUEbQNB4cs HkmCZkRhJ/dhPAUWqaaRITHT1+vzp7wGBf5oYZ3UREkylg7OHKbdQSpJudLD6PiZWrDAcIkknjED q2Y+e0GYouvb0d1ht/Xhtpcz42aUR+XJ7xcQQQRgEhQTbdexsw18TwxunUAAO4xMbRjB2nZOMx6z REmTIIwx8j5dMeynylxVcLw58Ur4UmrYlPk7hZdmouT71zr4NbTgfzHM0aU6xqUdsA9O3EYj9KML VtKvCnYeHyw/CgSxvN09aamdqaCSIgU6eXGNsYuRezG41JJOnw4Xd22VgKwBEmZx8o2+yBR0tkAD EhXXz5UDWdKmoSinnMQjlrxIJqePc0atu2hlLi+ltde578FFq21sWkEjiJwEyOPpjwB20Hc7BFsS No8tnp1bOigNeN96PBGInKs4j2aWBK33L+99d+CcFCQEk7Ovj64R8OAqLrhlPeEJnDEfAjbPu9uF cN9bC8DK1juYLtYqi7xsYLowBOpOn0DhlbnTKTAV0Y4+w+W3j60ieCVplWBHTjs5MyfPpoxPSJcT xHMlDIY4qllCpHDFAllWQlEs0SqAb99fz5IWRWTal6ugeu3rOOw4ACMKBm9bqQgoMqnZGzzOPHhO Mxwitur00UlJgvTzBqFIf9Iw7D4IpFUEL7y6n468G7nVsigulZ1HpoxVNXzVG+CGPzCimBUIJINt f48YQF6tlNmDUvCYZqbEqH5cqJYpWhmSbuN6/a0728BzyJraleEihFq8PnjomqaqpMWI0oaSCRiS o1uB9x7DmlNgRjjVw5hEYVEpMUxStjgw+TDlr4olEj1UJsdfHW3fjv3YU2SJp1ro4nw6eqpZDFKy mGKnqbbfNGpA8TbjDzR2E41Zt3htpsaB5qWl87YJRHuMSLfce1zfldERzzzjVFOyMaZcfy2tNPDW wV5gniCutNISISRb/D344poDGaqh06ZAqRlfqLi3T/MWF5ijwx1nwSWOroMTjAOyUMCCDY9jxNcs pUJKcemrG8VETRoeq3rY659TsoY5hGEZ4XCcdxKOjjjrlTZZaSYTL7qW1JFj468BG8m71w9bFDCt Ow+yllhfaiSvb01Zp6F/Vzi3VbKtJkvqo8VN1CwdTTJiMbDy65QLA63s1uJcsTcKbCH0w4PYf1pZ ZXym1lKj4fhVjXnx3tv0te31Xt29vFfdihP3nPz21//XOrVSYPTCVWrWlrj53lCuYks20MW2+wW0 7cyEV4vDUQpUZxkxQeV2I0iSJPQzyfP0KnFRT32hIBdmY39tj24kcTE4bKdBgjhSQxijxOknjxmr p0/l+KwtjAiZlUIQgk17Ek3+Hw5RJI2DGrlJBBmmvC54q2aeirjFEGlEUcagglnhFlY/6xvp7O3t 4tCgpMmmwNOw0wUQkhlxGHEY1WqgNRFAqaq2xf0Y17jQ29p+kcZW2mCeMVUKhU8KSGL4W8dNS4jR TGSWLyqym2tcyAjQhtSQm630W4jKVIEz5fjTrTuqQMMTSbzVhs+IYfK0VHFXYfiY/l9WjgKWilDD btsbsxPvad/p4luUnZ00qZUEpArWK9b3pXxfoj1BxTGaekLZVzBPLVU/l7v9FldzI8TEBrakag2G o+gBZjl2hfhxn2fqcIA6cZEUMsuuCuJOzow9sc9OO2vqrjYM0aL5nvbnttFze5u2zX7uB51BOJBT pGG3Z0Yjq29W2jlsDajZ5e/j5YjZ6VnFOlR5TJGiwINWjuBvJZhb3QO9xoL9uKEJhE/xD2wdojAA +cbThwplTRSjHGOPDrOz2Y9FZqWKKOKBWRkWoHmt7wY9zcX2EgX01t9Hflre1UmSOGwbB6AbDx2G nVomTgcdgj14R7uupJhkNVC+HqtQFbY6y7fs7rghivc66+H0co6yhB8MgAzx93RtMnz2VRxZSnFM K9nww6PgeEHX6JdTqWpwt8s5gqwQQKemeQyfo0j0AJdVsRcWsbcCmZ2CUFRn7p/XjgOrDyqSd3c0 7xIQmMBGHHr2UdvKUE1NPFHWIUikJmp2ZgN0bAlCAwB+rhWWAqARBFDPLs12gmhCoayKoingZ97s 5CRhvtAG+unA1c2im5IHnt9KH1peTANZIFaef5d2ipBOPLWViEiiUDTcQDrzaQleA2npp1wQJxIH tpF5qy9huN0aQS06SrKoqdw0JvqL6XuOKEW6FJIVjP7p2dfRSO9aU4fDRLM45drsv1VSzU5Eccm5 Kh94jQEb1JsPC9v10J3GB3mlYkYez2Drwk7DjReppSCBPpxmklPVpLKzTRmKLzNssl7J3udbG97i 1r/XpxbrStQIxEeXDD3+fzpECUiEmSOefbWGOolIitIwghJ86WRSAUU+B2Ekafrpxhm2QUwQIAjV jz6EdfGtkpBOzUeHOypr417gpoQsaAl5pAyMof7JNrXsB7LW+nu8rKUiG4GPUZ2kiD8R7QcKojUD JnqwIkbeenyp9WvoZqZIyYzUg7xUeaVCrEToAujXv9Pstxm8a1NgKTCB57MTtgHo2CcMKulapkHD ogcfTD980ncShYMjKDNsJusZA23UXuAnc20sPrPHGbNgpBPhVGzHy6Bt4+YmafSjUowYnqnnnCky YpJZo3YESN7zecVNlC3966g9z7LjlVMpEJJx4dPWBgfwkcIinFoIkEyPn+70NM02HIr7HBImvGt2 0ViAG12kantr9fFTjRSrQQCQIEDHqOE8OI6JAGNaWoJE9GOzgKyVWDqY4z5AaKUe83ugvId24LcH 3bkW019nG0J7sg6ZgcQenD14kztnbRX+VSo7ecNvXTG2BiOoSQRtM0aiO1x7tzo1yBpfwv8AVxQH NSTgYMY8fPrJ6Y6PKrHL0qcmefj+NNdXhlKk0KLEJDtLiMqwGuuwjZ4W9tubW1B2k9Y98epA4YAR 006bBOhQ6cOHt521BpsPSOZEemOx1Iig3AjdfsARr9R04udThAOyOmR54YQJxjbtNF5sW0t6VEde HR08dvVXM0MMskoNNsEYs7Q7VI+1oTtHfceJW2CVGSdJG3HqxxB9m0j21paUo2K8tv7udlSaSKEq sABDqFLyIwk22Kg/aBBIBtc27Dm12ZI2HDCcR0HZEgezbtpQ41pIV09Uc84UpgYKhopdgXYPLUhQ vm2O0EqqkdibgcTKYQoQeBk7ZJ6Oj3euNNd9pBBMe+PbUPD1glnmp4ffjDh1KHci3awNylzYN424 ket1CAodPqfLbPDDCaUMrXtn9/y/HqpXzxU9MhjhaMEhTDMrWB2jT9w3AGgAFr+PjxbbWSW2RAKk kkk44HzgTEepmDgaSO3i1KxExzPn0kn9U554hqY5mtLcPFIrbWawYHdYJoR21JsOLfyQ2kQeGM++ I4bMPdNJBcqnbtx5/dtpXYfnTD8Loq/CJMChxCXE5KGsgxCo84T0sdM0rMkDxlQBNvHmbg/2Vtt1 v60AQ2oFIVO3DbE9XyjzwoufbLjgheIkevWNnls29dcaa9RLHiFa+pLzxJK493b4323Hfx+/iB22 bTI8RSegGPT2RgDxkjYDW0ZcCcfLDr6uP48K4VuYJquKCnrJJKujpCDQ05mZwkAlZyqDXZdmJsB3 N9eI02KlqSFJ1DzJwPRt9cAfiVi2kNiBAPExjPzpGtRYnjc1VPhWEzS4XSSsZ1WMy6H31Qt5ew6W B104aNZXDQ8JMSeMDy4njw9hNE4zEBSUkiePCOnDb8aBvOeNT1OJNBKWWKzR+XK5kZWU7iDZRoL2 0Fj+fBJY5WA2lZTB9RgZgdXxjqwoL7yZpBUlAkATEQDHOPtwoPYWlkUmzSLAqiRTbc6Fgo22AJ1/ XS/D9xC48Q+OGyeePCgHpMkJwxwHlPRxExhUwQo1SigmzhPMbdcFjobkIfdJ01J7d+Lbe3QoCROP yMenE9M4ikFzLcgHE7eiPXnzo7PpFygcz9TctYZArfMSTedPTMCw8oAkFioO3aQO5He4vyTt3wpt CW0pAEk9GA6j0+ZoI5yjUQpWO2P3+8bMIwxra56T0T02FK4gCiVloEVTb9FCAu61uxPBDjMxQcmD jsoWcLnWjeuqIqdmkWd4lAHvf6xItciw5ZtwJFV1EnrrnRioqMTo6lyy0sTyTy7bBg97D2XHPeIb BhVuFCm+KxVsRpRF51LMAFWexbzAQL6A+HLtglIqpSCBShqatPl6anooRTSU+0vIiMqvt7i4H38d UgkiaZSqmfFJYK2nqWSMSNDJvZJQPLL2sQrEdxxh0Dzq7aZPRXCHBqWaJJ445E84LEGjvsRh3t3t bl0NCJIwppDmOAqVUzUCs1PsWSWJgEdgCCAoudfjzyRqOzGvap20m48Snmniw80sc1NIf0tl90XN 7kEcosHVE8KstWkbKx4xgOFVkojhRMOqEYKs0LaNYXtp25otjV1U2FK9aecr1OdcjYpT41heI1FB UU8oME+HsbEg6a2PGF5e2tUqGIq5eIEzR1/9uXrh5PlfzhvN/ln9XPM+W18/z/O87t9rZ7t+9uU/ lLPz55ivfnrnp55/dX//0DSUeEUU2IF56nzMWRpiYe4AZ/e94m7EeJ5kIbdAVUSOOqG2pgyvh1BU VeMwwCpjeL5FUJ2kKi3I+s/lyyWwMANtNB2YnbQbjB6rHa/E6OeuEow6FajDo6m5UsugBB728OIG kgFR20rdkxwpOPTLDgaYjPXRtViW8sVOCGE5IhUkta1u/wDTbjykARFJ1DAzhxqXATWzU+JUa+ZW EfJ1lOo2rdNys3veJHj38T4DilxGoDCqJUmI1UG1Qa2ipKfCYADHQ1JWnSQHWCSVjIpJ7hBbQfH2 cRPuCAk7BShpO2Of1pG1tNiVDRGGsrjLHTTCuoYEW2642opPtFrknxHEq2Ux10/qPTQL9bOnGE9c MgYhkbMtJGklZF58+JSxi/maFXUsLjUqB7NNLniO/t0Ot6Cnw/OlVospOKtvOFarnXDpRmPol1Cx vI+Yxb+WT7KXEpVfy6iGRS6shtqbdwD3725H2YWpDhIgdX6e7y9wztYWjUT0ez5EY48dkUD8s8Py 0cLSBQhkUszOPfJJsAhOmoubfDjbloVBOkDhJiceMEmOmOMeWJk2sz0A7OvDjxnZhjt6ca5Uc4eN XM3lbmZHYqzEBmsNocE7fAd/ZxtOXafB78fXpE+zHorTBSVSk4wejp4wY6zMeVRqcUsdR5TVSGVT tI1a3unuNABYkXF+PJs0glKhIHxHSZk4x7IxqiirCCdOPAAHERIn1PupQx1iYRU0VTQSxFqZgBUL uLBQPHvtNm8G+7xLX7MKwxKVeXD12gwZIw6cKftL1bR1IWSQMJw2YGBM7MOv1qzTp3nygzXlDCoq Su8ivgiKQeYGSRgF94i9yVv7umnA3mFotqceO0ezmak3JswbuFkcRj5e2KEDKOb5Zmb54hK2hkal rbaFinYgd7eI9vAr3CSVD+Ibernh19c1Its8Er9BHPnQtQYpDXo6pOscMih20NzfxFydOIjZgGOF HdteFSYNQMPgmqCzySgwxloomZiD9o7b97/HnkJASBjSxSvDgaY8ewGhxWllo8Tp0lerR4W2KRus NoN7A3HtGvLqZStOkwfMT7vnSF1uTI2iii5z6eVeEzYhJTmSajEZEqlmuALC4A1Nib6W4lW2WMNI IEmSAI2fPo8umi521WlYVIw8qBiuqJcPlQVRIeVQrvIzJtBG4KQL3Bvfvrew48y2lIgpiBhpHDqn aerp66LFv9Awnqx/XhUF69TI8U9RFtTZKBuJG2VA4BYE7jY6qB4e0cXnLwoSoCSNuyfYZ29JER11 oXXeIBTIP4fAedZ4cw+Wh/TqEs4KxPIA3ugAEKR7LD6e/G02aT4SiCYPSTj6+7bh6WNwBilWzy+M Rt8qUdNitPPD5XzMf6RAu2D3rHQ2JcBjexvf7+Vby4NJIKdvTIx68YnHE9A2UpLrnEEe74Yeymio m3vP5MxqJV3x3/SFgwXsRtLWv+fGWmlBPijQdg8PHqGzbjw9ZhR3mEnAelS6R4KtooX2b40WMq5O 8s2vsbX6bX5tVmnuiUDCeAkT1Tt5kxWtGsTPwAw9lc6uSm2U1PuI2m9QyNMWFlK6BxqTa50/Ljy7 RR8z1CCPhHRHGtNJIk9GwYfI/P30njiFPSy1LrPeMgLGXZ1UWP0a3vawF9ebMqQeA6IHyOMem0dN aWSuJGznmayYbX4LLilD/PVlfDXMgqIsEK+ef0ZZQhkUqLm19DYa2J4kZy5rvFJAkYcAPjzHRTF0 pWghsiR/S9/s5wpH/MQqs800w2rtdI13lQCSt7yAE38Ph424d2zDaYhPTIIkk8Y5gUW3DmicQJ4m Plh5n2CawR1UVRE0sbrG+7yknAew8VJMQN9NLW+PC+2SJ0giCMJGPxHpjtOym1LCWirVwk7Pns52 Vip8SpiLSTh7HYSpcWaykXDXA100t9Y4tVZKBJjxHHp8jPsOM+WFNqvpXIIHs8uZ4YYcJa1MZK1C VIIKn9ExcsUBUj93QXGt+3w8Lfk9atJmPTrnqnbsOMEYRhdnUYnjxjp9fd7eilDh9XS01NDuqVWQ MWttZSxbaoG4Ja19Brwsay1BJURhs2D2kzjjtHljTN1cmJBnnoqe2Ycj/wAlxGHFziRx0+a+F/yk QmlLqhKJIklmIJvcqbj2Hh3Z2jWjSQdR4pHpPR6TwoivLxxDgUlaQkbZxI4n5fOgi/rIcUm+WoKp QW83ZIzbR777LAWIsewUXPsFuXGVgBJcIhOOPvETtBxw44xSVi+cd8IBIwGz38THEk4etLLCsL+W m+YrZH8+oRAXjDnapFjtEq7W0UkHhLerIKQEiNuzht2YcOJ85wJoVWVmpKtSlSZ4/KIIGyRSkx3H aWKFafD5ryyFpHLqykKujW922oOtyPjbhda5erSSUgCNsHE8eJw84HniKVNvKgDA4cIPu6qbMUqo sJqFw6gxeDHhNHakxKh+cEc25A5ISohikWxYqbqASDY2sSdN5SBq0eIGCTpw69vDpJmNuNF9zeBO CkwskQIGHsPD3fBEY/mCqwOjwzDKvEJql3U4nJHWNKo8tlJBjEo0DA6G30X4bWdiq6EkQkQOEjE8 9HSKDuZ3rdmmAfEqZ2Ek+2OkberbJALYlVx1VVJUmVPKqCZ1UlyFuR7t2Q9tPbbXgmTYynSnb+Eg Yzsww+UUA7i4W6pR1fCfZx29OzjU7D48JmWoevxJYZYqdzQfomlE0vmIvlEq3uEKWO43vbtrcXRa qgEyOkCNuEbcI2bBt2cKLVvBOCeBGJG3r+fAU6UFLhqUsFXDiwlxKaokp6jDFhmQJFZdknme9feW ZSoAtY3vw1s7JaYWeB2xhhs6McOscNlJ7h0kjE47SerEnZMfHq4XPfhndKqjEsSruoTxNFDEfk6V mO+6RElzdlUjcxIt4cknJbUoaCzt8o2/LjQIzd1KlCIMDExGPHz/ABrYTo1FHQ0E0a291Ii0QIIR 23HT4cNtHjohSScNpp3knloIpI22lt5VJiCQSwvfTvzYRj19NeSRSuyhW0U9TXVWIxstNSQsXmkU 2Dsbi/0+HLKBDflWynGl8sMb0b1NDCDJb5qNwPAjSw0Px5daF4HZFa1AU6Q1mJqt9sU3zAUFpr+4 exsPz46tJpqUE4UwVFNWhqgwzrU0s0rR1DJbYHFze3tJ40iSoiOunUDAVnq62GOjgw6GeShkC7yY nNmcsQSR8TzWAOnZFM6TjjSGxOD5WoEtVXshp32VEsJYWAHe3iObKQBNVHHop4wk4jXVoGHUy1KU +11knNmsLEknmtJUSRWlKxxpxrKWhFastdOYKp7ysQN0bG9+5/Ljq0omqpPRXS4nj0FZFR09QlYh YyU4jc7WsCf3+M6DsGyKcChExsp7/nWYNm/5E7tm/btP29/l/dbW3Pauqtah1fpX/9E0xkw3BZUn JE1c7ykRMxN/NN7DU+7oNTzIMqAX11ERM7ad65DGfmI5RP8AzBwDTI22OKST3ja/+Hx5UpOzjW0q GGFJPF8JaloDVtW76+CT5qpMCldsBWxRtp79uVdQE7MadaUTjsikFmbB5MWqMNzThNO8WAVg+TxS IarE0bDdKQPskWFra+y3EzcjxRh8Ks5pKYpMmpGG4hTeVIWeeNYaKWP/ACY/SMVa40uAPH6dTbix J1YDbSUtqGzCs9fBRYbHU00irNNVpFDQ1U1m2ki7Gx1Fw+ut7fFuOXLekBIx5591USoknVhQbYhh 0WIVEyTVnlS08Usvkt+kbU7ENzpqBuBv4NwqI1JKgaXJQUwDTFFi9BSJTU6lKmnrmShraqQ/pII3 hKqANfZe3gwHjxO3BFKFxIOqiiern0j5O68ZNxj5OiEec8DphUZfxRbLJIyqSqM2h1CnQHtqeF+a ZSH0cQR18z8KN7HMi2ZGzj1+7D2TWsZmzJGO5OxCowjMOFTUOIYZI1HWCZZrX3Nrcnt38ST4cjK7 tFNO6FnCOOIk8OmSMOHHHbQjauW9IE9J2jGBOGEYcOI6DgaQlFHGypaZUkXeI5r3X7QPaSxF20IP FxSoEkDbhGM9HkT1fOlStAOI8PERjhxkRhj1+XGuponSpkZJt0zqXhlurKSba97Gw8PDiZLWB2pG Ez6wInCenb17TV3HClISr4Hn3kTt6pVVCnlz6ooHviKIBiyBfdbTXS/sNhyqGV6iMRht6MeivIcb DYBSAOmPjhPM8DS0ynm/GsAxLCMTgqWm+TCwxUxc7fJDMQlnW4Asf2d+IrhlShoUfEk4HzAniZ2+ 7pBo/wAuzFFuoxJ8yIjpw9vHb11YJlHNNJm/CY8XwpEbEgglq4IAwO5QSVO/bf8AXXgTNsZVCfEO jj6/vAqTbS5BGpOzno+PGhLwbMsVRTU0RmjhqCPKaEkqw3NcFgbH6OEt06G8FGCeHy/Dp9lHtvd6 TCqFfCDEaeJUmIlja0Co37gFrG2uvG0s69px5woQIuhprjiMcvmtKzKoH6Qpe9lGgF+UcaCT4js5 /dTgeBwHGkhPHTVdRLFWU62UBYllsSd17HxsNOInUo1AkYxHt4YH9KeTBMfuoDeo/TfC8XliloYU ppqYMrGFiFlUkubixuQe39vGXgpp0lv7hJJPV7x8qLbuzGkycD1c8+VFHxvKeIYbM86RWAsJEIAS +8dmFvhbwv2sOL274KWdcg8eBI5w6T5RBIu20KgHDHDkcOemkTiMNfRyRmeUEqNwfdL7l2sANzdr Ajv38PEGCZUNmEbMDMzj85gYdG0kLh7mDMyROIxOGOwCY/WnDLWYMRhnxGsRaWJ8Gp5MTmbFJqUq feEJCxVWkhJlG1QCbm9tCeL2rAKxCtgG3ZHCD07fKZFFi95m0r8U6CdvH3AYYdMjjWTD8doKpXa6 WYMzIxdWFiQdtiSLHUduIV5etshWMHy6vcMcR1TQqt942HwNKik9Yj4gDZ58KfcHxWKnqJS8nnLW qFhaJyGLKPgw7a8TuMSlKcADBxBHRwgYfoKVC5aIEcPI8+/jNTZJ5GKs4VampcqsSvclCxvoxQ6X 014jDSmyJJCR1HjsnH2zH4Pu3qMIxSOrq9fKk9iU8qTxRvtWWA7S0LKVIFgfeVjft8O/18XosdSi NQJMYbR8Y956BNInsybbBVsESeY540zyVTwsoeZ9n2zDIXAVwLXFrWNu2g078qqyOlQjZtwGMcCJ 2eQmSeg0musxAGoxOzA7Z6MMflTZU1cUzxyCMyRp75kvqHJHclQdb9vv1HDJnLFpIRMD1AKeiNnv njBBoPLzJPdnCcOEekDCSR7RsFS6rAsRpMv02YZo5qehxiaemoKyaKQQTmmZfNEcyhQ5UsAwvpcX 725c2IQCQPBjB27MOcD5giqquTrUUmFQJ09Pswx+dNoSKmpZA0ZRiyz738wtYhQNpcWsQn0j28Ye ZWFxAxHDEdP9I9OPD31tq5QTOqZOOGPRsIG0bMfIU7QvFNTxVUlSqNEql1l92yHa1rWN7DxHGnWt KgNqsRO3Zh0nb07OPXSpnNpEEEDh57OImPjBFJuvxxfPKUcIaNk21EUh3OzEgXW50sRqQb2Ps4sa tpnHb7PbIHkn2RhRBe56krjaZAOzDpgwTyI41Ahpa2pqWqGq2jkD2NRuZX92xI33X+883cKCAMOE yOvZhMD1Mxwiq2OXqfSCuQCeOMHhsn4e2aWOF4BFTamO8jxho2Iudu7ffaLj46ePCt5a1lJ4HHjH QSTt2eY6YoY2GWNIjSOqMMerYPbA6cMafMQmFKtJTxo0dTCjSYi7zK4lk3krsGy62WwIJbUE6dgW ghYBSPXD3fCJPxo2UUypSZOMAREcnk02zSvSwNUyWrWPnM3mNISD9nvEw7X76f0mNugghQGkCIIE eR6enZIPDGitd4llJE6QRtAG31GHMmk02JQ4LTfMVMiz4rM7EKxJaKMoQLB7drWvYnX6wb/y1b69 KME4giDt9uPV64zgQneZ2u3a1qI1q2cjDbB6cTQesarGnra2WQ1U1IgqZEswYoW2O+m+yoDcke3s BewlatNKgkYYcRPwx59KBN4+q4WtczPT7vKPdhHUwSyCDyXDqVF42ExY+7oouLsQNB2Ps55xokHS SqZ4Gevq6ePHrq+tGgpOwkc4gnr2dFSESXeB5h3OCwdNDcXW25iD2Pie31cfbOsBQEJBw44eU7fY eIgUXvrRhBHRPD4ben47aV+TMvVGYcxYVlvD0d6zHalKKForht0j2194Ai+p0+vw4ZZZZuOOJRIl W3js6p2+yMQeFIszudDcxEYgT0/bAIw59dsT0vdLsL6bdN8u4FSximkgpUjxGPQHzBYXNrdz7eTI lvu0hPAYVG1zBXMbZo3kmM7KSlpIG/Sy2ggTcfdA7nvywiYG2mRApwnqZ8Tjp8KlkdZ7tVVDxggq oYDv8AeKEJ1KxplCI66FKgwpqrD62SJ/PGINHFT0yuNYx7hJIuCbXtflnkzANKGzIM0t6KoKVMFD NTSxfy4KWWHVpAg+jtx9wAmI2U1PXFO6y/zqZPKcUMJjLEVabJSy3H7thbjS0bcca1qI2ipGFUVZ FStS1KxRGkZmpn3ErOCb3+jXlkpBx2VVZxjhzzzFJPH6mKhq1jlVjLYMqlP0etz34wqEnqNVBlNd YZTSY4GWaEuFZXll2W/RlhqLg3Avx4oJSKbUqOilHiZpMKaVaRvJrJItkEC3DADS/u9r8ss6Z6a9 0TSEzDjsPyeHoYWrHpJClUkOj+8oB9ugtxp10EQMa22ADial4fiIo38+poSIRteEoSWsRoRut9fN AxjFVAHTS1/nOG222G7y722m26+7b27W147B+fPPrTc1/9I11NlKjjq4JKqTarRrSQzTFRukvdWj HewAHt8TzId1rSaiEOE4xxrFJiGAYVTO9XPJXsspljaM+CED3dngWBJ115XvQlXVVilR6qR9VnBs Qb5fCoflKOctPWK9m33e6rfwuVuRyqHQpZwgVfuuusjU1XhsaJPV+dgWZd9BVQGwijaQGwB0HfUn wtxh0KSIGyt61HhjSApKlcNxiqwGQU6U+DiMYX5Klt6xyEIzNYgFr6X8O3PNv4jpFb6xWHCpqOpx KZ8SqRRufPTD2m+27pICtlN7WIuB9Z8BwyYbRjO0ik7jfQKRuPZRmwrDqytoqrzpa/bPAzj/ACZ8 zewta+tzdf8ACL6E8Kn7EohST51ZF7IKTgemktW0P8w+QSCnSBqiBIa6GMCwnV/8qbDtcAn27Txp YVidlKkJgbKYKyuq5a6lL07RUzH5OOR7e8Ntyyi+v2SAPhxM45OPTSlCYPlVenrm9IVH1eylUZmy XF5WYcvSVOIIhu3mpKieaAoH7wiFz3Nh7BwhzfL1KJWOH60fW11DcE4frzwx2Vrn1uFzYRU1tBV0 ctLVQO8LSzbo7bH94EMt7XPs4ClLIJSrGOEHEEberZO30o8S3qTJIUekYmZ6PU4AztpqkaJp1ZEK /LKj1UqyMVO09z7/ALDb2eHKF4pBw2iIxx2dOzDGJHA8TShllQAOyJjCT5Ydfp07IrjL5Tb1iLBG 3MkLMXO9iNRew+nUA/Hli4r7lJgDbAPHqxPAmMemnWnNKjJE7NhGzHoPtPlUuijIaVvelDK6WppB HscXBBDd9ARtvrca6a+dBUjFEpgQIw8+jjgZFNpUtKiTirGds4dfygYzhgaXvTfOuK5PxiKeCWWC hd9lQlwwN7jsx9h8deFd+wpSTpAB9nDz4bMCTwoT7sZom2fJWPCqOB6sZGHxAo+GAR4fnWOnxfBa nbXxU+4iIqFkANgLqSb6aa8Bd4yQ8SUwT79oG3bHltgkbKlf8x3gJT8+fdSswvNeK4fiUeG19K9N LC496ZTYqpt3UkG+h78KGXFiEkafQx7eG3aMKWtuJSBjKuemhlTFcOrqAyvUiSsmO0mEbtqhbm49 vHC6hXh589uznjRgwo4YwKZ6qikcQYhHOZY13IZALAWt+fE62tKgojVE7P0PyoxZd04caRWM1Uc8 gdIiHcFCxO5Ru0F9wvfvxMLhwLHh9Rs6uPvp7vVqkT+NA1jGE0lbTmGZdm25YkFrx7u3iBbwA4SJ YKXPEmFThxOHDGMTt4E+ord5bqIx2ewz8/OgSzHlemWEzRRuq7XCecxUPrY97NfS9x7O2nD61fcZ Ikfv6hJGz44xQfvLHUeEYTHDo2bPPr20D+P4PDHuSNTG427Wayix1Kta41v9V+w4JLW6OpSkgKB2 z7sOo9WJoI5hloAxT69HX67PKcaQktMI3ikhl3M2zaq7Rdl3ACykeJH08MWr0zpWJnj57eG3rxmI 20HHstUTGgiOAB6JGw8ePR8JFJXVFM6R0yMCoLVAc7owd1jYe8ND7Tr4ADlLlpK25GE4DrgcCY+G HXtpEzmT6Ej9pMdOO2OgkjnZjSj/AJ/HspwYiJ5Gu9pLhQguWIf3Qbm1rk/tLkWMLJT4o6QZmOHW OscOqhOxnmpY1J844jh6T14+2MtdW0jxQSRE7Y2G0AC7kksLqSLkeFh7fq8wsyYxVBg/Hr6ydmwd MvpvwsicDtiCefl14mm56+vjljxGEs7B9wlmiDqoAEQ0lXbYE6Aj4cUXjCSnToIjaYjbjwO3DhHl ROt8rxB2iII4YcJ/GRUEVENR5cEiSTyrvWnhQgBdxBO3c27vrbTvx9xtZQJwHHDgDx9+O3CAMaYY ddSUjZGMYz8uOH4zhmWvqHSKnklmEVDJJ/L6Z3cLB5oMhChmYDcRdtBc9+NKBKhpGEY4cJicI6eH Xwq1msKnUkST5SerDDrw9kVzrKyRqVys3muP0YVnG0vYKNyuSD28D8b8bWzpI1DZPmOdnimMaUP9 8iVQCDskcI2gx5GejhMVBnoaqpjp6qOcNTRyfLSRxX3ElA27YBu2g+N7E+HF4dLLWIJUJxxERs4x 7BMDbRerL3blzFUJ2QP0/dO3qfcsUtDQSKlRh8M80sU9KJsTep8mJ3SyTgQMH3JbcAQRfuDxA7fL WtSSPB0RMcfU/vo4sMpS0gEDEHoxPqcIOzYPaIp3pKSR4Y4yT5DzKXJ3BWexRSPetuUEganvbhZf uOBoKKRhifkTGJ44xhQtsbQwDIn5fh08KUkMtLQRL5zCWxkRZmRCwQNsuSu428Rf2W+lDbBboBIg QOJE+k7eiZ9lL7kBskjbw593M00SijgwxsYq4pjTS1Jo1qFb3nn2BzGBrsuG7kX8Pbw1tGVuYiNQ menpHGY29AFEN1fpaOKsY6CcOHmfdx2Uja7MWG4fh71NS3n4lICMPw8XARSdpZvL03e7r71xcAXA I4bMWbiwYGHSJ2e3Z0DAe0GgheXmpBXPjUIG2POOkbY9D1hVEaqrljmYu8fvRguAAFa5Iv2sT2uA Py4doSUSkJGPs6uGB47fTbQIuZXMkBWzzPp7+FS8KknnxzCAKlqdpJoot8dlXy9xurOfdKnW9wRa 9xxzUrEkAgDDo9mPznCK9bKMgwCQesnHZhzt9KZ5RT1BlM7GnZhJIhhXvJcWXuAAV7fVxS8kxqSM Z4zPMnorzaVkSR7udnsFSsPiSRAu528km7xADduNiBe+hHLoQSQYAk4TsMdIx6+OHnSO6SsKJA29 XI93n1Wu/h++nHEMaxiDqdjVG0FFT7Rl8zo3vbXIeUd+wFgT8eD3dywOnvliCdnl7tvD40Fs9vVK 8AOHHzHDyHR04+d+2ESUcVOpjkAiogROkV/fe3ug/DgoW6SKC+kwKUq0stbU0gjqN808TIyg7Si2 G5h43JPFDafFz7KTqTJx2UJEEfyFHVV5ZoFeFIDKxu2hCHS17HhigBM4itJEnyoTsIpXoXo4qKse OkmgTEVVgofcze73Pa5J4wlqVnGtvFUClZQUlafmMWbGCaiBvIZvLD2PYXsR9GvHwgnGqrVjFKjC nxipkgj3w1kMSyMIUX9IGOl2+A79+aXqnrqmINLdqCCppi7q1NWxI0CRPqA/2iRa/KKaM02NmNBv mjL1TitFDK9Q0lTQM4qY4RYOqm48Pj35V1okAmrpwBFR8vYhVRYlTUgjkooJFISZtxjlCHVb29vF EwYplw8DSlrsSpXUVooWpwpAmkkVXBI0Nj3tyjxJxit+dJXEqOmlrKaWSGMw1jLeoQBWXQX0F7X5 vYQQK2pv21OrsImnLCl3ClVLRsrX91Re/bx+HNOIUSQKanZSQ8nFNnmbNdvmeHfzPLv93GO8d6OH Rxq0J6TX/9M3OIYK88yyz4yI5wsnytFAN7IrjZuZ37dvAcyJcaJVgfOohBCRzz7q4z4DgFBgX8ox ESOUQy+ekZLStfdfQaAE/XxK8EwAOFXIUeqk7RHLscEeGxP5dW482m2xg7HbQhmNvp/Ll0pCpp1A KT50qMbwOnqMvU9H8rNiNRRu1QI4lKpHIw0Yk2HYc3ctKMHiKa7wY9dF7lq6WGmr8PrpZaPHsNq/ nUkgQEzRxqCbk6kk6DiBC/bSokaZqCa6jxF/m8RpEpTQmnqYYqhLzFUm8xlI+II3DsdL8MmH0hQO 3opA40syKUGLV0FQtVW0kQcVRGI4dDUbndSBcKxXQ7tCe1yAOw5a4JOCK82j+lQe4rWPQ0eISVtA sdXMonp6xT+jEkjmKMAhQAg/Mbj24hWkhGOBpQFDUD1UHNfDLRJHtQvR06B4ahmLNvKqyk6E2LMD p7TxE+2EGKUIckVDwfGYKiSapSRVaSA0clNOu9GjF9GW2pt3+i3NSJPRSpK8OuqivXX6Q4czUlf1 Z6ZYR8rXqJJcWw6FTsnWG6s6AKdpZhpYa27WtwOZjYS4XCMD0baPcsugf2ajAPl1Yn2fhVHhjrqK u8iqhMLws9PJfzGdGBttG4C5uLdvpsewdQ0yr7QATE7J9dsAdIA6qP3FIKRpVIM+vTHv+NeqYUdI BTtoBKwQsy6EWOiDU27X7D7uNqtm9unDoHVPRHrPs2TtTMNqGoyRxT14wZ6ts49OMVPp6CafyIjT lJ5iY0MZmMhLSW1UC1z27Hv2566LZwSmCZwGIHz69sQMMIpULdITpBMjaIGPpAmIHtprE0rzszgr CheNipf917dyPhodOF73dkKVwGPpwgHZwGwTTdlagAJXhPSNvuPT0/oO/TPPdTljH0hlqmkppjHt ZHYgFyFsLDsfE9uFmdZY24C4kRp6gY4z1TsB4Tx2UNN194u6UlpZ8PDpx8p9dnsOFh1HV0GeMHii rYIhWxrtiqqUFmFxo19NeA69tgoAKBw9OnoNSrbFtYEfKk7PQYpk2aYShq3D5V8z5xi0hu3+IWBW 3j4eziUtoR0gHbjPDrP6eVKEtBKh+799LLBswGeJaQSeTC17Ko/e7fvDQcbVpVBHR7udtLgUzJNc qimSaFWZtruWVClwGAB72t46682u3SU4xjz+k1VKQOFBZjeBzSyTruJTQh2JVC3sOnttY2/p4TKy 0YqKp6uej30rW6FJHV1c+uNBrmfAKq6pJFYm3vKzBTpbRnGupF7g8XOobbRATgOOHAzgIEcgdJYZ dShJO0c8Bs9KAfFKCZqmVGjWUXIXdJtuDYAi4Ha1rHnre4lIUnEn3R0x0YcyaRXbLS/Eo8Oj3eXT SDbL71NUYQ5paeBtjCKU3Xduc6N91x9Z4e2pQEjXj09cfM8zsAezHKkkHSognq4T8/gcKaKnBIln jSnmeRJAfeZ2JU23HadgPdvHtywuQlJA2jCBB89hGPoJ6qJk7uoQhQJiduEdPHHh08dlQqugApoV ljF1HlvErSOt1UropVT3/LxtblrJ9IWdvTJgdPHZ6D2EzVP5C2QkgYztAjHzAPHj0Y7KhmIPTGla JYZBIJNGZT7y7basf1B15tt7WskJ+44DDb1Hb+Pxo7l6UpkjAbZx92Mn9Os1grkIp6b3yZnZozEh kI2bBIB5gDA3HhbjiFNbE7J6AfYNo2fHbtovdYaQqDJx59RIMY0x089RJIKanVfKhDorh5VKkkMV W7bdNtxYXJ0N9LGettGBEYzt9kcjHGiNwpWDj1z04fOeOPDjWOD5hqmVGLJMbkAh7qSR4e6Drqbi 4/htwJUCYkRj0x5H12D9WmtI8Y6gBsn9/wCOBpZ4HHV0kLGoYSrWIYZ4piJGsXG8o7qxjIOgK6/T rwrzNxHeK0JwEdcwPP58YJwoVWOXFcbThs2berDp2EYdU0qIKSmkjiSkpZYSlyxrJhISH7AWRNNN LX14gefaUlOBiRxAxxJjE7OszjNDBGVpAlUKUOqI9nGPLCnKkwuaRnEkY2OPNaYOgKqCFsLAD4C3 0fDiK4ebTKUzPiBw/dxOwj9VCLdtIk7OiD+FZsQ20MUINzKp8oJdgp94MC1ge/jp9HGnLcKQMJJn zxw4kY9EbPLYqU8gg4xP7vX200UeJYZhNOMTraimra2R3p/k6qGWoSMb1YOAujFgTdXW1u/jY5y1 pClQlAMDD59IAEdPXHSEc0zNsEQsgGDgIJHAcdnSI9NtBBi2MzST1CRujrGDFCd9gu5QNxVDtAIF tP4cPrK0QmNAPCPOTAn8aB+bZmh6DJHEAicPnJ444YbYpLSkWmnR/MsyunmmQCyoA522Onvey3DY loQSmeEcyZjDpkGg44EnA7TJ6PTZzG3p4xM7uiiTzlsFKgsSxN7ED3SR48Vk7SEbSOHvx4j9aThK EjUUxhxAjq8vnWIPKTFuk2FmEaz++pCnev2mZdGt4eA8O3KrQ2SQUYdZA6/jMbB1Hh59BB8Jx6Bw 9g4D411LCAUVgVsPNRnaS7Ke9vLDWHh+ujTPdFBEEwfd6nbh0fKlGicJiRPA4+zH2+dGd9MXQLG+ vGe8Ny/RWhwuikjqsYrS7jbEp3bFJXUkXA10Gvfh7kOWNvknSdM47Mdh2YRjt6ogAk0S51cJaRBV iR0D9fnNbImVMsrkDCMGyrhsIw7DMFjeANtA8wkbQgtbQWvwcrVMCMBQCMY0NGGRrTYWz+WJlWVW ZSSS7Mu/VT4X4sBTpFIzKcZpb5bhRIFrJTsmhjWpxAH/AHPe+0D4XuL8WWwAMnk00T1UNdJhlDX1 NPLiVYlK9Oxq3jQF1ZY1sosR4nuOLBp0k0yk0KOXMUoJKF5qikjlrI0YCQDUpusqqON25gTtpx0m cRTrgWG7ayqqML92CuMYqqYvu23JJ0PiDe3FaW+imlKiKXMRy9h0Dw4dNKtffyTLJ33Mb6EcspKI wqgB4GpMtXXRfKTJTCeRXMRhMn6QkfvGwsdPA8aCwBWkIBqNXSYjRLU4j5a1SVqsNk4KqgXUL7vs 5QuR1mtThsoN6SqxCqhqohR/JvRq0ySpIpVr62AvcX5YLBTMY1siSKWFK0kVAsLxtUrLEJ2Ug+6x UErc824vCmSkagZ58qS1PisE9TFQzYay0is0bSHsPYfaTzaVycRViJHXSsmqKfDsPMtPOtS81xHS FwrAdiLW005pzHAVXQeNJj5bEfM2fIyf5bda2t/K8y3bv+VuNaFzs55409GNf//UM4MUgoY4pnoZ YsQrZVheqrZAbhyOwX2knQcyIkCBURBuVY0rv5hS4TUPBWhq+fEHSCgpSAAFADn8vHlNqoFbTAia T2YanBqSb5ekoVqa0DbWLAm8IrE6lvhftzYOkxOFWQmTTzU41mHEoZUw6RYPLjjQvS7HAVZAnvDS 5I78uFFUg7OeemqkYYUEWY6GOoxOlrKXfiNWTIZZoomCSMCTtuo1Cgi9vHhe+gBQgbKfDkmdlQcy 4RhOJUseO0EWzEQIjiAn0HkKLkqgv3Itrx9CgVyKagjjWCCmo5q54JqtPfaSQTxI4WHcgsLEXA17 +wad+GLKBq0z+tMpOEmmjPGAy43BHh1JaQQ/6P50pKwsVZWBcAm1x3HgLDueNXbBWkEc8/Gqp24n hQTYlUo1TRw10UoFA8svy7Dynl3oU2mw26bj8ASB4cKHwSZA20YMjCZoIsZw+fDq+f5AAxUhRkKX 2SSldm4H/XY3t7COJVoKVkDnnbV0pJFTsBrkkgkwvGqZJaBgaeKgqCGPmSL5jb76eNvqPNCKVtLC TFVResr0FzSQV3V/plS3Hlu2LYFEoBnLfpGdTaylQe1uBvMstDZDiR+HmcMduHRR9lz7aiAcMZ9f bzFUyVeHzUUkkFVE1I9O8kMyvIYizr7m217Aki3bgcKlrKpgp5856cPLHgew1qKVFRJGGHT1TPnj HwqJscy+VHGS6SNBtW+0Em7aAlgNT2+7jhL2qUqCuggDZ/pYmMD8aababS2Qvr6R6TI2RiPdFSKe KJJZWjiBMjxqytddWNkJIB18LgX+HEepYkzBJOJ2jAAmCMNpmDJAq6W0KMSYA6MeGwlWAx2/pUha eWmMx1B+25gcr9Nh2Fj42+nXjV3OohJMEgQQCY4CYxOAPT6TStpptZTgcOJHwGyZ+O3ZRh+jXVar y7W0OHV9Q3yQS3nVJuiIHC6MCRpe/CLN7IlSVJI8XAcfb1DDyHXQ53b3hAUG1T8+qR7ts+dH9w3M tHiUcKVk0c6VChadgRtay3vrp24E1gFenYodPJ5wqVrRaVDCnWrypSzRS1mBFPmQVMyCS4GmthY6 nvxq6QJOnjtpTb2gWvD2Uiayeqppo6XE4mo6kKTEXJ2sL3JBHccRtXk6QqNRGzH3Ejb8qedZU3Mb KzzLDKlLGrCQkLMkgA0DD2AePNpGBAgDnqpltaccdtJ3FMtLiFPOEjFQFJqHWBrlUJ0JYXsCbc3f 2q1gEAahh6dGAPrIIpO890nD50XTMeExRwx0MYjePD6l8RQyBRIS8cYNnIJt7o0HjrrwtauVoKkK 29Xs26Yw9DxrSEBSlLMgkR1eon40C1dRzR1jRiHegYF4kICta4F9BqBqf48UW65WI88TPAdROPn5 Vu6YQUyOffz0VCWlqHSTdF5kkqFVjlaQnczBfdBZdLX07cu5dLawTgBjPCIkDAdc9PtpkWzZB4JH UNnpx666mhgkhnM1FHNV28nerybonYXDe6xAZgLXNx8L80xeALkR7PlAkdX76LXLZKQASYHVtGz1 9o8xSdamopainWKCRZEhIqNxWTswSQ+6E3AkC1wbe08Mbd9QJjpgSePCej59WytXOXYQtWOGMbZH nAMfuFM9VhEUpMMAAIZqhAHO1ioG4jb9A0H3c3/MXSApSkx0x0+g2beHRRHmGSW6xIkR6jjGGPHH mKaIcsGNopAGQr788yspVb6g2sLg+74m/wCXDlGarQCE7BjiNs4dB68P0optsgSsDWo47JHr08Me r20p8Pyy8cQnmil+ZBvHOGICAG5IUd73Pa3CxWbOGcU6T1fphHqTwo0Y3dbSInAbPD1bcff7ttKa LLsEcL1JqljnjNhQsrqTvG4yBhE0TC4FwTfX6TxDmFy4WwZCjhwk+3DD129PA/trFLS/CDB9Rhwi cPZ10oaCiekVdsCrKq70Qi63YBDoo/MWt48InnVuJwIiY2Y4dAIGM9U7JMY0d92iMZk89PxmazVc HypBW0e8NGruy9xYmxFhcbgPaeP2zq0AEkAngIn1wmDx9dlNT4Dx9OcMJoOM31bVJhoqT3apbxSx RhlKEr9k3HvG3D+yQpCipwpAkEiMDjOACenkUEb94EFIOKtmw/PAeZoOJzT4dRyQk/O4hICkoTTy ymm0KuhJFi1x4eBvc/tg6oySnT8tuOGEcdvwoHXwtm0lJUSsdXl5zHw2YUhvOo2qatqxJKkNFIkZ ja2x/LIQ+8CLBgOw1+BNwZpQ7tERI/GZI4z1Y9FESWkagJI6MMdn+MdnH4cK5Izn5XfG08SkLOov CdGH77A6G/a3588laoiBHkDw8ur2nrpKthshUEz6Hp9g+HTTiVwt6SmMcNUMQTzEqIpWienmiPvB gSImQj2Evc63BFioty4gCCATG3bxI4fh1mqSNM44ESI9PPzmPZUFYTTq4EDwzOA8W8qBsNmB94kD d3GnwBHgqVcLRjwJ+G3gOjAbergaJUJIMmer37fwpddN+nWNdSs0YXlrAYCZ611WrlsxFPAHXc5t oAFPtsTx+2tjcQlUHHEwMeE8jziktzddw0VEzP6evu9a2L/Th0eyr0QyxhtPgVPHWYxiKM9TVxsG lL/ZaR7E7dRcD2ckthKWmwlAigDcOh1wqUSSefZ1TRqlqanFvk55Y1cWs0iAugJbb4a3PbiltBMG kZ66FHBYI5mkqRTMvzoaOiiYGw2AKGII+H634uZbnbhNJlRSlp8MloMOSOMfOS1m162OX3T7pGy5 00BFyLcWqKhAFMq+6hpp6QRYIiR7DPjjxfplsGiQLqdTprfS/HXhgBtp5tISTSjhw1oikkrmljV1 ip6pWFnRCBqF5tLGkUzrBMRSyME8CrJQ1aBkN56qG6nUdzfx4/GIprAjqpy+Up6VViWvaSepVppc QqSCiXHaw+nQ8opJBwrxM054afPleP5kVEl9kc9O12W5v+Z407OFNqVxFP1TJA0klHIJZ6SaN7tE d6Qsotdra6635vvYwr2nGkzNluieDbDDIGljElQOxIYgDudObCBwrxmNuFN2Ewz4fU1mHVU71kcO xKZJBt8kAbre73v4nmwCNmJqziQSBOym2ejmkxeKs8wSNFIFai2goR2uTppzRB1VtRQK7eaapqpj DQNFVh9lOV+wzf4yfq005RbpiE00pupH8yxrdf5ht3neX9gf5TZt2/dxuT/Sp/Dor//VMzMaqCV/ mcPlrIIQk9PVHY7hlTdcAeAOnt5kO4vSBAnGolIChTq0WNYlhcjVdEoq5ozB50e554hKVQbTptNu 5Hbjh1ExFMoUAvoFMWNZdmwhaCObFk3tJ5spha7GCOOxJv3IsR9PGHFp1RwpUgEinejxSHB8FqoM uwtDSyHyavE6iEmW7jzNN3fv3A4o7yR0AUkKccNtM9BXz4ytHhmCl3moo5i9QFCRyb5dx1toB438 ebV4oVGEVRQikfnLD8RyxPT5moIDX0M4iixwxMNGQtcADsugvwvdT3apGylzThVNJaqr5TXw4hRz bcMrbVUE7OP0Ekm3eGFtELN3Jv4Dj6HSpWFNOoEjoqVhGLMnymXalFxbEMSMoE9ICDGWbcCq9yVI OjG19Txbb3CVQkY9dJbhHHrqHmPA0xfBzWSQ7qiPfQQQBWaQCItOttvctY7b9z73a3Edzb+EqO2r gDVMxQL4rl2onweGeuDw10rJXSRUxAlRXkKqFH0DQ+wDiJxoDDaaME4UEObqCmynV4bPR1Mk3muq VC1JFkmkZlKEnwtccRrTpMCnGkhRn8K5RZxxOmo6TC6+i+bwvEqlKaup5GQsgk3jdYgi1wfrPGgS RFKO8iOqq3vVv6J6HN9PXZ86R4btxGjJmr8CpJGSOtklf3gvl2Nl26aeHCXMstTEpAIA6/XDro1t 7jV4SBB8vmOZql3EMOxPAcQqaTFaeSixWiEkFRQVS/pEkUm32kb2GxNu3fgWadU2BpAGnqMYYcOr q9KP3EILmrCMf6OHXs6xx41xwqnetSpnkkVIqd4hMyyQ+6zFrDZ9r93uNBpcgHni0YIhQBxOJ2xs IPH3nERhhZgoDgJUB0HDzjHGI9OmsE9RO5R9oEDP8pHJKYtpYdyAVJsQfHT28o41pkKBnZImJ4RM GcejHYANtKEqZUPCBB6CB7h5YTPR11EV4qdTVedGJWO1EQLvjsbDRrgntp+oYdtFpQkFJgzhjjhG J2+yJO3ZVmnpIgDA8Ij16I4bJxNDt0q6rnBqqHDMyVBfD5WZKSedw5h8sEbrk3F/gPHgYuLErXOO zoO33+W3hBqQMl3j7mAo4bJMR04kcfPjR88lZmw/FFjko8RZoyhSORDpJtItdtfD28I72yIGzH19 wqTMtzQOrlMGeihjWDD8bp2hq4Ffcpj8zbdQVOhvbxB4TraM7DQllC0QfxpF1fT+KPzUwqvdDRRx fK7yzqSAAwJ76XNuOJtxOozqHWZopLZSs8ZnCk5V4LiEDmB4AHAvJUq3e9tPD2duWUoKAgQeJpK+ ws+VBRjmT53r6h/mXX5oBgqqNtl09gubDT9vEq7NYWpQJk8ZOHx48NkcKZ76MCmefdzsoK8VyHiE 7hxJNUTuGcxqqADViACLDT8vz4kaHdrOlJ1ROM44HzJ8uBxMzRkwBMkADnnZ+FIqoyviSyvFLEJp lQxuQzKUbQhri/a3hyiXYUNKTrM4bDw5PsmnnGU6Y/DnnGk9T5bxOetoKBqk0ArZhTTVVXdo17jc 1t/i1+L7NYLkRpBjE6js2R++ii+YCUKUBq0487OYpH1FBUUWKimqoHeailEFQvmLtLRPsKtYG+oI /hzTD7TUK2nHDUT1HaMPUYddJHGAtEyACJHRjx2/hgac8NoYKSvpq2aFa2kErSNRPLIiui7iYy8T JIBYkEjXvbjb16tSgnutW3CTGJwJjjtx+VeGX96kpSANmOHwiJ2R1YGnbDcp1ZmEi1bU7QHfvS6B l9gAQAMQNAOO3b8FJMKT67ceB8tow91KlWjSUmAMfL38SMdtKeriipqIbIktMFhjSx3B0upIUkAX 8SQT7O1uF9pcqSAkScIOJ9sRBnr9Kqm2hWPDH59fupqjmEaoVg3ShggNu5uoNyNSAddQb25ZplAc JCDPQDPrEwPgdk0qMDAH4YfLZhT3U1dBSwGoq5hHVQTLHBBGVHu7Cxfve4bQAfSfZwxZskqWhWkq J2yeGMycSOv120TPPAK2YEbfdH76DrH8xvisRfDaeYpCDNLLKYzHH7hQHtqfd8Py5W2RC5xHr746 TInqjbW3H2+7IQUk7Adg29OOHA8mgex3FK2hoJ5KFnqfMlNPNje5Qu+ysYY9Ab7Te+hPs4KmrNKw B3emR/fH1OGOPsPsqMb3OGwTpUCT9xHvAGGzyx+Ad0cz7N7Dz1IkWNWCE3cgM1mGnca28e/D3W2B CUlMYbTtHVj14T6UGlMwo4An098dHX0YdFN0glaoDRs233rpuRPeKbgDutb29vjzyFAJ1LT57ccT w6OjaOnE1tQJwkT7fPGBB9lT5/OhTYgZBIE37XIspsoJW17W7H8ux48tCNBAThMn0j06Bxw9a0kI KTBgR1T1z6xhhgK9AikqinRVVyqEMbg3195QL2te/wBXNtuhJ1Ae3VJnh6jo28aTuuKP3kFJ6ej2 T1xtI9hEnpt08z71nzXh2X8v002LTQxw0b1tUx8mjpYRsQsxHuqoPugXv4Dx4qyzLFXThREDidsf js2e+q3S0MtqJUJ6ARx6oM7PIdOyr6Ognp1yn0WyolNhggxbNDxzLieMyDdvlI+JayKdAAfbyRWb FpoFKNnTQHubxS1kq9mHPrQ/ZNpqiennhonZpKYrHPMy+6BO3vWsNNLAW9nHWsfKi5S4MYUN2GJ8 hSU0FPGqRMxihRftN5Me69xfv8O1+L2kiAIpM4ZHWKGemqIhJSHSKW3nCRdIwqL74BHY3PDAKCYA qsDaaU6eZjNXQ4ZSUgmrKomlepG5iIB7xb3Po79uKtQMQZphIxk0KlFl+etdWp60Ui0cYokplS8a qlhe/wBXKNthRKp58qdUtQ4Ut8KipKaqnoiY8TRPLplqSygBzrYBv48UNKKht2UnPGcKdMQxGkek ZaGZEeB71EMgVjtHfb8b6c2CBWwodRqLTYV/OI48QjTyhMGaqWpuFeJR7u3w1+PPFEnn2VVEA40s Mu4jh0ksUWHYdeqVxS1aovu3UbrkjsLduULgOAFaQnDppQ4jQ1NLaqwulKx1O7zIhoHLC7Wvyqts ivIUSIpnrhFDFK2IJIY5PLi8uKSwRzptIHLyAJ01VGyoFZiFJhtK8tFGrlCitNLuDkWC2t3sOWdU B1V5KTUlMSytXB4auRaKvYCxikUxlQNw3EePKhwEmqrMGs8uASUsFNiFLUfOpNc08qMNoLG97KPD mi1pOHrXhHHZNNX8uqt1/N183z/tD/ejbb2drcvh0e+r94no41//1jsYVVU9PTTQ/JDBsMjRUpnN mlnK6Ndm7AAD6TzI7vRsO2okWDIioH9Z4a6qqzQMlPRWAqWU3ZiTYC99PjpzREmabUiTTNVYFR4v itQHgDLhKoEhd7s7GQuwsTopF/v402hBUSRNeEpG39Kcs4TtiETNSSJRIahENFQ2VREIxZWIBJIO p5ZLY2k4TWtStWFJb+T1GHouIPUg4VOj01I8ZZQHP22NjfuOPKSrZWgSDgMaakUSU9PhVSWxHCKp pSFQFQ1v0jEsbEgcTraBAHCrNO4xFB+KHAMLxOopqyR4cuVjiPzBqVuN6A+yzeziDwhcGaUIQrZN QKPDkyaZK+mf5xkhkmwbEKhWY+U0vsUHuxsFHfUnhiyAgSOjbSVZ4EUxVGJ12KV2K1EeJhKiUJJU xwsVUPPAQzqBYdr3I+AHjy6F69hqyWzsjCm+qjWWeKhp1kWshRaiGsqm95mS5mMhYkCwUA+y1uNq QVK6AKeCwlOFBZj9DS1c0DmjWpp5pliloFIcyTF1RTr2Cgjcfp4WPNeKIpQ2SKBrGaKqweqHzhSK jikSagbbcinDgRNY992jE/63C9YCcOin2xqGNKHCMcphVIWgWAI0xkDEKDGyAowQ993u2+F+aU5h E7acZPiJonXqa9JWQOr6YxmnAqZMKzmFiSirKb9HFMR722QW2sSdSCNNOFVxlqF4gwefZRr+eVgF bOeNUbZ66XZl6a43NgmasNOG1DyPElQgYRyoJDZkZtD3B/ZwMO2ryFkmMcTPT6cOo7dkjbR5bXhX Hh4gDoAw6tnz6TSFmmp7ClkSyUz7YI1Zisd0UFtqkqCQAWJAHx4hKVLCSIEY9XXjOOM7JjrpW0HB OACidpw48MenzEYxhNMkqiOJlc+bHUvvdt1hpd/3lPawBJ+k304of1FJISR0Y7YkcCZkzGEnGKbc WFRpEHp2efnHA7Z6dtM7SxKEYjy2iDAiNnsBYm4Ngw1uTYjiAMwpJVhPHE7I9vR89lLmn1LVCBE7 D0bTx49ZmaF3IvVrGMkEIJPnKKL3HpJi7Mu7XTdY3trqB/SUX9sX1kYlROGyNkHjsnjgZ24UKMm3 mXbJBnUk8fXpiPPyw24H16Z9acPzHR0kdOPJkQWq6OUjfHJprt10Pe4JHCNWVrSIOPz6/wAPWpPs d4W3TEiaMVhmIxw1as7AiWlVoxIw2sjOQB376acSdxpGJijld4QPKnaV6ORPfW/mhrbtQbC9zbUj jD1qEgRsJ552UsZug4RMQKS7YZTYnFURPGS8cbSRiwvcnaGB7jvz3dnQRTbmnhsoPsSwCWjUpu8y BdwMRYMQO5IPw4WGz0kY4Dz9+38KqlyCIG2g9r8LZZSIoQ7SbQl9QFBUEm2un0nni09hAE4wY6ZJ xkxx4fhW3Egp1HypD5ly/EJYYFroaGlqSFrZJrNsVwbtYKSe1tLkaaWvd9zLDqEAASOkk4TsE+wY jHhRa1ckgkJJPDb+PPspjr8nHGMWqcTglFTFIImgichfNVEEBd1IHvSBSzW8SeOKt9LilewcT548 T0z0cKYYeACUKEHHpw2nDbs2eUU9x5EwnDUhxCaXesW2NYkey3JF9oUgEkn48LH7FQGImD0bT0fG NkedPt5ksmBhXGWjp4VltG9Qx3StTq6Hy95tpqRb3vDv4a824w8psQkYRIg7RJ4HjxOyPZTql64w w+PnspB1+HYnV1arHTPJRKTTN7t1QCxAvcC59nx7e1MLJaiEnYBEDjt2DAxx2eeNPxA247ev059a xQZLxOr2tQ0sxoFuJWqtyKrlQxRbu17PoLa+Og4sNlcIEJ04gbQBiOJ6YGyJBjHGaQXDokg4q5x2 Rsx6POo+JZEw7BaSTFMerV+a2loaGRg4C7G3FiN3YDt/RxU0wswBirERhtA8xj6TSR59U6f4QOej nhRTc35wSsqXw/B9tLRwOY1jpmC7yNb32anW/c/w4KMqyZYQFOGY88MANkicBswoA7yZ+4oFpEFJ 2n3cDgPZSKStpaSkxHD6mjgqZMQiRY6io88z0skbiUvGY5FS7hdrBlbQ+BseHimtTGlIwnq/GdvS NtAdCymVBIKtgnZ6Rh5RTJGIVUHcWlkO4FGLkAuq2tY6nbyyWJWADPDo9cfcINPl9BUQEnrnhjOB 24dOFY0ZjVSqqHcis7LL+8f8JNu1jfsDxxEuBIMcPPjGBn5COqm3FQSomTzxw9vH3U91OKVtThdN hHnsKCjepmp6eHaArVBj32KBW18pdC1tOwJ41dIEgGfPieP4+UTVWrgxx4bfxxg7Oqhu6H+n7N/W zGaHD8GpHgw5ZGXFMXZCIoFuHBVwfeYg3sO3ieGmV5K6+5qBKUHidpg9HuEn20ivMz7hEQCeHDZh OzYP1q+joD0qyD0KwbGst4HhMb43URJRT4tURIJJZSAAXZR9Oh9t+SDYsIt2yhCcB6/EzQJvLxTs En8OeZoU8OR6Q1OCjDmR40eSVpTfdJI25SSve48Bx5YJJ6qQziJoScDMWFRUuH0UHkLXxiXEyATa 6hhtHhrf7+KGgB1iqOqUTNC1lvD3xiLEFg27IKd5aOpYaxXBjax+n8+LGkk40n0kD9/zpYYKFFPT wkRt8qqUk8UqEu+4Ek62+PDAKCuOyk8EGIpc4XLitBVRBKP5d8RYUODTMAGERUn7iTyigoLAwxp0 E0PuFzz4Dh1Rh9bRJWVQVWmnJVN4CXNr6ak8WOgJTHCk+uTSMjQ0pmrIsOK0FSHkUBwfLcyXPYG5 4maCggkbDW1mnjCoo6+B6p8JMqU8gp9yuVBYWNiR4e0cWIAIkYVtwiKU1HjtZgCzx1qI8e10FJEG dkYAstz7OaUsAHp540xJJEU+ZQlTEqKfHqKOXDa6dVd4ibRS7mPcW72GvKBUpwGNXMyZ4UIuGri1 Wah66QEIC1PBqBHdT2PKJTE9dUCdUnhSMEGJRV03n/6bRiVJtsTXQhdQRfx44gkgVtZAHnUDEcXw qSdolwtpnZT59QjjapvoGA9lxyhxMRhVjGmJxoNq6amixiqoKKgL/NJuWVogDutb26adteNIUnUR FeU0eml9gsmK4bgvkzQSBh70MjXv7bG3LoJgTTZTNRv5pU/8o7X3ebfT/Ke3v2/LjePRVtI55/Wv /9c4GL45RrSYfRYVh7T04inak80ncAGAUnd8Dpc8yNcSomOkVD64MYmkTTYBi1aZcOo4qeimTZ8w ZQRtVVv+79onux44ASror0Ajpp6xWGK8dVAkkNaweCBICb1EhXYpsAb2J7+HGnG5UIMmvT0nCsmE 5fxxQq4hEtHTRwQ0jxMty0isWkkJudSNDfm2WFcccdlacdwp8ziJcLwzdKoSiLboPJQraDXUKNAC Rfjzsz4qq2eNJylrqCugwumhVIIKaPyZ8SnRkKNIPeALd9L35sgqOOyrbThjSbzVlalq4fLpK01E Lkx0D7PdO0WLsBYd27/DiO4tis082vTQcw0tVl163AMz1D1WG4lAsUNYh3vIt9yRi17dgSBxOlKW kwa1rKiMIplrLYY8MFakVJ8xUxPQ4iQV8yKN9uhUd1UeP0AX4oTAKSeffWgKn51Bd/m6KKOSpg/3 3/6MCm7zmAiJF+63JCjUnU8VOQFYca0JjroN8wZfSWfbhRSB2jeFWlZe9rtst4nVV9pJPEDjWqSD hT7OyKSVTlybFWqaZ41NTLH5fzDrfagPuAe2wBOngo4XKYMbKUnwmaKhnPLGMQYwRQYtvmp5BDTT ICG2xp+9Y9hcC3t+jhatuDhTnVWOizrPSSVUWJSmSikJWONRcXNyGBNu3u800NOB2nqrbSZJrjnL KPS7q7h0lNj+GwzCriEV6wKXp9gLFgw191FvfxZhxq6ZbdMR5+yl9u+UHCqt+t3oOx/BsHnzF00l fH8IrGqKulwq48xUiOwsgUD97TwvwgXu6QYTAAx2bNv4n9RRtb5mnUVKGMjq5/DDyrkzRgOacuTV WH4/hdThNSCUMWIRSQKHUAnaNoBsPAf28LbjL3dmmCmcQJw6Punyw6cBFGFpeNqOvEDgMDtxECDE 9Z6cOhIvOZYYGmZyELR1DgALdh2Hge2vf7uFi7JTagmZwkDh0T+uHrtpXbkmfDJnjJnqw9BHspwp If5mYqaEAQyBikkpiUKwJ2hnldVABsLsRz1xaftfCCVR0ARhx4bcdlOMux4QCrqEbQZwOPmZ6Omn 7AK7GcvYrNUJUNQVlC7x1KxybXW7lCde2t9SLfXyrDSVo1L8IiIjpkcDPAbI6SKdZvy2YR4eOMHo PDp8+qjN9NfUbNTCgpc5KtRTxhKWKv8AMO/YXYglba29vjxFc5Kp1UtpJPUCI859fKOsUMsq3pIV pMmesYThwMD29fGj65dzxl3GMPNVgWIJWwdp17lbqGNgew+HA/c2SgMPMddDq0u9kjGlCKx5QKvD XbzZb0xgp2IEgci6EL318OMhlU4bT1bave3SgRq2DGkpJjK1k9ZRvRXxBGkEVPJr+jvsIYXGt+N/ lyFEAGesc+ylDd6VAGcKR1ZT1KySR10S0z0tnjlAACKpuLrc9/DidNrqkxiMOGPl1dRrb12qJmRQ U1mGR1lb5taSbv8AMRTJM6gsoG4kXsDoLW4gcsFn+JRiNkTGO2cfMYARs2UutHHCBAkHqBw+JpwO CRSQtNDPKTL+gFRTuA413WubdttifZxRb2SiuQTpPCOj9f1B20w/dd2rEelOFFl6m+bpDVVkTBWN 4JGeVVuRYAHx01P1cSt5VjOGOJEfDj7cNtX7xKgYBPHhStXLkNPVsyslTCVtCTGVspa5BN7cWmwJ wgFP+KPx4DCIrSblATxBpvq6LCxucxo9RC4cagaltt/dbvb28ZRZFGOwD8PX5mrB5odHPCg1z51K wDLOGzwGsiNdDGz09OGB3Pu3FBZtNDf2cXpsVlWgAzHQI4e7EY/OizM8yatkFSsPjs99EEzh1Jxv NuIFayuPySNtWljclADtsxKlgwJAtpYHsNeCO2yDu0pVplfljxw2zPTtM+6Jcx3ieugpKvCMNkRt 48OigucwyzG52yTKW8xnv79wCSoH+E2Hjfi+2ttKhEYHgOmeuT7RO0TRRdKTtgnZsj29GP69dekj QQhzeSeUtHCbkX0Fr9zcX7j9ul/yatGrEwZxg/ODJ4dIwxmasrgaCk/HaPLy6jwFejVQaYxyoWv7 5BIdTew0Oo1OluVFr45IJnaSkCD7SMevzIwqyVnUQSfww6vhGw1jp6apqKuemXzJpGuUhG9idALW Xv37W421bOOARgeGAgjqxxOzDp6TVHgEAdPpt8+Ht9lWUemf0KZz6gedjOfzU4BlTEETzMHp/wBH PWxJJHUKH3MSiAxg+3Tgvsd19Z/aj06uuMPKg1f54AkJbGziYn2gfuNW9YVg2Qej+AYfgeXMOhpK ehWOCkloUUuyLeMqAdSxPdte3BLo0DSKD/eYY/Hn8an0QxHFUp/Iw6N2xOaOWsjIC7EWQgsx7k6G xPjbilNus+GkqyY+FCjTYcFngqYajfKEFLVI2rARW2WHiSDa/s+jjgb8XnW1OGINKGgRYWo0iiT5 qQMkhOrIpNgGFrgk/dxYG5OGNJyeNC7l8Nhb1eHzMKdK3yqUSp+6tybi+uh5dtM15YgRS3w3Aops RSCGsjlw+jCTTyShRK8yWk27j7T+XF+gCCeFMyY8qVWF1VTimNyYg6LPFh3+++hoXHuh1PcEaaX4 w0CV6q264YgChAXD8dxuqjaepUxvuiUTnaBuTadgHsA8eKO7cVJpIjGcOedtScDgxalVMKkWKKlp Q4i3MCWXU37ccbCgACcBSg8RFZ8Gpq+PEqqH+YI8VYzSRxp7yRupUKSo01Nzx5BETTLk6qfMMwqu hxCvmmxymmfe8lZSxqLtEqWGttD7fZyxTEYzPPrVFFZEis6Ybi6TSnCa/wCVphaVHjN49Du2keJ8 LcT6CTNX1g7aEDEsQmbCQsdJMrWAnkhO0uSupudANebgxWtSYgYUixjVVhtMsklOVhQhYvmrF95J Fu/w5TUDWwlOnHbT1l6hlq5BUQYektTLulmpTcBQTqSTofo4q0kVTWQaTuKYkcKxaqNVhKJUVG2a OQBrxqAVH2e1+NAxIIqyttK+jx+lqmjeekkkgWNv0SEFCbWOh8fYeUgjhTZXgcaaNuF2vsk/5S7b h9rdbZ3+1424xo66d0jpr//QNPHUNQz1nlR/PyiIxmMkKscI2uQWNu5HYcyPS5A6IqHirWcDU/B8 wYji1ZDPFQbaVlamWRU911I2lh9B8b83OpRxwragBspyo6Kngq1dozSmOOWOKeV9580G6hb9vE6e NuVSBHR86soTwrFW1+ILFXKH8uFmiqHmLDSFTtYXHb3R+fNIdKdtaWdQwpOVWdcIxieTDVnepwpl kpaqqqG2rEiC/jfS40HHJC1dVb0KSB004z4rlyZKfD2mXcZS+yJgfMsm1VItpfwHLIVjhjTJbUah VayVxmp6+sTft/Q0sI9xUJ0JAsCNLcohkCcacUsk7KbJ8uyYjh0dKJkakET1QdVUWdx7mp7AXvYc 84wFDbWg5EedBDLFR0taMrZ1rlEGHQ+dh2ISagy7SA6r/iBF9eF7bmkwT5Uq0FScNtMWPmuhabC8 PlMWF4ZIBQ47OpK1Dr7oYk9jtJ11JPFLjiivZCeeYrSANnGnSiwzCKUUiVsLyTU25pKh1ILNVqAT bwbadqjwHFzSEkbKaccg0E+KS1uE4kKeaKX5aJJhTTxAgWll2gAAC7BRtF+wHCwjRNKSoGDQb5iy NVVvl4tR0/m1dGBJLSg+5Mrbna5/xBbseIXrZX3edOBaIoL58v0eJ0kMldQx0j0jVFTRiRSrNFEg Hluq6XvtGva3Ea2AR10o1mZAoCsUwGuwfG6fE6Os3RK0lRFTlt29AoVFv4C0Y0+PEmiFETTqU6hK hsoUqHNEuER0dPVRIFliNOsO2+wxht5v4X2sQPEnjqFKk9FUSQPFUTq96f8ApT18yxHQ4zQJQ4jV Lsw7FaQtHLFIqqrOTGRchjbXw4xc2qXhjtHPPVS9i8DZEHbVNfW/8PLqX01ira/LMwzpl9NxVkFq qyqXIIN/eUeIA7+3gbfyJYUXEkjyxk+3Dhtk0eMZqCQF7fj0D3bfdRCq/CsYwR5Yauhmo5aVjC0F T5qbPL90gh1tck/loe54WP2eJSJkjH16Dx2YGcfdS7v21pjUOiekdHQMfUbKxIlUkLSMYY1VS8hv KpkuQoXam7vYamw9p5tiGtSVBUHZPy6MOrGn1OpXP8IHXM9ft4dA2TNY9sZmCwptnVUSAxu4u+0N uZdi6n2+HjwvSykOYKOmDjsGycJM4bMavarSTCTjG04Yz1YzHHb0GcaX2Tc95jyfUJV4VijUpnBZ 45mLw2JIKnbuJa4vcX0Pw5d3LmFJBJIn3gbYHX54YjaaN7TNi0sJQvwjD12/Pr86MpQepWvocRX5 h4mkopI1ixPCaipgZirXEsQkRWuNt+wsfZwvVkbajAJPp+B2Dp6tmNHyN49cpJAngSDtn4/vpd0f qSwDF66txHEK2qFdUO0r1TkNNN47y5LksWOtz34Xv2MzJOHUernhPCllrmzaFQCIHu6eqg9zN6gs Cj+Ymo5qiaCpUxENbcVYXLEk9vYf48LLrLFlJgnGOsdcDr6/lFCC23nso8RB4Tz7+qONM9D11wtn VanCWqbWeWQMy/u/vEC3he/f4HlWd3g4UuGVdYSfLDHj1BOONMr32tmSUIOzy8+n3Rx20s8C9R2X MWmo8GlwA4dESI1lSRWDWJAvu29yLa8OU5e0tKgFfbw/ds6QNu3oola3nQt0asJJnDnDrofKXGJD 50soip4V96OMhd7IQPEfR3Pt4H3ELOAkD3/jhs85ih1bOtqAx99N+Z84UeEl1cKoSH5nzpnYIbMF sTrYC9zp/Dj+kHacB7ceTSVS0KSRqG2OE7J9/n8aKZ1G6yvh0tZhGX5RK00rSS1bOT5pf/DqL2v2 v4W+HHrfK2iCFk6Yw2zOMjpI64MHGgfmmfJbISnFXpzzhtoplfiGI4liKzYmZ6mOZzU1KM7I8iFg +0SFXAJBtcggXvr4iBVu22YTtAxwOw9OJHuiThsoFZhfrdXK1apOzh7OB8oOwUyyxSLJPLTBokLN LAJn8wxqfeVGb3L6HU2HFUJJGBA28Yg4Y4nDyw6hTT77ajISAOuD8vZx89lRJqV3nSdowEdQAkhY 2NgtveYdifDjKUADRqM9AGMTPE7D5+6KohbYSCMZ8unZOG3hxw4U61lJLFNFJJErrOscjsN6eH2L W10Fh9/jxYu2jSdRHRgRtHmD0bDtwxptGiFDiDjiDs+HUNs9Ipb9O+mmcM+Y1T5ey1gU2LVFW11l pjIsaOwGrtbQEC1ye/N22XuXWnSkjhiCNkRj6zGGHlTF9dMtlK5APRgdmyAY5wq5n09+hrBengps z9QoosXzXB5bUVPIp+Wp7x+9tUkk2J7twfZdlTdujbKuOEfuw/fQVv8ANVLUoDAHyx9gx9nTR9Md zTTKFwjCNlLDFHHR1fyt418sLbaCLaXOvFrqwonDbRMlZIqIMs4XiEr1TUbph+HwwwiSpcWUlt1w x7eF799eeVbYauFNBcqiJpf5ao8IxmsnGDzCoqo6X/SqZRbyvLJJc97207/TxcGjtHVzzjVFQNtK /B8DhwXEWry4qJCDJiMjXYFCm26hT3HfTjvdaca8HAdtZIKcRVEdZEGmd2eR/LO0iKVAyWBNr20H 5682lJQDAxpkqB86EjA8Pq6mipq03FXVwxS2Z12wFWIBa4JuAfv046E+GSaoAThtpSpiQq8Tp8Lp ohDDTrJLU18i+9LKri5v7T4coPErTwFOLgJk7aETLmNKFxVXZIkw4rVFY096QWvbUffwwbJEauFJ nuqm+KqxybG0ENU8OGTsZHWS4ZWm1sq300sBxGiSszWkoECKXOIVKUBocWepENO8WyKmX35XcnYN xsQLcUSEjbV1KEVxhnmjCSCd6dgSPJZxYg2NyfbfjwBGINMwIml/RwYfhU9PXUjLi8zxefNBE4G3 cpFj8dOKFkV5xB21zwOlXFo560tNhu1n82gNiLM3uMPieJkJx4j0ryVQBQgUMD0UcME9eHpqaKQS xVNt24++tz+XL6NPGqKXTbiOHxVUSQNaeUqtRDYqyFiRroSfu550SIB215JwxpprKrHMKqKZkJaB YWeenb9GlmIXvbU834gca0oDhTfVY3VGvdzgvzcYQQypL79r63vY+znm8TW1EA407YpNB8pR4tSU ZgjCMs0SG6TSWtYg2ta1rc9pjZVCqARSb/n1Bbd/L0+x3s3292zba/bw4k7zDn205pPJr//RPZJV 4NFNh9K9AD83TyI8kq++zPZvsDWwGnMlNQmBj6VDZ20xnGKLC7QyymipqqORaOKMRII13bdRpbtp 7TzxKRTgmI2Gk7K+WKnawxBqaii3oXZ3eVTICHY2FgSDpblVJG2nAVTtpP49WYLU5eFFhbz1s1QD DVThmAWKMgge98QLniJ9CVpEV4vKiCaReBZQw/AsNnrqvfii1U885o/MAeQohLaE2Cg+PLhCWwJq 4KjSwwWpweqgwoU+ECliaX5qneb3naRPdZmYaG1zbi9lYOPQNtJlgpk9NZq3B8Rq2fMtHSz1WGBn +Q3x+6drG9wbe73Fzxgg6iqMa2FEgCk58xVCnxDEMbxcUMCypMtJSL77SLdUFjoFUjXlQBEk41ZR HpSXrcu4bmaklrp9tVVeWks+IRjchbaAu0sb7dTe3GF2oIww+db7zxA0gcWzBX4DSQ4JisHzVNua ajmsBH50Q8tXFxptLbvjxD3i0qpYkA4xjTnjldVYfl2A1VR5kqPTxQ4lQnzCtxfUAD3gPvJ1NuGL 69MUw0lR6qk4TLQ4+s09Vsiikh+YkuurRLIsm5iQQCdo3W8Ljx4rtm0KBnnn3027JjbhSUzDWS0c ZlCIaSqmamSFl2CVwhZpLntfaNw7AacSLGqrgkUG1Rks4zSTzTxNFEJTTu2ql1J3nbr2fcS31DiR VsNPVSlC1TjSQxnppheJYdSzmmNDBTz/AC3mbgG91kXaQb2uQgJ9lxxOtoEjCnW16TFBhmXp7i0l RTpQ4lGYKRS6TICWLRlgbi3YqjG5PiOFy2cKU98gnwzSRweHHsMkkrJJTsoZFgh+SJdGBZVbSxt7 8pv9HGdMCRXtaeBNPcXUWdKt1xIo0UpT5iGVd93kAAFj8ZAPq48HSAAa84NJmk7mr099EutWXsSg zjlakoJEhNXQYrh5MdVGJmPbbtO4aD6Tx65Ybda0qEz1VZl5Ta9QMR11V/1X/DhzpgkU+MZIxFMZ pW31JwayxywoJCBdo12+9bQADx4EnMg0kwBBHROPqejDqHRQgt81CoC5McSdn7h5z7xXrm3pHnzJ FXNTZrypVYXGh8uWesiZYCRdfddbKDuGnA4LNaXvFqGBxAOPRJG3DHEjr6aPmr1CkkJWonHYZw6h 0nbEz1bKD6rFTHDKlSSq7rGRECKGexAsugFje33cRPOJKQoJ2QcAQNuJ4/iKdS4rDbI6x5dMxhGB nowwpvE0jiFRIrlrDzLtsQMALalQdG7cu0tJnbBxxB/Ex1CRTJWkKkyIPVzh0ifhWCOurBM1NLUS SmUJDCJXu22MN7qnUgAMbDQD8+USyg6QJBAn7fXZMdJxJ4TBkUpW8lUGDA6wNu3E8eYHCK1RIrKN iMYQHtUGQBVNgB+iLANYW/v4zethRkSVYbBj7PeeHXFOur2gFQ8iOmfZ5+7E05Utf5MEEEki+dUA VEkl9wCktZWAcN7pAuNT+XFZd0oOgkJOH2kefTt6NvWZpKsuJAknTjGI93n0/GmyOsEUiW2yShrB oWYAbie4LKLXB78StOAqJ8WOwxger4efVWnXFEyCZnpGPu9ow95pXf1+zNsaBMSlWC3vRySzqwVb qBvdiba8SvtNFsnQSRwj2z8Sf30cWubPJIGsmf74YbeofMnrEim6qzZi+Je5Pic0yoNg86W52rpY EMtrEfqeLlFtQ+0kj+9kT0mYw6OI4cJQvZncY+M49Z9sYgHbwjqpPvL78El2kkYlSJVYlffKEHcS PEG48PZrxpxTCiYwB6B85B2RtnqmmWVKAUMSMP4gR049GzEGscpPyzbVRGLsagONWZhbTW/h4acu laiDq1EwOA2dMzGzo6qaUSo6cSQekYcMBAny6/ZOeOKpFNsQicqpcsWcDxv7+3v4X08Cb8qwhMiJ MiJg9fXw6jgOGOGnrpeKicPMe/ynE+lCFkTo91A6kV9JSZVyZW40td7sFXSwyCFGDGMnex2d0II3 d/DhlZ2r6klKUkHjIOPHq8xh86RuXrSAVFRnqI+QEeyrMOkn4alRDDHmHrhjMeGU9PJEkOWsPe87 u/8AjkXtovZRwW2G77MBT2II2cnHht6OFB+9z5wgBslJmdo/DHz9lWOZbyH0+6ZYdS0mRcvQYVQY IW+YrYlBeoCj3m3WuWudCTw7XpQYAhI2QKJC+ScSSek1Mjx/EM3VZrTEWpYDYQu215pIx2I+IOn0 8fSoKJ6qT98Zp8wXADiG966kCTvUS06wnu11sSSDooB05pliZw+daJATQpYfls4gs2BzoVw53Qzu WIEmyzbr+JvoBxc20Ix2U3q66U9HhFNl2qrJcBw8VVZVKKKpZWtu2KW0AOt9dOWggwNlNlaSOM0q 6PDKYxtVuppqlwkApFuwUSAEi57nw48GtJ1KrQx/fTpX4YaOamw1KYS4sXWfy4SQYIApUtIe1ve+ vnh41QBXlGMOPnT0ValMOX8EU1tfVBY6v5c3037tT8APr5R0j7QMKfRKduFCPlOjbCBQpJhafKk/ 6RUVjASSGxLMAw9p8eKmfBpmkLrk7dtLKqxjCoKWU01JH5rSOgBCm4194le/FReHlTSUSRXDC8Qk xKqjEOGJBTSTeR51WwBWyWLn2WI0HLBwTgKvIpd4ThFJJhlRS1klPEKVpPINTZ7sq3Dbt1gNdOba T4TFbUdSsaakw+ixCGemqadqkANM9bS+7ESg1UXGpI5pQ8PTVRA21lwjCJYkhmo0anSe8ETzEEbQ xFwB4DlzHAVVbhHrS2paWqgqkSapQyOUCJGALICWF7n+PGyk6oqoUJJpQ10izUbz1MLUcsoeF6gA FVjUan6eeVMGRW0ug8cKSOD4NhkE6Vb43JPU00ahJIyyA/vaqb6C3G4RA6q3CjsNN9RPjmJ5hp6G rLPTyrKGqohtUx/ukgfG3LkYiTWz4cImpU82IYIjRRuZYpxtapA0IGhsSNDyoVBia8Vya44SaeJT T1WIypSyF6tFrCAt+21b9/G/KpKScabWnDA4VI+byh5f2m2/L7vq83t3738eOSK9qr//0jvV0VeV qsXooxTCpUpGkCbSFDe8dzXOvs5koWuMxUN6vHsoIaijrIK2qgelXEKqeSOaKdvMmVIz7+26ggH4 e3iRaV/wilp0nFVKnCBTlWpMew7y4EIrNygKrbh7qkgak27cWgJI8XpTDidWzZXAy08Mify7DDS0 EySSVayBS2521AH0AcTBqQQdlNqWAmeNJXEq5RHVS0tFvplWSYST+7tjOrkE+AtzziZHTTyljCsF JIs2DvVUVQIoooEaiM/7lyLkEfD282hOkYbaoU49VKmbM+Ny0VDTPiEkeF7V8/b7iNuIGhtounHi mTjhVQokRSalfDq2apw0YbJVSjWZwLI8TJuOo79/DngiduNOBOOA5867rcNpK6SGlEJwOicLTTyI +xGWKPcoQeH2eNuDUcTGNVMjYMaQGK5bwqenq8I818Vw++xqurYnbfT3Sde58OJ3mwSZp5vGKBCv xTEunVPTUGKUk2M0U00lM8zKzIwaUKu6waxtYcLkrUlUU8UgTO2nqq81Y563BnWpwB4lixQK15IW lRVKgN3AvZV4sb1OAjgDWlK0iaUE8sYpcFoK5lxRKhKmWkMasTDGSSXcf6pOpPc8ULKp8qThUgHr r0khosHo9rtVLRpIlNLcbYkLFgWte9u5v48eOwdFWKNM01YnHhdSYY66NqIO8Wx6VWdQ5YgmXvrc 3+njZbE4iKuCYwpGPh8c1RjKRyEVECqgjjRmVomtCu49tALaeJPCx1sGTxp5lRB6KDqDImLYRiNd R1EPmYXWSNLHtGwoyxtI7HX952/LtxhdtpRjXgozSCzV04abza7DIjTTvJsgI7ohvMrSaahQyXPt NuI1s9Hr1UubMnbhTA1PmuggqCIgyUEkUcMig7pIULudOwH6LW/GwlWBqiyOAik5R55xxMRSd5vm 4bmnqafayjdvVHuO9rKx+HLpUqMRVS4R5UtsMq8Dzhh1PTZmwGkxWXfuhhKRzK7Er3uPBntY8ulG sQaeCxxHHn99BX1I9F/p/wCokWKzS5XXBsYrGjq4qjDpGhUEqC9gnY9uJLiwZW3pAgnA7aU2d2pp YKVGRz60UPM34W+DYgslTlDPMtHAiPP8pM3mKgCbkUk2Ou0a38eE1xumw8SMR+PSPOccMaNbbN1t E4BQ4z1+72zhQBYx+Fr1maOWtwbFcMxI6uIpnanZtm620KpsRssSbk/lxD/ZZxqdKzhO2fT5nZVx nTZJBQJ4wZ93u27KAbHfQT6h8KRK2PLEc/nNIqpRVRdpLuI9AQAfeIBPt+jiS73ZcglKsesezGSe fUKV50kiMSD6EcfLppO1foh9S0MkZlyHUyyKQ0wE6HbpuRzc2AO4GxF9NR25pvdS4U0FLwJ+G34+ UdJras9ZJ9Y9vwjz8o20xx+jrrtVVCouRpKYIZbtJLEAqqb6m5ubjt/dzzO7lyFElWGHE/GAdhPR 59N285aIkjA+7b0HhxjqpXJ6C/ULWGnCZchi+ZXcqT1IA2u224Ed+7XFz255rdq5J0T4QJ9T6e7Y eikhz9tQJ0nA4GZ593pjQhYT+G71sqpaaKrmoMLhpoxFK9TVTSbXC7rrZALW+7itO7DkkFePHhs2 cfbW3d4EpIISSfT37Z59RSyR+GZieN1s9HjvUGCimTYhkpYywVX7kuxuSQRoO/j8DBG6bWgAqOGP VPp7p/eXKz1yMEj1x8tvPRQ3ZZ/DD6eww4lV5pzhUu1Gr1YodyQ7li2qGIAJuddL+FuKm92bZKUl RUojDE7Bh5fOkN7nT5cwwJ6qFPLfo/8ATzk+evrEwr+dTYdtdZcUkaVTuUoPdkL+Kn8uGdvZsteJ KaZuL1xe1R8tlGywvF8o5LwW2TsLpKOFXWgK0scUbLaL7Q3AEn3h4e3l1OAIIGyixtKRsoPMazNP m2VRhcpqagqZamU7t6iM2Zit9ANwC2+nmwTpwGA556qd7wqVjtqbR4XiyYjgUWISOaZ1dVhj/eia xDm5GovoD7DzxYJV4qtINKfLOGxUGJmmCGGrnBnw+CVDcpG+u2/iNvjx22YAVpBim1LNDpSxU8fy M0hSJ4i5jjUXeQn3QNP6deLkIMmk0qAE1NSCtlWGpZBQpFPaaCoNlYMpHvEe0G5A5tTRJE1sHSDT /QiIS+ejyNLRjz4lj/ykzdidPsge37uKWkJAppaiTShpvmZK75GjpDiFTUJA5MjBRD75Z3NvAffc crqKiQmlGAOJrqtw/GYFrKWirYpsXxFZKerrVILte5AGpNtRxgrJTpSa8DJmhaynl2gyZTHEcRrl /mgp0qna24yMsRNiWPe/FLaQ0mTtqiyTtrPCKnMkVZLLjSVTV0Zq44KUbVRGNtot7O3HS2FJxPPu pOkk7IqF83V0kdFSGg8xHjANQJB7rxse9/HxPPBQBFbDYJw21CetzHHVRQQ0cb0tS5DqrncEIAvp Yk9zzaAoqKeFbketLGihxnC5K+m3R1MdU2yOEl2AAAPb2jnm0uEQDTSgIin6DHXicYfV1LFaZnpo tlra6m99PEceSCDE1dYgYUqKTB67MQkq6PF1oY4GWKGEmxYLe4+j+PHHGyobaTEnVNPfymHCWJZ5 WqsTlUUVfLTM3uLESTbXQn28oqNWGyvJ2GlDVwBIIsFkrGagmb5iJaq5dSSDtDey3hyujhVwoxUY YfhIrG8mleaSnjWG2+62tftfXtyukzPXXgnDjWXC3jmLSRUO6opUcM7SdmDXKjxtxSUyKqVpAik3 WxYu9Q9O8kcsVSomgpXJAA1NiT7OMpaAVjW0nGo9TlvEJ6GCXyfJK3WNGtc2Ottb25UIJOOFaCSP KoX8hbbs+TH+R/l9767t/mX57V1074enjz6V/9M702Nf6RikE0MlfDDN8vR1RHlwFTYXO3U63vzJ QHCKiBSROO2kJi+Z8xR4NFhGX4Iaeenlb5x6ZQ2iWHc63t35oqVqEbBWkkRSep8QxPMc6R4ir0FF h6wsEhHvF43ZLtfT3u/0crrMkkc9dXSJEClbSVNDU4XUH5N6hlklHn09txjuQtrfAc2vFNNd3jtp D4/gFNSss0hqaiKt8uZ6UswVEYW8sAA6X0PE7jUedKE4gcYqNgz0VKKijweneSWC1LVxzFn72Pu7 9Pd04oYWmAmqutiZpR4r5kkPlQGJ09wmlKMzkoQSL2tYePNL8RiqpEgACuGFVUlHVGWomakeREp5 zIgBeMtqqj2W8eKUoTsJpoJOycBXc9Nl+CUCaScQSmSqqDIC58sqylYyL3OttOJ3leGqhox92NJi qrsKnp1gpE2MQIlknjuRcD3j8b8bWkE9dK0EBMUHmIZdqMV8yl/mEdRAWFYRMbnaGFj7NTew78RL TJgn1p3XAmMaQ8WQBlI4hjuGxti9HPN89UYXuaT34m95UAve5X+PPIZ0DDZVSrprlTU2B4olbVUN ecLxt5XqMUw13ZiqyoVFwzd1Gqg6XPLIWgpg8OFbKDgQdtKOOpp8Poqahw6jSjoEpn2GtDPvSCUm 5/xe8DdvE2HFv5gAmNlNpVwJmucVbLX4Slb/ACxqNquT5dqeo2lwxUlGtb3rEbvpty7awrbtq2mD A2U+mDCqTBWc0UlBNNEs1Q5jVpNsY3qB4N7pJPxPKakAQRyaumdUUgsZoMQlwyKIQ+eJpopYJe8k UTKSQba3C2B+J9vGn0SBNXStI40ncawKGejgWkmepxgNHGGjuLtEgRkItZh5hUa+zhY+EHBMmnEg jbQIQZVzDhtVitOJ2tEyUtStbe2x5PJ0ve1xvsPp4w6jRs2VZJnyimity1JidNNT/LCnasE1PLWQ hUdd15fd/evdgL9xxNokbcauTGw0lsZyBNSYklRhyTw1Mu54lgJEUa7mUMfoEXgO/KaVDxR61rSM INNNDmLFkp46LypBCSaOmlS7O9hDdlHcm+h4y8SoiafS4BJB2U3RZ7rxgIkppZUZGehqQCA7LFCo uSf9bUD4ccDiSNtNEEqNQ6Pqti2BfPPVebPFiG5sLEzElgySqpIsbAm5IHLi4VpiZqh8Oym7GusF dg8Jknwhnp8NXzFRI9rKRVxOWsbE7g2nGnryEkxP6U4gxhw8jXM9c6uppPPaErUV0XnCErexmgG0 WHiL8dF4dOnZVAoLUONJui6ryJiEcE+FxT0tIzUUkToFllfzpveUDubm5/o55F1tkYmrACakf51J KuvgEIipZBLAuJSEKGEaBGCDvYC5uOVF5t4gU0qBt4+lc6Tq4uJR1sXzcisQ6GRF2sirGouDpcXG t+/Kd/rFXM4A1Gpcy1UGEu8NQ7SYmz1pqblQqAvCljprZN3NouPCOFNmOmmTCMSxjG5qupmkqJJ7 PRKsjkxtuJXcC3e4cW420STsmt3KQDNMddUZgLth0kjrWPE8pjVTtLBA6i5HcMjHlArxU2Nvy55F RMDwqspmw6qxqSavgnZ4sPpXDhDMF8tXNu5b3e/LI2wdtXU2kUNdHgi0lHTVVGGoa+uhiUJbcBG9 t+5Y9SLH8uLEojAUwDI5+VCzgmTcSWlp5aioEdVT2kgq5yw3yKw0APa1+1vHi1CNu2vBUjGhKo8q yPJQ1jUpNdhyrD5s1v0khVna3j/aOKm2BOymVOFO3jTlVZdNTLBVyTADDy4jjj90xkra+lvafo5v Qn7ga8iSDNPk2H1mN0dDAXWnpTtqd8anVlcAqxa1tBzS1SBJqiiT60+YZhr4jV1EeXIVelRTTVVf UXSNnveysb9j35coKhOwV5wARj7KyDHJMLkTKuBwpUYtVozvWLd5O233mGlr+HEBcUpelJpSjSBN CBk/ItLguGQYnjdcavM0gbz0TcQWb37W19v0cMGLdKcNppvUTJJp4rKB8QlmScAOoSOCOoJCvubb awtYce7oKTKttJtZxAp3oMKnypTPJOIRDEymUIN3lxLc+79Z46ohKRVUGeG2mapxXA8anp8NoJCj R7qqvmkj9624bRrbUn8uM+FSuqrmU8ZNR5ZqOeSOiw4yCWIhGlijAuxHZSfo15YqBOGymiRtmptA uYqeoaqqMQjg/Rv5TuADcmxuLGx7cfRqCTNWURwpUYbLR1kFIs1TA1ZLNsmkmtq7aAm/sseaKhAq qiYilUmI0uHUNJCYd9VT1AVZ4W9xiugQbe3tJ47qA4yKoUjbSmpsCo8QrazHIJDFJUkO1Ept9gbS QAeUUBMg41oGKV8Ekb0NVNVyK9Gm2loFTbvJVbm508TxvUCZrYxEGkxj3zFOkdVSVyQLZYpnRCNC QCb20+PPKUAJqqfEIqFDRPSo+JJXRTQttRmpn3FiTa/fxvryyDAMGRW1K2V1OklUadaWf+YPFvn+ ZKlAWX3VjI79/ZywMz0VRQg0p6CnqJaynqp4hPUw06pUU6ykJGTe47m1+aA8VbkEe+lL8xFv2+Qv +W8r93ts37e3flu8V0/Gq6uuv//UOZjtXBQ0FHAkywwV8avElOoHl7JAxUfEjueZMPL0mKhpCCVc 8+2kJRxy1WI4oKOgdpagiop4o298LIzKbXv3txltBOzbV1nSanVOQcQjkqJ3rpqRyu5qZWEa72Wx W5Gp1HHC3w41orGrDCkjjBr8tCgwwVMtRDFIDWGmKlCoXeFJB1PsHE+shXlToMineebGMbq3nmd4 KKTy/Jkp7Wby49EHx9tuOO6lKBVVEBQ2VzyrSUMtdU09bO9DWTBzGrIfOmOrHaewGmp5ZKcIG0Vt wzjOFO+Iz/LQwyTYS81PQmSFapZNsrmRSpbS2oBtrz0AHHnnqqifDsNMWG4BU4lSpUPJtp3hApZK s+8bNbaSex5bSQnGKsucI21zrTXJBSRxzxolErwz+WtnWIR213HvfsONL6ZwrydRmkpW4Zhhjgni r2p1mK0sitdwxZb3vpbmltpJ6qdSiU4HEU34LLTiDFII6ZHhpJNqDaSxePTaC3gF7cshSiIjZ760 AenGufzDIFhqQadUDy0tPFYAguQS3idW42gdONeI6DSKxHIuEYlNVYjQIaPEZCFjrWfaJ28TbXQG 4A4jdtEjFOBp5CjEbaSiYvW0aYbh+a4jidPGEjpKyD3LRQuh8tbC1u+vKpuYia2yyMfbShqJaUU1 LLRzQyy0LHEaaKaS7eZ5DFX1bUKWOh1P18UBaTJ2GrFCtvCmnDsWzPW+RJI/ny1d5BRS7Qsas4QJ 7w0so3se1tOXAX7eeeuthcg40r6maJqtqdJ5KcwNFR1UbI22+0MDdxYC5DHjxWCMRhTaYwik3Jhs 8TVMmE+7CFjSCpqvtuXYte2ndiXPwHGw0MOirayTNcMVooKqSmqpUNTR2FI0yABUZt0cbsTqTt3N r4kc0+0nXjVg70HE87aD2qylFikbYjhzBqTCQrVEMHd7TPO4t3IsFvpwtLUCeinFE4yZ55+FNGKU FStJT1ccDRz7UoYBLuCOgjAI2n90PNftxhQkAn314KA2RjUOmyJPSx02J7IquoppCY4WQ32eY8kl vDtHfniiSKsSEjGkFU9KsFjkmxmNPKrpoDUvhsRYRmR0QqbA6aEm/EyrdIUQMZreniDQaZkyYI6i aalkimpZbMUmV/ORSkqe6unc+PbjLqSkzNVxpO0uSBWRxV1S6OFEs1dh7odrXqYlspbxCjT7+eLR 1TzNWDvhqBV9KmpDBPWV8UQhY13vR6l3pm2gH4bgoFu/LOM6AOOFUCiYFc6XpdDFV/Lz0zS10pc0 2IhSEuZ2YkFhqT5hvywtARhxranSdtJB+kGI0My1NOXTCmkRlFQgMkkphjdgDa53bTxjuFJqzjgJ 6qVNL0tw/FZ6qjmpBQ0sqrSRTq5hLsS0ZJA19429nFH5ZRONUUo9P4fhStremdbWGgp6aL/fbROY pRCo1iRQzKLHT97Xij8oaT6+g1NwPpjUoJBDviWNVijNXcBbxmMsvYE22nx44LUJA6eqrrwx40tK Xp3RQ/oZp/mayS7hYF3mIFTuF2Frhjb6DzabcasDVlKPEVym6e0yxHC6mpaRHkjmoJY13yxt7sbC xBA08fAjnkW/8NMFO3HChUy902oMDo3qXPnvSyGVaivG5iNwYAEntpce3i5LATE8KslZ8zThjEK4 gwioa0Rw0x2RyyIQGa5ZgAQBppbja0pnA1UnEGalUsMGH08lJTVr1GIGSLzTISZAZQfe97tYe3w4 +SRgDWgFCvJiVLh9StLNEKtpkklqYE94kCysSddQWHEa3scMauEgI21JosRpKZqabNNR5VHP5c2H 4GjeWu+Ikbnc2JvYafDmnHkgyrHnnbXmkkgmaY6zHcYzJis9PhBGF5bLyCKSnBRCdtmA2Wub3GnN a1ORwFUVAMDhQk5UwzDKPa0SNeNVRlYN50j3DE7hr31+jihtuDAGyruJEAzQlYGkU4n/AJhjseGy LuWCGRdzWK6dz93H21QdtMxBrJT4BTzsQ+bFZYCquJrix37t1wNfo5YiBtpopJ6KXmKUVHWUMFSM VEymM0zwxxhmc/ZOn18VOJGnA1rSoCZpE5fiwuSXHk+XZamjKwMZwijy1XRrDvqbW40iJqy0k7aj SU1LQy0dLJXKIpQ0zzAaDaQ3h2vy4aAVFJzJw40oqOuwquxfDIEw1q8VcRR4X92Nu1jqfhfm9SSu rlMg1wp8SwOqxWrFBltcONJpViS7MfBZCT8Te3N/d515XCTNS6RomxSPC5K9YaWnBxOSoqI7KWe5 H09ueMnAmm4kzS3w+hxSkqTLSVMdfGY91MYn1eIkM1ge2p5sKAq2iRspwSpo6mjqKN4PIn3u6U7t Z18xSrP9PgONQCNkV4jopGQxSUQWijq5JqSdfLSGpIeQk+GvhccvAAFVRqjGlFSoaWiElTTeZQRD zJ7391FFtq2trfjhjbw6qoR4jwNSzjeBvJV0eBxSFpwJjJGjHYyi9r278aS5KpApwpAO2slJJIcK lxM71jcNT1jMNpGve3jYdr8ssweiaanhM1g/nOBbfM21H+Q+c+Nt3lbv+JfD2cakdHPsr2k9Nf/V OHmGty2tZgNJWYK9fLGI6amnbcsazM24kqvcf08yUUiFioeCxx2dFKan3DMCwUdN5ElPAZbw+XHu WMbRuZuwu3Yc8ggKwNVIBGFMmKVWG1lTsxSp+bEyt5y0kxbZG3vEbk8fd5c+L21WFJETSWpsWy8l OKA0wmjqQ5qPmlClNoNtT3va3NPDwjoq4JMwaYRmenaipoqUC9BLKy0kKnaoYkC9gNeUWoK2Y4U8 Ebcax0eK0NLh8WL19FMcfpzM7mbesSINzBFVfap15UOBCtmJqimyfKnjLmJy4pTxV8safLtUyRVc VQWvBGRe6gk3IAItzeG04CqFJ4UnKzHMamqKynwTDzXUuGlahILqQQ6+Y2o8fe40Fk7BNUkz4jAp Q02CYhi0dZUYvDHQvjNK0WHwFwHgZQbM9tCbeA4pcQdMdNaCgSKTi5foqGvpMPllNQ3lzPKZWujM jD3rfAaAcbTOqDSgTFP0OD01NTsImgBrpxWUzMAGVUUbgQL2JBvbjhTHGtIWZ2Uh8cgShxL596xM UpRHspJlBB1IYrYHsD4Hw4xCk4zVxjgRWOPHooDIZKdncqVgeQBQqygk9x8eeP2RxrZMGdlB1jdd PiDTiPCoRh8MaJTwva4Et1IW1uw8eFq2yZk0oCoov1XlzEaish/kNLJHU0Evy9ZTzzMySBmLAfDa bdvDiHQZw2CnwoyZ40oMDzPWUs8GDZuonpYFeNTVliPMlX39kbKRb4a2PFjVzpSZqjYxOGNK6rxW TF6+Cqy65qKiuCebR1bsbRQBmBN73DM4DHubceF0FEaRVCDGJkUtsNzCTW+XmCienRoCkFBMqgWY +WHummo0F+w4r/MEnrpvSAoGnuehNPTT1Mc8WMnEZEJgoFJ8tt3klraCyqbL7bX48loyUgzNNqwM 7KyUWG1WHNXrRURhqRMm6IrZliBIbXTQIoFuNqsyEyasVTsptxKmFVFI9Vg71UkS08ixxbb/AOks 1QdpawFl1Px4y8iBsk05gBWKjGIQQ0NG9OsFGIWjpKOWLVN1OQHYrfUhzyjZSrAnbTpKpmpUWWcP q6/+W1CLB50gppMQkVdkURdYybgDts5ptkExFVUcSejnnZQWY504gnrhiNLVRulBHJSTSx2ClTDJ oQfHdoDxIu3VqmtIVPnUCoy7TIuI+XRw4jKsC1VX5IKbJNsN1C21Krofjz35cQTWkKVx2mmyhysM aq4Keow1VhZmElm96KLWNbkjS27ir8sSRNVkbeFKLGsiYVJRyCkm31WHoyzLE6gIJVS1+5H+T8Pb zTltBkcK2kya44Rl6gmpGpKmljX5eVZ6VNSXVA12BbtdTxxDGONVKjw20oqjI1DX+U1LhyTSwMki NIgFgsZS12P+K2vNqtuM1VKjHXU6ny5gVXUTQz0v8tWlZVAiZQSpAuCF111B+ninuQqDs6qbUqBA qJmDLrU9PJLSUsYFB+lp1la7t4EH4205VxBjHj5VoEiDTNHluqp6ugqaalY7w6Yg8JG33gsjnv3P h8eUbYjZTi1zTjgmVEC4lHXxuZE/SUNdIVtue/vAaG+lx9HHA0NFU1EY0namkiMj0cuMGYEimS58 pGeUbr7jrpbdp7OIysERNXBO2o1ZimC0nmUtDUQRCnco638xgsVQEKqRqNfe+iw4ybhOHE1pbRJk 0GmMZvr8SgxV8Hp0wvaVp62srFKBbkxKysdSbgNbwHEi7kqM8KsQkHCkPhGaa18ajTCKRqqQ3mar ZSyanUkm4uSew8eJhqIMU4o+HzoQKPLlfmKvw7Hcep2qKuhPu0QkCL5nbufgdbcUMMKGJNM6pTjs obYZqhnpCKSCD5bZI1FRBQqxjSzAEmxPcnhmXFSBWtBAwoRIMQxpZVpVwqGjgSLyjUKBu3Sm/b4D j6pBxERVQQqOms+F5crMWxPEIIZUiq/KV4a2pGikMAAo7a8baaUoHGDWlqIwjZUnC8Fr8GwjFJMy YomPVheSmeZUEI8t3J90DwWwHHgyQnEyaqqSeulDhM2DVCxRTDbVQsUWGPRbKBYgaXtbvxQkkjHb Tal4badcUyWMQp6vF6SpkSJIVRmmlvG92Di6i2gI1vxpy3wmZmqd5MdNJWqpKEvFgq4jTSLVJ50g FmlTboT27H2csV6yIOFeS2amUOKQYdX08NDTq81MAFqqpDtQowUC47k97cq1E1p5RAp/rqKvxTFI npolIqGIkMI8lSwXsb2v7eKIVMUyIFKM9McMjmwkVWZLYkzL51EtmG03YqSNbW8OMOMyvbT4I00v KLDKehozPh9KKqelkNFG1Pqyjd3+nseXCSDhTSdlcIMIo5qqkxatgkeWkEkL00oVVLKCbm2ul782 gzsrYVgcKTmLYXh8WJnFa2maKlYbRHEAHYEDX6TyxaFNB2p9bBFJgmIR4HEhjMTOfm227JNtwfjf niglBB41efFApFZVrhDLXfzBoIq2NkKCnN1bctrG30X+jmkOE1t4k7eNKulxmCtElNUx7fnDIs8T qfKCp9mx7agd+agnyptEgnCadP5Xlvt5Ue3y/M/yx+za+36b+PNeHoFbw5/dX//WORWeb/OcI83z d+87P5l5O/wt5fke7f8Aw38e/MlVffUQI+4c8ikvr/WV/M+c8zyKn/e3b523W9/K9y3t8b2txKiM dnvqx+07eNRMmbflKryfI2+7t+W3Xtt/3Pz9fpvxWiP3TTSNtd5n2XW/yn2E/wB5t+7uPtW8f8Xx 5dXzp1H20mMOv8pVbflt95f947fMW3C993u/T+XE2On91Ww1D9aWFRu/kQve1p/8ps32se9tb/4v Hvx577hTeM0yYbb+TVO3bss/+8e7yreQ3+L3r/4vH8uMufaeeRVhOvmandMNvztds8q/y8W227b9 n/c/M07e3+PHLb7R8vLjTQ2Ut8U37k77vf2+f5f+E/Ztpu9t/DnnZpobfWkhXX/neCbfMvslt8tt 82+4X2btL+3wt28OXRGulSfsFMEtvJrtu3/Ly38nd38ofa3+Ptt8OPK9PSqN/dhScxD/AJJ0e/y7 /Lvt8zv/AJRL+Vs/e/xX8LW8eIXJj06qfOz1pB4nv2nd8x/vImz53Z5dt8d/K2/nfXtbjSONee4f OueIbv5dRbb/AGof8nt/1e278uUOwefPrTmHVUbLHl/znEfN+XtaO3znm3v73byvz+PK2/2K2cKs r7xz7KTWfPk/kB/yQb/NQ/72/P8Am30ts8L/AOHw4kwjh76ed9aBzA939bqryfnreXFb+U7PI7r9 jz9fovxGiJPyrePX6xQzw+d5+M+d8xs+Vjv/AFj8j5e24dvI97b7ba9uLLT7+M8+lMvbKzZA3/zr EvI+f2fO0tvkfL+X3eRp5HzHvW/wX0ve/FrP388z7q1jA27KFDKHzH8yr938y3+Xp/WH5Xd9l+23 3b/4+L7fYdvrWlfcKVmM7fnKLdbzdmvzG7zL+Xpv2+5a3+Ttpa99bcrhHDj515P3c8xSJ1+drrfM 38kf7x2ta4va+n7bWtwtVtFPL2CnKp/3gp99r7Df5627/Lj7WzS30cMF7OHPzpG9SZqdn8qf/eLZ +g/y3mbP8lNbb+9b+2/GOI+XlWk/dUak8r5euv8AIWtLv2efv/3D/Kbddvt2/Dmhsxjbx/SttzOE +n61Ofd/WCmvu/d/yWzb/lR9u3h7Pq5ZOyr0mP0X9Zca/wB5N14PmPm/Ovfe1vmvD/iPl6W783xO znn2VZOzjt9K6j/5K7/Y/wB51tsva1j2/wBX283/AAmqPRApZ0V/e27t2v2bW7te+7S3s4o/g9eF Va28zTJUb/mqndb/AFfO2bvhbb/ybfx78ZXMV47fWseL286i3W3+VVW+Z3X+147fd3ey/jy69qfL jzsptPGsCef8i/l/MbfMS3yXy2z/ACn/AB7rbjS/t408uJpJ4189uoLfz7ZeG/8ALP5f5NvMk9vv bfb424gVsx59lXXx2UBubvM/mdJ81/Mvt02z5vytv+8NTby/k/37Xtf93d424Vuxq4es9VWPDbUz oj8t/Ocw+T8hv3S2/mfzfnfaP2PP923+L/W+HFtjswj0/WmnokeXP6VJ6h+X/MsP+a+T2+ZL/wAl bzfld3lm/mfJ6+b+Vu2vKYd4nZsry5g+dL3DPlv5dhWz+r/+88tv5B83buL7PM8fbf6uKzx2V4R+ +lHLtu/+8u7fLfyt26209vD6OVXxppHyr2C7fl5Lbdvy3v7N3ndl/wArfW30fDlk7KcXPDn28KET Dd/lj/ejZ5sdvm9mzv4397d7L8eb28+6mnNlK7Le/wA6r2/MW2m1/L32ue27w4YW2w1WkZjXm+TV 2/mG3yDff5Py3+V8b67vo4iXMcaUo2+opc5c8v5V7fy/zPlhu8nzPnfD/F7v3eF+K0THCkLkauZ4 0tK3d/VKS3nbtjf8k/bbsftX0txx/wCzDo4/rTKpk889dFiqvl/5973kX8kX8r5rzb6f4PHhOfvP PtpXjHHnn4UocG2fKL5G+3mPb+X+Z5l7+HzP735cWM7Bt40me2fj60NOHbf5jSed5l9bfPb732j/ AJR/3vbxajb+Nax0+td5l/3soreZfzZLfIf5a23wvpfjL+z19eflTjfChg6cbf5RN5fbzH2/K7t3 c9vN13+2/Lt8a0x91ccT3fKVFvmP8pLbytu7x738fbflTVFbDz7aReZ/+Sdh+/z+3u/Pf8R/1PH2 X48PtprjzNJ7ENnkLsv9hfseZ5f2f3vM8eM8U+tXTsqPhO3zxb5T7Z8z5ffu+z/ut/D2bfDjwjvO HpTSftpW47u/l9D/AJPbYW+T27b28PG/06c8jbW1RApNeHh+29/4/lxNjP7q3zzzE1//2V== ------=_NextPart_01C8E823.DA10E9A0 Content-Location: file:///C:/8E69C634/Classof2004_files/slide0114_image018.jpg Content-Transfer-Encoding: base64 Content-Type: image/jpeg /9j/4AAQSkZJRgABAQEANQA1AAD/2wBDAAoHBwgHBgoICAgLCgoLDhgQDg0NDh0VFhEYIx8lJCIf IiEmKzcvJik0KSEiMEExNDk7Pj4+JS5ESUM8SDc9Pjv/2wBDAQoLCw4NDhwQEBw7KCIoOzs7Ozs7 Ozs7Ozs7Ozs7Ozs7Ozs7Ozs7Ozs7Ozs7Ozs7Ozs7Ozs7Ozs7Ozs7Ozs7Ozv/wAARCADsAKMDASIA AhEBAxEB/8QAHwAAAQUBAQEBAQEAAAAAAAAAAAECAwQFBgcICQoL/8QAtRAAAgEDAwIEAwUFBAQA AAF9AQIDAAQRBRIhMUEGE1FhByJxFDKBkaEII0KxwRVS0fAkM2JyggkKFhcYGRolJicoKSo0NTY3 ODk6Q0RFRkdISUpTVFVWV1hZWmNkZWZnaGlqc3R1dnd4eXqDhIWGh4iJipKTlJWWl5iZmqKjpKWm p6ipqrKztLW2t7i5usLDxMXGx8jJytLT1NXW19jZ2uHi4+Tl5ufo6erx8vP09fb3+Pn6/8QAHwEA AwEBAQEBAQEBAQAAAAAAAAECAwQFBgcICQoL/8QAtREAAgECBAQDBAcFBAQAAQJ3AAECAxEEBSEx BhJBUQdhcRMiMoEIFEKRobHBCSMzUvAVYnLRChYkNOEl8RcYGRomJygpKjU2Nzg5OkNERUZHSElK U1RVVldYWVpjZGVmZ2hpanN0dXZ3eHl6goOEhYaHiImKkpOUlZaXmJmaoqOkpaanqKmqsrO0tba3 uLm6wsPExcbHyMnK0tPU1dbX2Nna4uPk5ebn6Onq8vP09fb3+Pn6/9oADAMBAAIRAxEAPwDjIAog j+QcoOce1Vb1VlZYEADluSB1zWgozYIScAIuPyqDQ2sn1V7m/mKww8qijLSH0FeZRi23JGreg5vJ hiETQ4K4BBGKkPlSbIVjUOeeB92tvxFbyX2lxarGLe3hB2Jbod0gX1c+tc5ZyKsu9jjjNZ1aXJfq aQfMi0kQCMJETOeoHUUu8B0TYMH0WooZmnkkGeOq1dhjwMkVhJuG4NaiM4ihK52qeoxwarSGNV3l QwPVgOtTXalgFHGeafaRrMv2cxjd1HvQk2ldlW0MstEZgYRg9TxXRu0SwROI13SDnKjio4PDbEl0 ITd0B7VrW/hx2VPMuWLKu3AXOK7adObWiJc4o5+S3XLDYufpUcsSCPIRTI3t0rrG8Lkgbbk5Hdkq rceEbovmO4hPs2Rk1k8NVS2D2kDj4UMV1hgOfbrU0u2GFm8sEjtir+paNqFk4D27NjkOgyKqx28k 0hMg2xqOQRyazmpJ3krFKz2JrLTptQfy4IGk4LbETJx3OKmtEtg+37OmxAW+71wK6j4d3VnBc3iX E2y78vZGM4yDXOSGK3mvU3k9VViMbhurSzjCMr3vf8BJ3bVjOnt7WRWIIjb/AGhxVBpDGEt4trzb s78ZwKju7gszSNkIOgq3pGm3E0LzJDJIzDLFVJ2in8MeZg3d2RrB4L+1UPbqJ0GC4AwariCO3ZQ0 a4brx0NQWd0YZyrdOn1q6S2oSxW8ChpZWCRjPUk4FROXNGz3KjZHKasmNTmGAOR0+goq3r2nXdvr dzBLEVkjYKwPYgCiu2nF8iMJNXYt3eSixQH5flCqoqzpdn9kSN5sAyDg/wB2qYeXVruPIyEXJwOM AVq+f8gUqMKc881z4h2XIhwte7JTdEWMlsiAhpM59sVmQRE8ngHNXhJGItgjBYnGSegqLaFwMcDp WTnokim7aoXTrVmu/ncxLGCQcZDe1bcFqs0qosgUOwUA1U02/wDsb7ZV320pAlXvj29DXWJY6ZPf W99piSxxr8xjfnDen0renCNVJkuTTOSurdprt4bd2cK5UFR1FT2VlPYuDKPMdjgewrsUso2disaq GJJ2jrUMtqkMhYDL9++K6I0FF3YKTloV7SSYAfuwDj+KtOCXbgSxbB/eXkVVgJD4PIP6VoOWjVGA DL3DV0RM5xsyyqq67lkUgdxTTbBjuAyfY5qBJE3b4wUPcA9anS6T+IEH16VWhFivPFtPysyeoZaw 77SknZmTarHuOhrqGkikXl6zbqwL5aN8/oamcIzVmgUnF6HGajpF5p01rqHymOQtHujbLKeoyO1R rbNdzheS0hx6810ckbpmO4UtGe5GRUtveW2jaRqDWFt5l/PHsiduRGD1NcFXB3kuV2Rqqvc8/wD7 JuNR1kWFpE0/70R5UfLuJxya6G3vNa0Cx1PSUt5UQny7jYuQnbr2rqvBEdzYWaNpMZmkxm+WUgBz /sE/xfpVrVPGegNZ6jZxWLpNcRsrl0AYyEY571UoRUVd2C7b2PMrGJ7m8iiNpJK7OAIlXluelesv 4D0q4ht7yxsp9LvYmEiD7wDDkAjPrXLeArrTbXxD5moyiKRUxAzfd3njn8K9TvdQWxg+0yxs9uBl pIxu2j1I9PejDRi4uTCo2nZHi3xDL/8ACcahlMHEWR7+UlFVfHesWF74xvri3nDxP5e1sHnEaj+l Fdt0Z2MTw1EvlSTMyA8AbjjAqxdSwJMEjbeT1I6E1QtISlnHtX5mUct2q5axkEvJJkjqK8yrJNtn RFaWGmSNeC20+9PJLc1s6DqEem3E8t1a200E8RdRKAxDJnA/Ems2yhN/cKgwpdiTgdPpUSp2imt2 Le5o6JpQvZPMmJEKHkD+I+ldbEwZfLjAWNRzj09KoIkVnbLEhwFGOO9SJcsI8KAM+nau6lFU42Ek 5M0jchPlHX09BTQN4569az0clgRyT1q4sm33zWl7nQoW2FaLcDjgjmrUVziII/XHPvVQvionlz97 jHenexM4XLEskYY4IB/KoDdRjq+PoageUMetV5YlALKCKLkezNOK8Q4AIH4VaEyyAjGD7HBrnBKB /Fg1YivzGw8w9OhqlIylTL10XUE5DL0II5rOyY3EgOUP3TjlfatMzQXsPluQNwwCDyKxpd1lKY5G LKe+KbZmkX7eCCWVJTJJErMMlXKgGoPiFHDfa1GsaRK0MKhpIWyGzyKntglzbvC7fI4+lc1PDLYT yw53Dd19K4cXzRh7prS1epRhUpLJHknBGCx5r1L4b61Jd2c2l3Db/IG5N3PynqK8ykiPnCfrxyPW uu+GM1u+v3Rkk2skOU+bA685rlwkm6qa+ZpVS5TnfH1hZ23jXUIoLaOOMGMhVHAzGpP6mik8e39t c+NNQlimR0JQBlbIOI1H9KK9iy6HNcwYivlRrn+EcfhUkKJc30FqsgVpHCEk8DJxzTGkRrOJTGGO 0fNjBHFW9FsrGe5YXzFMIShDYIbqK8unFOV2dDVtifX9Dn0C/SzuQvmbiCVOdw7GtTw7ZHJkf5QR kcdBVHxFqx1vUUvnG3YkaAE5OB3PvW3ZvIbNQWwBGoyPStqai6vu7ITb5dR7ESykqTtFPI9KbGm1 BgYFPYYANdEjemrRHoccelTxkg8nNVwSenANSKffihGqLBHGahIOSafuDc5pjEc81RJG8gBGV6VG 0u44APT8KhnY71O7HalIboDSuIGhWT+Go3s8DhiPoasxj5fmPNK3AxnNPQTTM3ZPbvlWLL7Vfci5 t/3igsOhpn8XtUvylT7iqSMJpDLE+XhNuNvYntWhqGkaZcaNe3sk5ivIY98Yz8rgdsetY9swj1Eo eA4/P/69T6rOV0svn5k+U5HUVNRJ03dXMVdTMBTuTjuOKzbKSSO6kiRyrOChwfWpLe52SfNwh6D0 pwtLm4uZLu1hMiW+Gl2jO0ev0rx6MXGbR1y2ucxqO77fJkc8fyFFaOvLGmszhQMHaw/FQf60V60E +VHM2rljaViiTGcoDkfSo/MYlucEdDVmz8uGSGe5dXjXBMeeo9Kbe+XNcvJbWzrvO4KOig9q5eSy 1LUugqJm3ROrSMMZ7nNdoUMcaoB2A+gFcXYwldShaVzgMMKa7KaUNFtHV/0ragkk2TO9xI7gvIFH IHcVaxleazrRwSTzxwKtTXiwIDtLEjPFanStESkMBxTJJtvBrLuPElumQVwV680xNdtpsbsD3qbo fMawu0Xg9aabxH4HFY8t9AHyJAxPoarG+wCFPzMcCmO5uyyxsq56kj+dSNLGB1/WueubhwURWJII yalmvdp69qANprlVGAxqEzn7wfNZP2h3x8361PCC2N0ij60yWzTSQsanA+WqkBQHAdSR2zV1sGLK 1SMmUWyt4kgHAPUdquahFnT7lGG4MuQKolwt0Dk4Dcj0966DS7Y6lqsdoJPK8xCA4GcAf/qqrc0W jnk7SucNpP2Z9Sgt7iNmhlkCOFPOCe1et6N4IsdE1VruxuJgmzY8U2GWRTUMXw00MSRzSmVZkOSY nwGOc59q1tb1608PQLLclmDDCKOrVjRoKmnKRVSo5NJHj/jzTLG18ZX8MFssca+XhR0GY1P9aKo+ MfEVvqfim8vI4mVZNmATzwij+lFbKUHqiLMgsZtMt9BcmBpr9yFV3PyxrjqPeo7VssxLHLe9Vok/ 0aNR/dH8qsQoQUA7GvLqPmNoX5jY03SR9qSa8lzF12L94HtVyScKW/vEHj8qxbVZDqM0hkYlW6Z4 q4265k8wHsRXZTtGNjapT10NCwf92T1ye9Z2s3Ez3GxGICjAA6VqWcHlRqocZUc5rNv4pxeM6KpB OaplWdjGayVlZ7iQIPUmqcsNsg/dXTZPb1rUfQbq9ZppbpUP8KDnFUJfDNwWyZyfwpqJDTXQzy0m TtlyBzgcYqzbTy53csw6ClfQpYh/rcn3FXdK0qZJjvbg4x6GiSHG5etFk8kvOoJb17Csa6v2jeSJ jkdjmu1/s6E2+SuSRXF67pxjutsYJzS9SpaLQr/2zIAoUsMelSR6w4H3XYk9M8VRXTbk/wANNaxv I/4DitOVHPd9TTbV7ppA8aeVjqPWum0XVvtEex2JYjoa4yI3MXMsTmPvkVt6PJtvInVfkLY/A1Oz H0OjDD7USe44HpXR+EpkTXoHllCqqEZPrXNXMbIwcdehFQ217Kmp2QYlY5JhvPfbnkVopWM5Q5nY 91BBGQcg+lYPibT7bULVhdoGSKJnAJ6461nTeL9C02KQWlyysFO2Jslc/wBK5VvEOr3GmXV3eTFo J0aJB0xng4onWglbcyUZXPPNftrWLWrhIhLs+UruPOCoNFQ6zepPq08gOQdoH4KB/Sisoy91aGr3 NC1VTa72BIWMD6nFTQfdDeld34ut7aDw7pNpb2iRIbZZGkVcEsQOprz+OcRqUbtxmvOqRtJxXQ2g 9LmnagJeTsfusucmptPuFku5IlT5UQsSKZCqtZecDgMMfWrOkrHFFMAuGkGCfau1dzqequSq4b7z YX0HepkgjkkBx07tVSADZnvnrViPcxwOBVJDRJNablJQqW9ay57C83Y85gvotbaJgZJOcetDFdvX mqsDRz8emlW3Ss3vk5rRjhVB8oAxU7NGDliABSo0UhyrAgUE2syVCxjANYmoQ75s9TW9kKpAFZ9w qA73HI61QS2Oflhmi+aMbh3FImoAnEqBe2Sua2rd7eYkowPtVkWsDEN5SnPtS9CeW5mQ7LhSqshU 9tuKfBpSwvu6LnII7Vpny4eAmPpUIuASQCAT0o3E4JIku8LYSs8gIQBgehGKx0kMwjlBDMj5/Sr9 7/pNlLGDtLIQRWVpoMcLM3CoOe9KTFFJXGzXFvKMkMrD8Qa0heXutWEVjFC5hsY2K+VGTn61V+zr NwjDa3f0rp9AOqW2jNpulpsnupcSztwFXp1riormbRjUfunmerWd1BqUsc0Do42kqR6qDRWv4n02 9tfENzDcXayyLsy4bOcopH6Giu+MbJKxgdTH4iu9T8FrpdwpkxIpac9QMDCj06Vyc0RiuTGQSCcj 6VseH9TeGD+zVgEyXwSMoeobjBB9a2/HuirpGqW8cEWyBoF2E88jqM9686Tm7zb0OiNl7pgWdyVj 8rAJU5CnuK00eMyb412nbyMVzm51mDjjBwK6RJUaBdo+ZlyT6V00neNmbp9COIgJ7VYRwFLZ+lVN 21QOtI0pAIz0rRMq5akugiZPNZt3q+wkA1Svb7ZkFqzFmWeUBjnnpTbG5WLq3U2oXSQ7iqM3Le1d HGttZx4Tp35rDjixGDEQrDpWfcTakrFncBR2609iL9TqZNXiB27hiqv9qQyna2ME8VyM187ckkNj kVAs10WGzOT0pq5Epm9fsLDUVe2f5JhuK9ga1rPUtwGcfhXNeTLLCDKcuv6VJBM8fGf1pdRxkdTL MrDdnj0qtIo27k6is2O7boG4q4j7k3ZxmqQ5SLMZMlv1wTxmqZjS0ikg3E5wGq3ZtuQrnv1qG+jU XBz0+9WVZ8sGyLkujarHo179pktYblNhQxydCDTrzWFngVolaGTeeVc42nt71Ss7a3mvY1uFZoi3 zgN2qzbTpo/iUXH2fzYIpSFSZdysmf8ADvXHTk+XfQy3dzlNWlZ9TlYyFs7eSf8AZFFbHiiXQz4j u20+Ii2YqygjoSoJH5k0V6EY2ilcybNHQINKVkk1e5ngRUBjltz8yMOQcd6l17xvfa1ZR6dcNHcJ DLuS42YkI6c/hWJYMgaA3CmWJSpaPONw9Kua1LaXuqtdWditnBxsiXoABXKpxS5UWtXcYP3wGBgZ 4rTtkMW9c9RxVGyMPkAo5YqgZ9w6HvTrOWSS5mdjgleB6UR0lY6Ilxm/Sq9zIY4DjvTi3y596S6G YgR6VsWzmLiSSa52E4yav2dlHGwJfLelNubPPzLw3c1Attf7wYjuI9RTRm1qdEgQITkCqlyy7T3z WcupTxSCGa3Kv068Gni6uJnEccHztnj6VVy1JWsVlti77mAxmrcFvGWzgCq0tzPCdjwsDjnIpiar GOqkH1zSQm13NWSEBcAYyOtY1xut5Tu5Umpm1YHHzVWluhdDYBkk02TfXQtwzqcDAz2rTifEIPWs uO3MQBPX0rQgJKY9elEQZetZPKSVjzjpWv4i0+Ox03SWYKbi4gaSQhs8E/KKwS6qjK3R+MVc1fX5 9XFr5kKobaBYVC9wO9YYiS5HEh3bsRWgCRyuTyq13r6p4R1TwpZnVNiXEcIVRGP3ikfSvO1P+jyM WwWHzDNRwqIo1JHJ6ZrlhUUItWuL2d2UvEU2kvrtw1nbPHB8m1STkfKM/rmis7VGJ1GUn2/kKK9C EvdRk42ZpIzRQx+YuMoNp9eKt3FyXswgQDOFye1Qq7S20O7kIgAHpTJmLNHGRx941wKzlfsa2sdH 4m0Oz8NaTZJFdvPe3cQkfAwioemPfNZ4fTooLMWzTG5ZCLnzPu7u22svWNUd4ojcTNMyKFjBP8I6 D6Vl2FxPeavbB3PMnAHQV104c3vLREptM6gt1UGnn5oQPSqxO1sH1qUPtH1rRnUirMPn+tadlDsT p1qrFF5k4z61pqQtFxpakc9jbzj94gz61UGlxQuHjuCpByM1ZmugOc8Vn3F0CN2eRTuOy6i3Wnyz SlzeZBXGMCs0+HYwcmYnNP8AtWZMliRVhblSMBvwppkOMexTfSLeMYAz7023tESTp34rSH7yonTD 5FD1JsiKXlgAMgVNGQFBJwAM1XORJgmnOWKhAfvH9KVxSHrIWkHBINbvhTQv7c16G1nOyA5aQ99o FZcQ2qBgZ7e1WIXu7eXfBI6PjGVPODXnSqc1S7Whm9jpfGvhKy0a3t2sJ5pV3bJF2ZCjryR35rkf LkWQiZCu3+A9RXSw+Kp7fw1Po89sXEo+WYMQ2T6+tc4xZmySST1Jqq0o6OIoylY53VmB1KUj2/kK Kbqg/wCJjL+H8hRXZB+6jJ3ubMTLBCm7OzYDn04rcvvCt3p+kWurTnbJfvthtwPmCYyCfrWdp+i3 upwxFozFBtGC/wDFx1rtNe1WWDQY3m2v9igCRHHsBmppYVyTuVOpax5Fqrlr2RDwEbbj6U/REP8A aUMvZGzVWZzJKzHksSTWnpG3chA710yXLGyCnrK5v3KATH35FNz8mCannAaNXA6cGq75K4Hasjt2 JrOUbueverLZfIB61mxEh8ir8LqTnrQNaFaa3lYbRk1Qm0u7Y7l/nXRCRD2z71HNIAmMDFFkOxzQ 0u6yeOnvQun3SSDevStw8rleCackbY3McqOwp2E0irHH5agnnio5mABzVmZxjpjjpWVeXABwOTTI emw1mHmhR1NPS4jF+tv1bbkH0plpHjdM/wBaxoLonVFuH5BcEgenpS5OZNGFSVjqiCFOBk1D9pnj xluR0NWr5fIuXAiMSMdyKzZ+Xtz3qqkZmJCkH8a8rlcXZod1bQsrrE0kfkPGr5HUjpTFIIznNU2/ cYHRs1HFc3Es7LEFCjoT/WtHCUxJpMztWUDUpf8AgP8AIUUzUy/9oS5K54zj6Ciu2mnyIze56rYq RY2vY+Sp5+gqDWLcahpdxbA/MyHb9e1WbY/8S21J6iFP5Co3BPQ161tDkueQSKyuVYYYHBBqxp1x 5Fyu77pNbXi7R/s119vgH7qY/OP7rf8A165sZz+Nc049GbwlbVHdQSCRNpwcjBqvKPKbaenb6Vma VqBePY3304PuPWtaY+dEAevY+lcrVmehGXMrorBhuzR9oMT5B4qnLI0b7XGCKb9oDDpzSuFy6+og EjOAah+3kMCXzms2fJPHBqs/m+5poTk0bLavlzk5+lNOtN0XOPesMiTPSnKjk5qreZHO30Nh9QLD PcjAFQgeYwzyT1Jqqg2/Nj8asxOE5J5P6UhvQsXsnk6e6qcEjGa52PPmjH51o305dSASAOMVRtkL zogH3iK1p6s56uh60lrb32mW63KB8xLyeo49axb7w7PahjYNvOOEY4P4Gt21G2ziT+6gq7gt2/8A rV0VKMKnxI5Izcdjzl7OVGDzxvC+ThXHIrqvB/hoa9FqSlcNFb/uSO8h+7/KtW4s4bpSssauPRhW t4d1K30C2S0itcRvLulkLZOPb6VxPBvnu3dGvtlY8W1W1mi1OaN4XVlIBBHIOBRXaePrqCXxpfyR yIyt5ZBXof3a0VapcqsVzJnQWKhtNttvXyl5z7CmsMHGOD0NPsgG023+b/lkvGcdhTpkB2lPSvRO UzLu3juYngmG6Nxhga861jSZtJuzE/zRscxv6j/GvUZELJnbyorI1Kxgv7ZradeDyrjqp9aznG5c ZWPOYZmglWReqnNdBaXwmj3Z69R6GsfUNNn025MM6+6sOjD1FMtpmt5d68juPUVzTjc6ac+VnQ3E KTR/N+dZNxDLA/HzL2Nadu4ljDwsCp/hPakliD9OD6GsGjs3RjfaARhuDSmQFcjFOubba/IqsYio 4NPQi8kOZ8kAAZpPMx1IFRlH3YAqVISfvCnoiE5Nh5ruAqrgetKZNi47dzQ5EWO/rVR5GkPXj0oS uKUuX1FmlL45+UdK1fDNl9t1ZCR8kXzsf5VkxQyTyrFGpZ3OABXoGiaYunWqxKQXYZkb1NdNOOpy zkb8bgkKvSrq8jgc+gqjbLwMjoeavJhecfSuk5xGByEB5NIfkIHOfXFSSAtggAnrTSfmBI4xQB57 4oI/4SK65/udv9haKTxOB/wkN1/wDt/sCiueW7Nlsd9ZbP7Pt1wSfJXrz2qYjIypyo4waisdq6fb DdnMKcY9hUru+ccbO+RXSjIrupRxyfb/AAqtOgdSSo5q+/K8rkH0qq+FYBvX/OaAMPULSC6h8i7B Kn7j91PtXI6jo9zYEtgyw9pFH8/SvQZoVlXOSeeB6VSks5IiWXGD1U9KzlG5alY8+t7uS2k3Icju PWt21v4LxQCAH9D1q3f6BZXr74wbWZucryp/CsK50HUrVtyxGZR/HEc1hKmdEKrWhqz2sbZOBVCW 0XOBVL+072H5Xzx2cUwarcA7srn3FY8hv7VGgtngZUEnsTxUM6/Zk3SSBSegHJNRPrTsm1IwD65q oI7m7kyI5JGPopNCgKVVJaEUkpkOTxzUlpZz3soit4y7E8+gHvWtZ+GLiTa14wt067erH/CumsbK K2hEVtFsj7nu31NbxpnLKZT0nRorCPtJM3DyensK37aPABH0xTIoAoxgDHcdKtQJxweB1PpW6VjF u5ZhACZ43Z4NThieSMn+VQpgMBv4xj0FTKCD94HPerJJyQUByKZlt4HG09jTuNoGAc9c00k8FunY HtQB554pz/wkd1x/c/8AQFopPFP/ACMV182fudv9haK5pbs2Wx3lnuawtgqgkQp29hUj/MMYO4da ZYuy2FqoPWJP5CpXzvxk4rpWxkIVORxn6VFKAw2kcHipgMuEJOC3PNDgKRgCmIomIx/dywHX1FIC h6gHPpU8jEMMcZ61B5CFXk5DDoQaQyKW1DjAx7cVVNm0Z3R5U54x0NWoJWMe7jOR/OriqGh3Ec5p WuMwp4pv+WkUbj/aUHNU2sUPWwt+uc+WK6dkVk5GaYYUXJA6jvS5Quc7HakHC2cKfRBU3k3brgHZ 9BitxUUAjHTpSOB1wOlHKFzKhsnxukOf61aWNUAGcd8UeczTonADHBwKelsjMzMWJDY60CHxruOF 5H97/CraIOAOAORz1qGLgYqdP9cFAAGM8U0AzbyDwM1Oh2tjjJ4qKZiJQBgcelTI2Iw2ASSOSKoR Kz7UwM5oBGRn8u9Pm+XIA96iXJZjnmgR594qKnxHdYAx8n/oC0U3xSxPiK6J/wBj/wBAWiuWW7N1 sf/Z ------=_NextPart_01C8E823.DA10E9A0 Content-Location: file:///C:/8E69C634/Classof2004_files/master04_stylesheet.css Content-Transfer-Encoding: base64 Content-Type: text/css Ym9keQ0KCXt3aWR0aDo1MzRweDsNCgloZWlnaHQ6NDAwcHg7fQ0KLlRCDQoJe21zby1zcGVjaWFs LWZvcm1hdDpub2J1bGxldJU7fQ0KLlQNCgl7dGV4dC1hbGlnbjpsZWZ0Ow0KCWZvbnQtZmFtaWx5 OlRhaG9tYTsNCgl0ZXh0LXNoYWRvdzphdXRvOw0KCWNvbG9yOiNDQ0ZGRkY7DQoJbXNvLWNvbG9y LWluZGV4OjM7DQoJZm9udC1zaXplOjIwOSU7DQoJbXNvLWNoYXItd3JhcDoxOw0KCW1zby1raW5z b2t1LW92ZXJmbG93OjE7fQ0KLkJCDQoJe21zby1zcGVjaWFsLWZvcm1hdDpidWxsZXRuOw0KCWNv bG9yOiNDQzk5RkY7DQoJbXNvLWNvbG9yLWluZGV4OjQ7DQoJZm9udC1mYW1pbHk6V2luZ2Rpbmdz Ow0KCWZvbnQtc2l6ZTo4MCU7fQ0KLkINCgl7dGV4dC1hbGlnbjpsZWZ0Ow0KCWZvbnQtZmFtaWx5 OlRhaG9tYTsNCgl0ZXh0LXNoYWRvdzphdXRvOw0KCWNvbG9yOndoaXRlOw0KCW1zby1jb2xvci1p bmRleDoxOw0KCWZvbnQtc2l6ZToxNTIlOw0KCW1zby1jaGFyLXdyYXA6MTsNCgltc28ta2luc29r dS1vdmVyZmxvdzoxO30NCi5CMUINCgl7bXNvLXNwZWNpYWwtZm9ybWF0OmJ1bGxldG47DQoJY29s b3I6I0NDRkZGRjsNCgltc28tY29sb3ItaW5kZXg6MzsNCglmb250LWZhbWlseTpXaW5nZGluZ3M7 DQoJZm9udC1zaXplOjcwJTt9DQouQjENCgl7dGV4dC1hbGlnbjpsZWZ0Ow0KCWZvbnQtZmFtaWx5 OlRhaG9tYTsNCgl0ZXh0LXNoYWRvdzphdXRvOw0KCWNvbG9yOndoaXRlOw0KCW1zby1jb2xvci1p bmRleDoxOw0KCWZvbnQtc2l6ZToxMzMlOw0KCW1zby1jaGFyLXdyYXA6MTsNCgltc28ta2luc29r dS1vdmVyZmxvdzoxO30NCi5CMkINCgl7bXNvLXNwZWNpYWwtZm9ybWF0OmJ1bGxldG47DQoJY29s b3I6I0NDOTlGRjsNCgltc28tY29sb3ItaW5kZXg6NDsNCglmb250LWZhbWlseTpXaW5nZGluZ3M7 DQoJZm9udC1zaXplOjY1JTt9DQouQjINCgl7dGV4dC1hbGlnbjpsZWZ0Ow0KCWZvbnQtZmFtaWx5 OlRhaG9tYTsNCgl0ZXh0LXNoYWRvdzphdXRvOw0KCWNvbG9yOndoaXRlOw0KCW1zby1jb2xvci1p bmRleDoxOw0KCWZvbnQtc2l6ZToxMTQlOw0KCW1zby1jaGFyLXdyYXA6MTsNCgltc28ta2luc29r dS1vdmVyZmxvdzoxO30NCi5CM0INCgl7bXNvLXNwZWNpYWwtZm9ybWF0OmJ1bGxldJY7fQ0KLkIz DQoJe3RleHQtYWxpZ246bGVmdDsNCglmb250LWZhbWlseTpUYWhvbWE7DQoJdGV4dC1zaGFkb3c6 YXV0bzsNCgljb2xvcjp3aGl0ZTsNCgltc28tY29sb3ItaW5kZXg6MTsNCglmb250LXNpemU6OTUl Ow0KCW1zby1jaGFyLXdyYXA6MTsNCgltc28ta2luc29rdS1vdmVyZmxvdzoxO30NCi5CNEINCgl7 bXNvLXNwZWNpYWwtZm9ybWF0OmJ1bGxldG47DQoJY29sb3I6I0NDRkZGRjsNCgltc28tY29sb3It aW5kZXg6MzsNCglmb250LWZhbWlseTpXaW5nZGluZ3M7DQoJZm9udC1zaXplOjU1JTt9DQouQjQN Cgl7dGV4dC1hbGlnbjpsZWZ0Ow0KCWZvbnQtZmFtaWx5OlRhaG9tYTsNCgl0ZXh0LXNoYWRvdzph dXRvOw0KCWNvbG9yOndoaXRlOw0KCW1zby1jb2xvci1pbmRleDoxOw0KCWZvbnQtc2l6ZTo5NSU7 DQoJbXNvLWNoYXItd3JhcDoxOw0KCW1zby1raW5zb2t1LW92ZXJmbG93OjE7fQ0KLk5CDQoJe21z by1zcGVjaWFsLWZvcm1hdDpub2J1bGxldJU7fQ0KLk4NCgl7Zm9udC1mYW1pbHk6IlRpbWVzIE5l dyBSb21hbiI7DQoJbXNvLWNoYXItd3JhcDoxOw0KCW1zby1raW5zb2t1LW92ZXJmbG93OjE7fQ0K Lk4xQg0KCXttc28tc3BlY2lhbC1mb3JtYXQ6bm9idWxsZXSVO30NCi5OMQ0KCXtmb250LWZhbWls eToiVGltZXMgTmV3IFJvbWFuIjsNCgltc28tY2hhci13cmFwOjE7DQoJbXNvLWtpbnNva3Utb3Zl cmZsb3c6MTt9DQouTjJCDQoJe21zby1zcGVjaWFsLWZvcm1hdDpub2J1bGxldJU7fQ0KLk4yDQoJ e2ZvbnQtZmFtaWx5OiJUaW1lcyBOZXcgUm9tYW4iOw0KCW1zby1jaGFyLXdyYXA6MTsNCgltc28t a2luc29rdS1vdmVyZmxvdzoxO30NCi5OM0INCgl7bXNvLXNwZWNpYWwtZm9ybWF0Om5vYnVsbGV0 lTt9DQouTjMNCgl7Zm9udC1mYW1pbHk6IlRpbWVzIE5ldyBSb21hbiI7DQoJbXNvLWNoYXItd3Jh cDoxOw0KCW1zby1raW5zb2t1LW92ZXJmbG93OjE7fQ0KLk40Tg0KCXttc28tc3BlY2lhbC1mb3Jt YXQ6bm9idWxsZXSVO30NCi5ONA0KCXtmb250LWZhbWlseToiVGltZXMgTmV3IFJvbWFuIjsNCglt c28tY2hhci13cmFwOjE7DQoJbXNvLWtpbnNva3Utb3ZlcmZsb3c6MTt9DQouT0INCgl7bXNvLXNw ZWNpYWwtZm9ybWF0Om5vYnVsbGV0lTt9DQouTw0KCXt0ZXh0LWFsaWduOmxlZnQ7DQoJZm9udC1m YW1pbHk6IlRpbWVzIE5ldyBSb21hbiI7DQoJY29sb3I6d2hpdGU7DQoJbXNvLWNvbG9yLWluZGV4 OjE7DQoJZm9udC1zaXplOjExNCU7DQoJbXNvLWNoYXItd3JhcDoxOw0KCW1zby1raW5zb2t1LW92 ZXJmbG93OjE7fQ0KLk8xQg0KCXttc28tc3BlY2lhbC1mb3JtYXQ6bm9idWxsZXSVO30NCi5PMQ0K CXtmb250LWZhbWlseToiVGltZXMgTmV3IFJvbWFuIjsNCglmb250LXNpemU6MTE0JTsNCgltc28t Y2hhci13cmFwOjE7DQoJbXNvLWtpbnNva3Utb3ZlcmZsb3c6MTt9DQouTzJCDQoJe21zby1zcGVj aWFsLWZvcm1hdDpub2J1bGxldJU7fQ0KLk8yDQoJe2ZvbnQtZmFtaWx5OiJUaW1lcyBOZXcgUm9t YW4iOw0KCWZvbnQtc2l6ZToxMTQlOw0KCW1zby1jaGFyLXdyYXA6MTsNCgltc28ta2luc29rdS1v dmVyZmxvdzoxO30NCi5PM0INCgl7bXNvLXNwZWNpYWwtZm9ybWF0Om5vYnVsbGV0lTt9DQouTzMN Cgl7Zm9udC1mYW1pbHk6IlRpbWVzIE5ldyBSb21hbiI7DQoJZm9udC1zaXplOjExNCU7DQoJbXNv LWNoYXItd3JhcDoxOw0KCW1zby1raW5zb2t1LW92ZXJmbG93OjE7fQ0KLk80Qg0KCXttc28tc3Bl Y2lhbC1mb3JtYXQ6bm9idWxsZXSVO30NCi5PNA0KCXtmb250LWZhbWlseToiVGltZXMgTmV3IFJv bWFuIjsNCglmb250LXNpemU6MTE0JTsNCgltc28tY2hhci13cmFwOjE7DQoJbXNvLWtpbnNva3Ut b3ZlcmZsb3c6MTt9DQouQ0JCDQoJe21zby1zcGVjaWFsLWZvcm1hdDpub2J1bGxldG47DQoJY29s b3I6I0NDOTlGRjsNCgltc28tY29sb3ItaW5kZXg6NDsNCglmb250LWZhbWlseTpXaW5nZGluZ3M7 DQoJZm9udC1zaXplOjgwJTt9DQouQ0INCgl7dGV4dC1hbGlnbjpjZW50ZXI7DQoJZm9udC1mYW1p bHk6VGFob21hOw0KCXRleHQtc2hhZG93OmF1dG87DQoJY29sb3I6I0NDRUNGRjsNCglmb250LXNp emU6MTkwJTsNCgltc28tY2hhci13cmFwOjE7DQoJbXNvLWtpbnNva3Utb3ZlcmZsb3c6MTt9DQou Q0IxQg0KCXttc28tc3BlY2lhbC1mb3JtYXQ6bm9idWxsZXRuOw0KCWNvbG9yOiNDQ0ZGRkY7DQoJ bXNvLWNvbG9yLWluZGV4OjM7DQoJZm9udC1mYW1pbHk6V2luZ2RpbmdzOw0KCWZvbnQtc2l6ZTo3 MCU7fQ0KLkNCMQ0KCXtmb250LWZhbWlseTpUYWhvbWE7DQoJdGV4dC1zaGFkb3c6YXV0bzsNCglt c28tY2hhci13cmFwOjE7DQoJbXNvLWtpbnNva3Utb3ZlcmZsb3c6MTt9DQouQ0IyQg0KCXttc28t c3BlY2lhbC1mb3JtYXQ6bm9idWxsZXRuOw0KCWNvbG9yOiNDQzk5RkY7DQoJbXNvLWNvbG9yLWlu ZGV4OjQ7DQoJZm9udC1mYW1pbHk6V2luZ2RpbmdzOw0KCWZvbnQtc2l6ZTo2NSU7fQ0KLkNCMg0K CXtmb250LWZhbWlseTpUYWhvbWE7DQoJdGV4dC1zaGFkb3c6YXV0bzsNCgltc28tY2hhci13cmFw OjE7DQoJbXNvLWtpbnNva3Utb3ZlcmZsb3c6MTt9DQouQ0IzQg0KCXttc28tc3BlY2lhbC1mb3Jt YXQ6bm9idWxsZXSWO30NCi5DQjMNCgl7Zm9udC1mYW1pbHk6VGFob21hOw0KCXRleHQtc2hhZG93 OmF1dG87DQoJbXNvLWNoYXItd3JhcDoxOw0KCW1zby1raW5zb2t1LW92ZXJmbG93OjE7fQ0KLkNC NEINCgl7bXNvLXNwZWNpYWwtZm9ybWF0Om5vYnVsbGV0bjsNCgljb2xvcjojQ0NGRkZGOw0KCW1z by1jb2xvci1pbmRleDozOw0KCWZvbnQtZmFtaWx5OldpbmdkaW5nczsNCglmb250LXNpemU6NTUl O30NCi5DQjQNCgl7Zm9udC1mYW1pbHk6VGFob21hOw0KCXRleHQtc2hhZG93OmF1dG87DQoJbXNv LWNoYXItd3JhcDoxOw0KCW1zby1raW5zb2t1LW92ZXJmbG93OjE7fQ0KLkNUQg0KCXttc28tc3Bl Y2lhbC1mb3JtYXQ6bm9idWxsZXSVO30NCi5DVA0KCXt0ZXh0LWFsaWduOmxlZnQ7DQoJZm9udC1m YW1pbHk6VGFob21hOw0KCXRleHQtc2hhZG93OmF1dG87DQoJY29sb3I6I0NDRkZGRjsNCglmb250 LXNpemU6MzE0JTsNCgltc28tY2hhci13cmFwOjE7DQoJbXNvLWtpbnNva3Utb3ZlcmZsb3c6MTt9 DQouSEJCDQoJe21zby1zcGVjaWFsLWZvcm1hdDpidWxsZXRuOw0KCWNvbG9yOiNDQzk5RkY7DQoJ bXNvLWNvbG9yLWluZGV4OjQ7DQoJZm9udC1mYW1pbHk6V2luZ2RpbmdzOw0KCWZvbnQtc2l6ZTo4 MCU7fQ0KLkhCDQoJe3RleHQtYWxpZ246bGVmdDsNCglmb250LWZhbWlseTpUYWhvbWE7DQoJdGV4 dC1zaGFkb3c6YXV0bzsNCgljb2xvcjp3aGl0ZTsNCgltc28tY29sb3ItaW5kZXg6MTsNCglmb250 LXNpemU6MTMzJTsNCgltc28tY2hhci13cmFwOjE7DQoJbXNvLWtpbnNva3Utb3ZlcmZsb3c6MTt9 DQouSEIxQg0KCXttc28tc3BlY2lhbC1mb3JtYXQ6YnVsbGV0bjsNCgljb2xvcjojQ0NGRkZGOw0K CW1zby1jb2xvci1pbmRleDozOw0KCWZvbnQtZmFtaWx5OldpbmdkaW5nczsNCglmb250LXNpemU6 NzAlO30NCi5IQjENCgl7Zm9udC1mYW1pbHk6VGFob21hOw0KCXRleHQtc2hhZG93OmF1dG87DQoJ bXNvLWNoYXItd3JhcDoxOw0KCW1zby1raW5zb2t1LW92ZXJmbG93OjE7fQ0KLkhCMkINCgl7bXNv LXNwZWNpYWwtZm9ybWF0OmJ1bGxldG47DQoJY29sb3I6I0NDOTlGRjsNCgltc28tY29sb3ItaW5k ZXg6NDsNCglmb250LWZhbWlseTpXaW5nZGluZ3M7DQoJZm9udC1zaXplOjY1JTt9DQouSEIyDQoJ e2ZvbnQtZmFtaWx5OlRhaG9tYTsNCgl0ZXh0LXNoYWRvdzphdXRvOw0KCW1zby1jaGFyLXdyYXA6 MTsNCgltc28ta2luc29rdS1vdmVyZmxvdzoxO30NCi5IQjNCDQoJe21zby1zcGVjaWFsLWZvcm1h dDpidWxsZXSWO30NCi5IQjMNCgl7Zm9udC1mYW1pbHk6VGFob21hOw0KCXRleHQtc2hhZG93OmF1 dG87DQoJbXNvLWNoYXItd3JhcDoxOw0KCW1zby1raW5zb2t1LW92ZXJmbG93OjE7fQ0KLkhCNEIN Cgl7bXNvLXNwZWNpYWwtZm9ybWF0OmJ1bGxldG47DQoJY29sb3I6I0NDRkZGRjsNCgltc28tY29s b3ItaW5kZXg6MzsNCglmb250LWZhbWlseTpXaW5nZGluZ3M7DQoJZm9udC1zaXplOjU1JTt9DQou SEI0DQoJe2ZvbnQtZmFtaWx5OlRhaG9tYTsNCgl0ZXh0LXNoYWRvdzphdXRvOw0KCW1zby1jaGFy LXdyYXA6MTsNCgltc28ta2luc29rdS1vdmVyZmxvdzoxO30NCi5RQkINCgl7bXNvLXNwZWNpYWwt Zm9ybWF0OmJ1bGxldG47DQoJY29sb3I6I0NDOTlGRjsNCgltc28tY29sb3ItaW5kZXg6NDsNCglm b250LWZhbWlseTpXaW5nZGluZ3M7DQoJZm9udC1zaXplOjgwJTt9DQouUUINCgl7Zm9udC1mYW1p bHk6VGFob21hOw0KCXRleHQtc2hhZG93OmF1dG87DQoJbXNvLWNoYXItd3JhcDoxOw0KCW1zby1r aW5zb2t1LW92ZXJmbG93OjE7fQ0KLlFCMUINCgl7bXNvLXNwZWNpYWwtZm9ybWF0OmJ1bGxldG47 DQoJY29sb3I6I0NDRkZGRjsNCgltc28tY29sb3ItaW5kZXg6MzsNCglmb250LWZhbWlseTpXaW5n ZGluZ3M7DQoJZm9udC1zaXplOjcwJTt9DQouUUIxDQoJe2ZvbnQtZmFtaWx5OlRhaG9tYTsNCgl0 ZXh0LXNoYWRvdzphdXRvOw0KCW1zby1jaGFyLXdyYXA6MTsNCgltc28ta2luc29rdS1vdmVyZmxv dzoxO30NCi5RQjJCDQoJe21zby1zcGVjaWFsLWZvcm1hdDpidWxsZXRuOw0KCWNvbG9yOiNDQzk5 RkY7DQoJbXNvLWNvbG9yLWluZGV4OjQ7DQoJZm9udC1mYW1pbHk6V2luZ2RpbmdzOw0KCWZvbnQt c2l6ZTo2NSU7fQ0KLlFCMg0KCXtmb250LWZhbWlseTpUYWhvbWE7DQoJdGV4dC1zaGFkb3c6YXV0 bzsNCgltc28tY2hhci13cmFwOjE7DQoJbXNvLWtpbnNva3Utb3ZlcmZsb3c6MTt9DQouUUIzQg0K CXttc28tc3BlY2lhbC1mb3JtYXQ6YnVsbGV0ljt9DQouUUIzDQoJe2ZvbnQtZmFtaWx5OlRhaG9t YTsNCgl0ZXh0LXNoYWRvdzphdXRvOw0KCW1zby1jaGFyLXdyYXA6MTsNCgltc28ta2luc29rdS1v dmVyZmxvdzoxO30NCi5RQjRCDQoJe21zby1zcGVjaWFsLWZvcm1hdDpidWxsZXRuOw0KCWNvbG9y OiNDQ0ZGRkY7DQoJbXNvLWNvbG9yLWluZGV4OjM7DQoJZm9udC1mYW1pbHk6V2luZ2RpbmdzOw0K CWZvbnQtc2l6ZTo1NSU7fQ0KLlFCNA0KCXtmb250LWZhbWlseTpUYWhvbWE7DQoJdGV4dC1zaGFk b3c6YXV0bzsNCgltc28tY2hhci13cmFwOjE7DQoJbXNvLWtpbnNva3Utb3ZlcmZsb3c6MTt9DQou VGJsQg0KCXttc28tc3BlY2lhbC1mb3JtYXQ6bm9idWxsZXRuOw0KCWNvbG9yOiNDQzk5RkY7DQoJ bXNvLWNvbG9yLWluZGV4OjQ7DQoJZm9udC1mYW1pbHk6V2luZ2RpbmdzOw0KCWZvbnQtc2l6ZTo4 MCU7fQ0KLlRibA0KCXtmb250LWZhbWlseTpUYWhvbWE7DQoJdGV4dC1zaGFkb3c6YXV0bzsNCglt c28tY2hhci13cmFwOjE7DQoJbXNvLWtpbnNva3Utb3ZlcmZsb3c6MTt9DQouVGJsMUINCgl7bXNv LXNwZWNpYWwtZm9ybWF0Om5vYnVsbGV0bjsNCgljb2xvcjojQ0NGRkZGOw0KCW1zby1jb2xvci1p bmRleDozOw0KCWZvbnQtZmFtaWx5OldpbmdkaW5nczsNCglmb250LXNpemU6NzAlO30NCi5UYmwx DQoJe2ZvbnQtZmFtaWx5OlRhaG9tYTsNCgl0ZXh0LXNoYWRvdzphdXRvOw0KCW1zby1jaGFyLXdy YXA6MTsNCgltc28ta2luc29rdS1vdmVyZmxvdzoxO30NCi5UYmwyQg0KCXttc28tc3BlY2lhbC1m b3JtYXQ6bm9idWxsZXRuOw0KCWNvbG9yOiNDQzk5RkY7DQoJbXNvLWNvbG9yLWluZGV4OjQ7DQoJ Zm9udC1mYW1pbHk6V2luZ2RpbmdzOw0KCWZvbnQtc2l6ZTo2NSU7fQ0KLlRibDINCgl7Zm9udC1m YW1pbHk6VGFob21hOw0KCXRleHQtc2hhZG93OmF1dG87DQoJbXNvLWNoYXItd3JhcDoxOw0KCW1z by1raW5zb2t1LW92ZXJmbG93OjE7fQ0KLlRibDNCDQoJe21zby1zcGVjaWFsLWZvcm1hdDpub2J1 bGxldJY7fQ0KLlRibDMNCgl7Zm9udC1mYW1pbHk6VGFob21hOw0KCXRleHQtc2hhZG93OmF1dG87 DQoJbXNvLWNoYXItd3JhcDoxOw0KCW1zby1raW5zb2t1LW92ZXJmbG93OjE7fQ0KLlRibDRCDQoJ e21zby1zcGVjaWFsLWZvcm1hdDpub2J1bGxldG47DQoJY29sb3I6I0NDRkZGRjsNCgltc28tY29s b3ItaW5kZXg6MzsNCglmb250LWZhbWlseTpXaW5nZGluZ3M7DQoJZm9udC1zaXplOjU1JTt9DQou VGJsNA0KCXtmb250LWZhbWlseTpUYWhvbWE7DQoJdGV4dC1zaGFkb3c6YXV0bzsNCgltc28tY2hh ci13cmFwOjE7DQoJbXNvLWtpbnNva3Utb3ZlcmZsb3c6MTt9DQouZGVmYXVsdEINCgl7bXNvLXNw ZWNpYWwtZm9ybWF0Om5vYnVsbGV0lTt9DQouZGVmYXVsdA0KCXt0ZXh0LWFsaWduOmNlbnRlcjsN Cglmb250LWZhbWlseToiVGltZXMgTmV3IFJvbWFuIjsNCglmb250LXdlaWdodDpub3JtYWw7DQoJ Zm9udC1zdHlsZTpub3JtYWw7DQoJdGV4dC1kZWNvcmF0aW9uOm5vbmU7DQoJdGV4dC1zaGFkb3c6 bm9uZTsNCgl0ZXh0LWVmZmVjdDpub25lOw0KCW1zby1mYXJlYXN0LWhpbnQ6bm87DQoJbGF5b3V0 LWZsb3c6aG9yaXpvbnRhbDsNCgljb2xvcjp3aGl0ZTsNCgltc28tY29sb3ItaW5kZXg6MTsNCglm b250LXNpemU6MTE0JTsNCgltc28tdGV4dC1yYWlzZTowJTsNCgltc28tbGluZS1zcGFjaW5nOiIx MDAgMCAwIjsNCgltc28tbWFyZ2luLWxlZnQtYWx0OjA7DQoJbXNvLXRleHQtaW5kZW50LWFsdDow Ow0KCW1zby1jaGFyLXdyYXA6MTsNCgltc28ta2luc29rdS1vdmVyZmxvdzoxOw0KCWRpcmVjdGlv bjpsdHI7DQoJbXNvLXdvcmQtd3JhcDoxOw0KCW1zby12ZXJ0aWNhbC1hbGlnbi1zcGVjaWFsOmJh c2VsaW5lOw0KCW1zby1hbnNpLWxhbmd1YWdlOkVOLVVTO30NCmE6bGluaw0KCXtjb2xvcjojOTlD Q0ZGICFpbXBvcnRhbnQ7fQ0KYTphY3RpdmUNCgl7Y29sb3I6Izk5OTlGRiAhaW1wb3J0YW50O30N CmE6dmlzaXRlZA0KCXtjb2xvcjojMDA2NkZGICFpbXBvcnRhbnQ7fQ0K ------=_NextPart_01C8E823.DA10E9A0 Content-Location: file:///C:/8E69C634/Classof2004_files/script.js Content-Transfer-Encoding: quoted-printable Content-Type: application/javascript; charset="windows-1252" function LoadSld() { var sld=3DGetObj("SlideObj") if( !g_supportsPPTHTML ) { =09 sld.style.visibility=3D"visible" return } if( MakeNotesVis() ) return runAnimations =3D _InitAnimations(); =09 if( IsWin("PPTSld") ) parent.SldUpdated(GetSldId()) g_origSz=3DparseInt(SlideObj.style.fontSize) g_origH=3Dsld.style.posHeight g_origW=3Dsld.style.posWidth g_scaleHyperlinks=3D(document.all.tags("AREA").length>0) if( g_scaleHyperlinks ) InitHLinkArray() if( g_scaleInFrame||(IsWin("PPTSld") && parent.IsFullScrMode() ) ) document.body.scroll=3D"no" _RSW() if( IsWin("PPTSld") && parent.IsFullScrMode() ) FullScrInit(); =09 MakeSldVis(); ChkAutoAdv() if( runAnimations ) { if( document.all("NSPlay") ) document.all("NSPlay").autoStart =3D false; if( sld.filters && sld.filters.revealtrans ) setTimeout( "document.body.start()", sld.filters.revealtrans.duration * = 1000 ); else document.body.start(); } } function MakeSldVis()=20 { var fTrans=3Dg_showAnimation && SldHasTrans() if( fTrans )=09 { if( g_bgSound ) { idx=3Dg_bgSound.indexOf(","); pptSound.src=3Dg_bgSound.substr( 0, idx ); pptSound.loop=3D -(parseInt(g_bgSound.substr(idx+1))); } SlideObj.filters.revealtrans.Apply()=09 } SlideObj.style.visibility=3D"visible" if( fTrans ) SlideObj.filters.revealtrans.Play() } function MakeNotesVis()=20 { if( !IsNts() ) return false=20 SlideObj.style.display=3D"none" nObj =3D document.all.item("NotesObj") parent.SetHasNts(0) if( nObj ) {=20 nObj.style.display=3D"" parent.SetHasNts(1) } return 1 } function ChkAutoAdv() { if(SldHasTrans()) SlideObj.onfilterchange=3DAutoAdv else AutoAdv() } function AutoAdv() { if(!IsWin("PPTSld") || !gUseSldTimings )return var sld=3DGetCurSld() if( (sld.mAdvDelay>0) && !parent.IsFramesMode() ) setTimeout("parent.GoToNextSld()",sld.mAdvDelay) } function GetObj(id) { if(g_supportsPPTHTML) return document.all(id); else return document.getElementById(id); } function SldHasTrans() { return SlideObj.style.filter !=3D ""; } function GetSldId()=20 { var regExp =3D /file:\/\/\//i var pos =3D location.href.search(regExp) if (MHTMLPrefix !=3D "" && pos !=3D -1) sId =3D location.href.substring(pos) else { sId =3D RemoveFilePrefixFromHref(location.href); var regExp =3D /\// var fixedHref =3D sId var pos =3D -1 =09 pos =3D fixedHref.search(regExp) while (pos !=3D -1) { fixedHref =3D fixedHref.replace(regExp, "\\") pos =3D fixedHref.search(regExp) } =09 if (g_fBaseHyperlink =3D=3D true) sId =3D "file:///" + fixedHref; else sId =3D fixedHref.substring(fixedHref.lastIndexOf('\\') + 1) } =09 return sId } function HideMenu() { if( frames["PPTSld"] && PPTSld.document.all.item("ctx= tmenu") && PPTSld.ctxtmenu.style.display!=3D"none" ) { PPTSld.ctxtmenu.styl= e.display=3D'none'; return true } return false } function IsWin( name ) { return window.name =3D=3D name } function IsNts() { return IsWin("PPTNts") } function IsSldOrNts() { return( IsWin("PPTSld")||IsWin("PPTNts") ) } function SupportsPPTAnimation() { return( navigator.platform =3D=3D "Win32"= && navigator.appVersion.indexOf("Windows")>0 ) } function SupportsPPTHTML() { var appVer=3Dnavigator.appVersion, msie=3DappVer.indexOf("MSIE "), ver=3D0 if( msie >=3D 0 ) ver=3DparseFloat( appVer.substring( msie+5, appVer.indexOf(";",msie) ) ) else ver=3DparseInt(appVer) return( ver >=3D 4 && msie >=3D 0 ) } function _RSW() { if( !g_supportsPPTHTML || IsNts() || ( !g_scaleInFrame && (!IsWin("PPTSld") || !parent.IsFullScrMode()) ) ) return var padding=3D0; if( IsWin("PPTSld") && parent.IsFramesMode() ) padding=3D6 cltWidth=3Ddocument.body.clientWidth-padding cltHeight=3Ddocument.body.clientHeight-padding factor=3D(1.0*cltWidth)/g_origW if( cltHeight < g_origH*factor ) factor=3D(1.0*cltHeight)/g_origH newSize =3D g_origSz * factor if( newSize < 1 ) newSize=3D1 s=3DSlideObj.style s.fontSize=3DnewSize+"px" s.posWidth=3Dg_origW*factor s.posHeight=3Dg_origH*factor s.posLeft=3D(cltWidth-s.posWidth+padding)/2 s.posTop=3D(cltHeight-s.posHeight+padding)/2 if( g_scaleHyperlinks ) ScaleHyperlinks( factor ) } function _InitAnimations() { animRuntimeInstalled =3D ''+document.body.localTime !=3D 'undefined'; isFullScreen =3D (window.name =3D=3D "PPTSld") && !parent.IsFramesMode(); g_animUseRuntime =3D g_showAnimation && animRuntimeInstalled && !(isFullSc= reen && parent.IsSldVisited()); if( g_animUseRuntime ) { collSeq =3D document.all.tags("seq"); if( collSeq !=3D null ) { for(ii=3D0;ii numSlds ) gSldJumpIdx =3D numSlds; if ( gSldJumpIdx >=3D 0 ) { if ( gSldJumpIdx =3D=3D 0 ) gSldJumpIdx =3D 1; var jumpTo =3D parseInt(gSldJumpIdx); gSldJump =3D 0; gSldJumpIdx =3D ""; win.GoToSld( parent.GetSldList().mList[jumpTo-1].mSldHref ) } } } function _KDH() { if( event.keyCode =3D=3D 8 ) { event.returnValue =3D 0; parent.GoToPrevSld(); } } function DocumentOnClick() { if( IsNts() || parent.HideMenu() ) return; if( ( g_allowAdvOnClick && !parent.IsFramesMode() ) || (event && (event.keyCode=3D=3D32) ) ) parent.GoToNextSld(); } var g_supportsPPTHTML =3D SupportsPPTHTML(), g_scaleInFrame =3D 1, gId=3D""= , g_bgSound=3D"", g_scaleHyperlinks =3D false, g_allowAdvOnClick =3D 1, g_showInBrowser = =3D 0, gLoopCont =3D 0, gUseSldTimings =3D 1; var g_showAnimation =3D g_supportsPPTHTML && SupportsPPTAnimation() && ( (w= indow.name=3D=3D"PPTSld" && !parent.IsFramesMode()) || g_showInBrowser );va= r g_animManager =3D null; var g_animUseRuntime =3D false; var g_animItemsToHide, g_animInteractiveItems, g_animSlideTime; var g_animMainSequence =3D null; var ENDSHOW_MESG=3D"End of slide show, click to exit.", SCREEN_MODE=3D"Fram= es", gIsEndShow=3D0, NUM_VIS_SLDS=3D11, SCRIPT_HREF=3D"script.js", FULLSCR_= HREF=3D"fullscreen.htm"; var gCurSld =3D gPrevSld =3D 1, g_offset =3D 0, gNtsOpen =3D gHasNts =3D gO= tlTxtExp =3D 0, gHasNarration =3D 0, gOtlOpen =3D true window.gPPTHTML=3DSupportsPPTHTML() var g_fBaseHyperlink =3D false; var gMainDoc=3Dnew Array(new hrefList("slide0001.htm",1,8001,1),new hrefLis= t("slide0002.htm",1,8001,1),new hrefList("slide0104.htm",1,8001,1),new href= List("slide0107.htm",1,8001,1),new hrefList("slide0108.htm",1,8001,1),new h= refList("slide0109.htm",1,8001,1),new hrefList("slide0110.htm",1,8001,1),ne= w hrefList("slide0111.htm",1,8001,1),new hrefList("slide0112.htm",1,8001,1)= ,new hrefList("slide0113.htm",1,8001,1),new hrefList("slide0114.htm",1,8001= ,1)); /********************************************* Frameset functions These functions control slide navigation and state of the frameset. **********************************************/ function RemoveFilePrefixFromHref(href) { var regExp =3D /^file:\/\/\//i; return href.replace(regExp, "") } function FullScrInit() { g_allowAdvOnClick =3D GetCurSld().mAdvOnClk document.body.style.backgroundColor=3D"black" document.oncontextmenu=3Dparent._CM; document.onkeydown =3D _KDH; document.ondragstart=3DCancel document.onselectstart=3DCancel self.focus() } function Redirect( frmId ) {=09 var str=3Ddocument.location.hash,idx=3Dstr.indexOf('#'), sId=3DGetSldId() if(idx>=3D0) str=3Dstr.substr(1); if( window.name !=3D frmId && ( sId !=3D str) ) { obj =3D GetObj("Main-File") window.location.href=3Dobj.href+"#"+sId return 1 } return 0 } var MHTMLPrefix =3D CalculateMHTMLPrefix();=20 function CalculateMHTMLPrefix() { if ( document.location.protocol =3D=3D 'mhtml:') {=20 href=3Dnew String(document.location.href)=20 Start=3Dhref.indexOf('!')+1=20 End=3Dhref.lastIndexOf('/')+1=20 if (End < Start)=20 return href.substring(0, Start)=20 else=20 return href.substring(0, End)=20 } return ''; } function GetTags(base,tag) { if(g_supportsPPTHTML) return base.all.tags(tag); else return base.getElementsByTagName(tag); } function UpdNtsPane(){ if(frames["PPTNts"]) PPTNts.location.replace( MHTMLP= refix+GetHrefObj( gCurSld ).mNtsHref ) } function UpdNavPane( sldIndex ){ if(gNavLoaded) PPTNav.UpdNav() } function UpdOtNavPane(){ if(gOtlNavLoaded) PPTOtlNav.UpdOtlNav() } function UpdOtlPane(){ if(gOtlLoaded) PPTOtl.UpdOtl() } function SetHasNts( fVal ) { if( gHasNts !=3D fVal ) { gHasNts=3DfVal UpdNavPane() } } function ToggleOtlText() { gOtlTxtExp=3D!gOtlTxtExp UpdOtlPane() } function ClearMedia() { // Clear any sounds playing before launching another browser window. Other= wise, // in fullscreen mode, you'll continue to hear the sound in the frames mod= e. if (PPTSld.pptSound) PPTSld.pptSound.loop =3D 0; } function FullScreen() {=20 if ( PPTSld.g_animUseRuntime ) PPTSld.document.body.pause(); ClearMedia(); var href =3D ( document.location.protocol =3D=3D 'mhtml:') ? FULLSCR_HREF = : FULLSCR_HREF+"#"+GetHrefObj(gCurSld).mSldHref; if (MHTMLPrefix !=3D "") href =3D RemoveFilePrefixFromHref(href) if(PPTNav.event.ctrlKey) { var w =3D (window.screen.availWidth * 1.0) / 2.0 var h =3D w * (PPTSld.g_origH * 1.0) / PPTSld.g_origW win =3D window.open( MHTMLPrefix+href,null,"toolbar=3D0,resizable=3D1,top= =3D0,left=3D0," + "width=3D"+ w + ",height=3D" + h ); if( win.document.body && PPTSld.g_animUseRuntime ) win.document.body.PPTSldFrameset=3Dwindow; } else { win =3D window.open( MHTMLPrefix+href,null,"fullscreen=3Dyes" ); if( win.document.body && PPTSld.g_animUseRuntime ) win.document.body.PPTSldFrameset=3Dwindow; } } function ToggleVNarration() { rObj=3DPPTSld.document.all("NSPlay") if( rObj && !PPTSld.g_animUseRuntime ) { if( (rObj.playState =3D=3D 1)||(rObj.playState =3D=3D 0) ) rObj.Play() else if( rObj.playState =3D=3D 2 ) rObj.Pause() else return; } else if( PPTSld.g_animUseRuntime ) { narObj =3D PPTSld.document.all("narrationID") if( narObj ) narObj.togglePause() } } function GetCurSldNum() { =20 obj=3DGetHrefObj(gCurSld) if( obj.mOrigVis =3D=3D 1 ) return obj.mSldIdx else =20 return gCurSld } function GetNumSlds() { =20 if( GetHrefObj(gCurSld).mOrigVis =3D=3D 1 ) return GetSldList().mNumVisSlds; else return GetSldList().mList.length } function GetSldNum( href ) { for(ii=3D0; ii 1 ) PopSldList(); else if( !IsFramesMode() ) { if( gLoopCont ) GoToFirst() else EndShow() } } function GoToPrevSld() { ii=3DgCurSld-1 if( ii > 0 ) { obj=3DGetHrefObj(ii) while ( obj && ( obj.mVis =3D=3D 0 ) && ( ii>0 ) ) obj=3DGetHrefObj(--ii) if( ii =3D=3D 0 ) ii=3D1 GoToSldNum(ii) } } function GoToFirst(){ GoToSld( GetHrefObj(1).mSldHref ) } function GoToLast() { ii=3DGetSldList().mList.length if( ii !=3D gCurSld ) GoToSld( GetHrefObj(ii).mSldHref ) } function GoToSldNum( num ) { if( PPTSld.event ) PPTSld.event.cancelBubble=3Dtrue obj =3D GetHrefObj( num ) obj.mVis=3D1 gPrevSld=3DgCurSld gCurSld =3D num; =09 if (MHTMLPrefix !=3D "") PPTSld.location.replace(MHTMLPrefix+RemoveFilePrefixFromHref(obj.mSldHref= )) else PPTSld.location.replace(obj.mSldHref) =09 if( IsFramesMode() ) { UpdNavPane(); UpdOtlPane(); UpdNtsPane() } } function GoToSld( href ) { if( PPTSld.event ) PPTSld.event.cancelBubble=3Dtrue GetHrefObj( GetSldNum(href) ).mVis=3D1 if (MHTMLPrefix !=3D "") PPTSld.location.replace(MHTMLPrefix+RemoveFilePrefixFromHref(href)) else PPTSld.location.replace(href) } function SldUpdated( id ) { if( id =3D=3D GetHrefObj(gCurSld).mSldHref ) return gPrevSld=3DgCurSld gCurSld=3DGetSldNum(id) if( IsFramesMode() ) { UpdNavPane(); UpdOtlPane(); UpdNtsPane() } } function PrevSldViewed(){ GoToSld( GetHrefObj(gPrevSld).mSldHref ) } function HasPrevSld() { return ( gIsEndShow || ( gCurSld !=3D 1 && GetHrefO= bj( gCurSld-1 ).mVis =3D=3D 1 )||( GetCurSldNum() > 1 ) ) } function HasNextSld() { return (GetCurSldNum() !=3D GetNumSlds()) } function CloseWindow() { if( HideMenu() ) return; =09 var event =3D PPTSld.event; if( !IsFramesMode() && event && (event.keyCode=3D=3D27 || event.keyCode=3D= =3D32 || event.type=3D=3D"click" ) ) window.close( self ); CatchNumKeys( self, event ); } function Unload() { gIsEndShow=3D0; } function SetupEndShow() { gIsEndShow=3D1; PPTSld.document.body.scroll=3D"no"; PPTSld.document.onkeypress=3DCloseWindow; PPTSld.document.onclick=3DCloseWindow; PPTSld.document.oncontextmenu=3D_CM; } function EndShow() { if( IsFramesMode() ) return if( PPTSld.event ) PPTSld.event.cancelBubble=3Dtrue doc=3DPPTSld.document var dir =3D doc.body.dir if( dir !=3D "rtl" ) dir =3D "ltr"; doc.open() doc.writeln('


' + ENDSHOW_MESG + '

') doc.close() } function SetSldVisited(){ GetSldList().mList[gCurSld-1].mVisited=3Dtrue } function IsSldVisited(){ return GetSldList().mList[gCurSld-1].mVisited } function hrefList( sldHref, visible, advDelay, advClk ) { this.mSldHref=3D this.mNtsHref =3D sldHref this.mOrigVis=3D this.mVis =3D visible this.mVisited=3D false this.mAdvDelay=3D advDelay this.mAdvOnClk=3D advClk } function SldList(arr,curSld,fEnd) { this.mCurSld =3D curSld; this.mList =3D new Array(); var idx =3D 1; for(ii=3D0;ii 0) { PushSldList(sldList,fEnd); gCurSld =3D 1; } else if( PPTSld.event ) PPTSld.event.cancelBubble=3Dtrue } function PushSldList(arr,fEnd) { var ii =3D gSldStack.length; gSldStack[ii] =3D new SldList(arr,gCurSld,fEnd); GoToSld( gSldStack[ii].mList[0].mSldHref ); } function PopSldList() { if (gSldStack[gSldStack.length-1].fEndShow) EndShow() else { gCurSld =3D gSldStack[gSldStack.length-1].mCurSld; gSldStack[gSldStack.length-1] =3D null; gSldStack.length--; var sldList =3D gSldStack[gSldStack.length-1]; GoToSld( sldList.mList[gCurSld - 1].mSldHref ); } } var custShowList=3Dnew Array(); /********************************************* Navigation button implementation There are 2 types of buttons: ImgBtn, TxtBtn implemented as function objects. They share a similiar interface so the event handlers can call SetActive, for example, on a button=20 object without needing to know exactly=20 what type of button it is. **********************************************/ //---------------------------------- function ImgBtn( oId,bId,w,action ) //---------------------------------- { var t=3Dthis t.Perform =3D _IBP t.SetActive =3D _IBSetA t.SetInactive=3D _IBSetI t.SetPressed =3D _IBSetP t.SetDisabled=3D _IBSetD t.Enabled =3D _IBSetE t.ChangeIcon =3D null t.UserAction =3D action t.ChgState =3D _IBUI t.mObjId =3D oId t.mBorderId=3D bId t.mWidth =3D w t.mIsOn =3D t.mCurState =3D 0 } function _IBSetA() { if( this.mIsOn ) { obj=3Dthis.ChgState( gHiliteClr,gShadowClr,2 ) obj.style.posTop=3D0 } } function _IBSetI() { if( this.mIsOn ) { obj=3Dthis.ChgState( gFaceClr,gFaceClr,1 ) obj.style.posTop=3D0=20 } } function _IBSetP() { if( this.mIsOn ) { obj=3Dthis.ChgState( gShadowClr,gHiliteClr,2 ) obj.style.posLeft+=3D1; obj.style.posTop+=3D1 } } function _IBSetD() { =20 obj=3Dthis.ChgState( gFaceClr,gFaceClr,0 ) obj.style.posTop=3D0=20 } function _IBSetE( state ) { var t=3Dthis GetObj( t.mBorderId ).style.visibility=3D"visible" if( state !=3D t.mIsOn ) { t.mIsOn=3Dstate if( state ) t.SetInactive() else t.SetDisabled() } } function _IBP() { var t=3Dthis if( t.mIsOn ) { if( t.UserAction !=3D null ) t.UserAction() if( t.ChangeIcon ) { obj=3DGetObj(t.mObjId) if( t.ChangeIcon() ) obj.style.posLeft=3Dobj.style.posLeft+(t.mCurState-4)*t.mWidth else obj.style.posLeft=3Dobj.style.posLeft+(t.mCurState-0)*t.mWidth } t.SetActive() } =20 } function _IBUI( clr1,clr2,nextState ) { var t=3Dthis SetBorder( GetObj( t.mBorderId ),clr1,clr2 ) obj=3DGetObj( t.mObjId ) obj.style.posLeft=3Dobj.style.posLeft+(t.mCurState-nextState)*t.mWidth-obj= .style.posTop t.mCurState=3DnextState return obj } //----------------------------------------- function TxtBtn( oId,oeId,action,chkState ) //----------------------------------------- { var t=3Dthis t.Perform =3D _TBP t.SetActive =3D _TBSetA t.SetInactive=3D _TBSetI t.SetPressed =3D _TBSetP t.SetDisabled=3D _TBSetD t.SetEnabled =3D _TBSetE t.GetState =3D chkState t.UserAction =3D action t.ChgState =3D _TBUI t.mObjId =3D oId t.m_elementsId=3D oeId t.mIsOn =3D 1 } function _TBSetA() { var t=3Dthis if( t.mIsOn && !t.GetState() ) t.ChgState( gHiliteClr,gShadowClr,0,0 ) } function _TBSetI() { var t=3Dthis if( t.mIsOn && !t.GetState() ) t.ChgState( gFaceClr,gFaceClr,0,0 ) } function _TBSetP() { if( this.mIsOn ) this.ChgState( gShadowClr,gHiliteClr,1,1 ) } function _TBSetD() { =20 this.ChgState( gFaceClr,gFaceClr,0,0 ) this.mIsOn =3D 0 } function _TBSetE() { var t=3Dthis if( !t.GetState() ) t.ChgState( gFaceClr,gFaceClr,0,0 ) else t.ChgState( gShadowClr,gHiliteClr,1,1 ) t.mIsOn =3D 1 } function _TBP() { var t=3Dthis if( t.mIsOn ) {=20 if( t.UserAction !=3D null ) t.UserAction() if( !t.GetState ) return if( t.GetState() ) t.SetPressed() else t.SetActive() } =20 } function _TBUI( clr1,clr2,lOffset,tOffset ) { SetBorder( GetObj( this.mObjId ),clr1,clr2 ) Offset( GetObj( this.m_elementsId ),lOffset,tOffset ) } function Offset( obj, top, left ){ obj.style.top=3Dtop; obj.style.left=3Dle= ft } function SetBorder( obj, upperLeft, lowerRight ) { s=3Dobj.style; s.borderStyle =3D "solid" s.borderWidth =3D 1=20 s.borderLeftColor =3D s.borderTopColor =3D upperLeft s.borderBottomColor=3D s.borderRightColor =3D lowerRight } function GetBtnObj(){ return gBtnArr[window.event.srcElement.id] } function BtnOnOver(){ b=3DGetBtnObj(); if( b !=3D null ) b.SetActive() } function BtnOnDown(){ b=3DGetBtnObj(); if( b !=3D null ) b.SetPressed() } function BtnOnOut(){ b=3DGetBtnObj(); if( b !=3D null ) b.SetInactive() } function BtnOnUp() { b=3DGetBtnObj() if( b !=3D null ) b.Perform() else Upd() } function GetNtsState(){ return parent.gNtsOpen } function GetOtlState(){ return parent.gOtlOpen } function GetOtlTxtState(){ return parent.gOtlTxtExp } function NtsBtnSetFlag( fVal ) { s=3Ddocument.all.item( this.m_flagId ).style s.display=3D"none" if( fVal ) s.display=3D"" else s.display=3D"none" } function _BSetA_Border(){ b =3D gBtnArr[this.mObjId]; if( b !=3D null ) b.S= etActive() } function _BSetI_Border(){ b =3D gBtnArr[this.mObjId]; if( b !=3D null ) b.S= etInactive() } function _BSetP_Border(){ b =3D gBtnArr[this.mObjId]; if( b !=3D null ) b.S= etPressed() } function _BSetA_BorderImg() {=20 b =3D gBtnArr[this.mBorderId]=20 if( b !=3D null && this.mIsOn && !b.GetState() ) { obj=3Dthis.ChgState( gHiliteClr,gShadowClr,2 ) obj.style.posTop=3D0 } } function _BSetI_BorderImg() {=20 b =3D gBtnArr[this.mBorderId] if( b !=3D null && this.mIsOn && !b.GetState() ) { obj=3Dthis.ChgState( gFaceClr,gFaceClr,1 ) obj.style.posTop=3D0 } } var gHiliteClr=3D"THREEDHIGHLIGHT",gShadowClr=3D"THREEDSHADOW",gFaceClr=3D"= THREEDFACE" var gBtnArr =3D new Array() gBtnArr["nb_otl"] =3D new TxtBtn( "nb_otl","nb_otlElem",parent.ToggleOtlPan= e,GetOtlState ) gBtnArr["nb_otlElem"] =3D new TxtBtn( "nb_otl","nb_otlElem",parent.ToggleOt= lPane,GetOtlState ) gBtnArr["nb_nts"] =3D new ImgBtn( "nb_nts","nb_ntsBorder",10,parent.ToggleN= tsPane ) gBtnArr["nb_nts"].SetActive =3D _BSetA_BorderImg; gBtnArr["nb_nts"].SetInactive =3D _BSetI_BorderImg; gBtnArr["nb_ntsBorder"] =3D new TxtBtn( "nb_ntsBorder","nb_ntsElem",parent.= ToggleNtsPane,GetNtsState ) gBtnArr["nb_ntsElem"] =3D new TxtBtn( "nb_ntsBorder","nb_ntsElem",parent.To= ggleNtsPane,GetNtsState ) gBtnArr["nb_prevBorder"] =3D gBtnArr["nb_prev"]=3D new ImgBtn( "nb_prev","n= b_prevBorder",30,parent.GoToPrevSld ) gBtnArr["nb_nextBorder"] =3D gBtnArr["nb_next"]=3D new ImgBtn( "nb_next","n= b_nextBorder",30,parent.GoToNextSld ) gBtnArr["nb_sldshw"]=3D new ImgBtn( "nb_sldshw","nb_sldshwBorder",18,parent= .FullScreen ) gBtnArr["nb_sldshwBorder"] =3D new TxtBtn( "nb_sldshw","nb_sldshwBorder",pa= rent.FullScreen,null ) gBtnArr["nb_sldshwBorder"].SetActive =3D _BSetA_Border; gBtnArr["nb_sldshwBorder"].SetInactive =3D _BSetI_Border; gBtnArr["nb_sldshwText"] =3D new TxtBtn( "nb_sldshw","nb_sldshwText",parent= .FullScreen,null ) gBtnArr["nb_sldshwText"].SetActive =3D _BSetA_Border; gBtnArr["nb_sldshwText"].SetInactive =3D _BSetI_Border; gBtnArr["nb_voice"] =3D gBtnArr["nb_voiceBorder"] =3D new ImgBtn( "nb_voice= ","nb_voiceBorder",18,parent.ToggleVNarration ) gBtnArr["nb_otlTxtBorder"] =3D gBtnArr["nb_otlTxt"]=3D new ImgBtn( "nb_otlT= xt","nb_otlTxtBorder",23,parent.ToggleOtlText ) gBtnArr["nb_ntsBorder"].m_flagId=3D "nb_nts" gBtnArr["nb_ntsBorder"].SetFlag =3D NtsBtnSetFlag gBtnArr["nb_otlTxt"].ChangeIcon=3D GetOtlTxtState /********************************************* Context menu implementation _CM() is the function that's hooked up to the oncontextmenu event. Once we're asked to show the menu, we first build it by creating DIVs on-the-fly. Then we position it=20 within the screen area so it doesn't get clipped. Creating the DIVs using createElement() means we don't have to write out any extra HTML into the slide HTML files. **********************************************/ var sNext=3D"Next",sPrev=3D"Previous",sEnd=3D"End Show",sFont=3D"Arial",sAr= row=3D"Arrow",sFreeform=3D"Freeform",sRect=3D"Rectangle",sOval=3D"Oval" function ShowMenu() { BuildMenu(); var doc=3DPPTSld.document.body,x=3DPPTSld.event.clientX+doc.scrollLeft,y= =3DPPTSld.event.clientY+doc.scrollTop m =3D PPTSld.document.all.item("ctxtmenu") m.style.pixelLeft=3Dx if( (x+m.scrollWidth > doc.clientWidth)&&(x-m.scrollWidth > 0) ) m.style.pixelLeft=3Dx-m.scrollWidth m.style.pixelTop=3Dy if( (y+m.scrollHeight > doc.clientHeight)&&(y-m.scrollHeight > 0) ) m.style.pixelTop=3Dy-m.scrollHeight m.style.display=3D"" } function _CM() { if( !parent.IsFullScrMode() ) return; if(!PPTSld.event.ctrlKey) { ShowMenu() return false } else HideMenu() } function BuildMenu() { if( PPTSld.document.all.item("ctxtmenu") ) return var mObj=3DCreateItem( PPTSld.document.body ) mObj.id=3D"ctxtmenu" mObj.style.visibility=3D"hidden" var s=3DmObj.style s.position=3D"absolute" s.cursor=3D"default" s.width=3D"120px" SetCMBorder(mObj,"menu","black") var iObj=3DCreateItem( mObj ) SetCMBorder( iObj, "threedhighlight","threedshadow" ) iObj.style.padding=3D2 CreateMenuItem( iObj,sNext,M_GoNextSld,M_True ) CreateMenuItem( iObj,sPrev,M_GoPrevSld,M_HasPrevSld ) =09 CreateSeparator( iObj ) CreateMenuItem( iObj,sEnd,M_End,M_True ) mObj.style.visibility=3D"visible" } function Cancel() { window.event.cancelBubble=3Dtrue; window.event.returnVa= lue=3Dfalse } function Highlight() { ChangeClr("activecaption","threedhighlight") } function Deselect() { ChangeClr("threedface","menutext") } function Perform() { e=3DPPTSld.event.srcElement if( e.type=3D=3D"menuitem" && e.IsActive() ) e.Action() else PPTSld.event.cancelBubble=3Dtrue } function ChangeClr( bg,clr ) { e=3DPPTSld.event.srcElement if( e.type=3D=3D"menuitem" && e.IsActive() ) { e.style.backgroundColor=3Dbg e.style.color=3Dclr } } function M_HasPrevSld() { return( parent.HasPrevSld() ) } function M_GoNextSld() { if( gIsEndShow ) M_End(); else GoToNextSld() } function M_GoPrevSld() { if( gIsEndShow ) { gIsEndShow=3D0; history.back();= PPTSld.event.cancelBubble=3Dtrue; } else GoToPrevSld() } function M_True() { return true } function M_End() { window.close( self ) } function CreateMenuItem( node,text,action,eval ) { var e=3DCreateItem( node ) e.type=3D"menuitem" e.Action=3Daction e.IsActive=3Deval e.innerHTML=3Dtext if( !e.IsActive() ) e.style.color=3D"threedshadow" e.onclick=3DPerform e.onmouseover=3DHighlight e.onmouseout=3DDeselect s=3De.style; s.fontFamily=3DsFont s.fontSize=3D"9pt" s.paddingLeft=3D2 } function CreateSeparator( node ) { var sObj=3DCreateItem( node ) SetCMBorder(sObj,"menu","menu") var s=3DsObj.style s.borderTopColor=3D"threedshadow" s.borderBottomColor=3D"threedhighlight" s.height=3D1 s.fontSize=3D"0px" } function CreateItem( node ) { var elem=3DPPTSld.document.createElement("DIV") node.insertBefore( elem ) return elem } function SetCMBorder( o,ltClr,rbClr ) { var s=3Do.style s.backgroundColor=3D"menu" s.borderStyle=3D"solid" s.borderWidth=3D1 s.borderColor=3DltClr+" "+rbClr+" "+rbClr+" "+ltClr } ------=_NextPart_01C8E823.DA10E9A0 Content-Location: file:///C:/8E69C634/Classof2004_files/fullscreen.htm Content-Transfer-Encoding: quoted-printable Content-Type: text/html; charset="windows-1252" ------=_NextPart_01C8E823.DA10E9A0 Content-Location: file:///C:/8E69C634/Classof2004_files/buttons.gif Content-Transfer-Encoding: base64 Content-Type: image/gif R0lGODlhWAESAPf4AAAAAIAAAACAAICAAAAAgIAAgACAgICAgAQEBISEBASEBISEhAQEhMTExAQE /KTM9Pz8/ERERPz8BAT8/KSkpGRkhMTcxCRkxAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAA